BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= QCN28g01.yg.2.1 (513 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|76931655|gb|DV172790.1|DV172790 ZM_BFb0175I05.r ZM_BFb Zea ma... 196 2e-48 gi|78104257|gb|DV522675.1|DV522675 ZM_BFb0208I21.r ZM_BFb Zea ma... 196 2e-48 gi|78107635|gb|DV526053.1|DV526053 ZM_BFb0213I05.r ZM_BFb Zea ma... 196 2e-48 gi|91054955|gb|EB165373.1|EB165373 ZM_BFb0341D07.r ZM_BFb Zea ma... 186 2e-45 gi|76924151|gb|DV169828.1|DV169828 ZM_BFb0169B15.r ZM_BFb Zea ma... 157 2e-36 gi|58082325|gb|AC155464.2| Zea mays strain B73 clone ZMMBBb0518C... 56 4e-06 gi|18174525|gb|BM349913.1|BM349913 MEST258-B03.T3 ISUM5-RN Zea m... 36 4.2 gi|40334995|gb|CK369065.1|CK369065 zmrws055_0B20-002-h06.s0 zmrw... 36 4.2 gi|55741088|gb|AY664418.1| Zea mays cultivar Mo17 locus 9008, co... 36 4.2 gi|88900596|gb|AC183308.1| Zea mays chromosome UNK clone ZMMBBb-... 36 4.2 >gi|76931655|gb|DV172790.1|DV172790 ZM_BFb0175I05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 784 Score = 196 bits (99), Expect = 2e-48 Identities = 102/103 (99%) Strand = Plus / Minus Query: 1 acttccaaggggctaaccagctcaacggatgactttccctcttcaccatttgcttccacg 60 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 490 acttccaaggggctaaccagctcaacggatgactttcccccttcaccatttgcttccacg 431 Query: 61 gccatagaattcatcagtgctgatactaaatctttcttggtac 103 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 430 gccatagaattcatcagtgctgatactaaatctttcttggtac 388 >gi|78104257|gb|DV522675.1|DV522675 ZM_BFb0208I21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 781 Score = 196 bits (99), Expect = 2e-48 Identities = 102/103 (99%) Strand = Plus / Minus Query: 1 acttccaaggggctaaccagctcaacggatgactttccctcttcaccatttgcttccacg 60 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 415 acttccaaggggctaaccagctcaacggatgactttcccccttcaccatttgcttccacg 356 Query: 61 gccatagaattcatcagtgctgatactaaatctttcttggtac 103 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 355 gccatagaattcatcagtgctgatactaaatctttcttggtac 313 >gi|78107635|gb|DV526053.1|DV526053 ZM_BFb0213I05.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 847 Score = 196 bits (99), Expect = 2e-48 Identities = 102/103 (99%) Strand = Plus / Minus Query: 1 acttccaaggggctaaccagctcaacggatgactttccctcttcaccatttgcttccacg 60 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 490 acttccaaggggctaaccagctcaacggatgactttcccccttcaccatttgcttccacg 431 Query: 61 gccatagaattcatcagtgctgatactaaatctttcttggtac 103 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 430 gccatagaattcatcagtgctgatactaaatctttcttggtac 388 >gi|91054955|gb|EB165373.1|EB165373 ZM_BFb0341D07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 809 Score = 186 bits (94), Expect = 2e-45 Identities = 100/102 (98%) Strand = Plus / Minus Query: 2 cttccaaggggctaaccagctcaacggatgactttccctcttcaccatttgcttccacgg 61 |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 423 cttctaaggggctaaccagctcaacggatgactttccctcttcaccatttgcttccatgg 364 Query: 62 ccatagaattcatcagtgctgatactaaatctttcttggtac 103 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 363 ccatagaattcatcagtgctgatactaaatctttcttggtac 322 >gi|76924151|gb|DV169828.1|DV169828 ZM_BFb0169B15.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 530 Score = 157 bits (79), Expect = 2e-36 Identities = 91/95 (95%) Strand = Plus / Minus Query: 9 ggggctaaccagctcaacggatgactttccctcttcaccatttgcttccacggccataga 68 ||||||||||||||||||||||| ||||||| |||| ||||||| ||||||||||||||| Sbjct: 514 ggggctaaccagctcaacggatgcctttcccccttccccatttggttccacggccataga 455 Query: 69 attcatcagtgctgatactaaatctttcttggtac 103 ||||||||||||||||||||||||||||||||||| Sbjct: 454 attcatcagtgctgatactaaatctttcttggtac 420 >gi|58082325|gb|AC155464.2| Zea mays strain B73 clone ZMMBBb0518C23, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 119773 Score = 56.0 bits (28), Expect = 4e-06 Identities = 49/56 (87%) Strand = Plus / Minus Query: 430 ccttctagcatccaggtttgtagggacatccatagccgattccttcaccgtgagta 485 |||||| || || ||||||| ||| ||||||||||| |||||||||||||| |||| Sbjct: 63470 ccttctggcttctaggtttgaaggaacatccatagcagattccttcaccgtaagta 63415 >gi|18174525|gb|BM349913.1|BM349913 MEST258-B03.T3 ISUM5-RN Zea mays cDNA clone MEST258-B03 3', mRNA sequence Length = 561 Score = 36.2 bits (18), Expect = 4.2 Identities = 18/18 (100%) Strand = Plus / Minus Query: 252 ttttttgcaaataaaaaa 269 |||||||||||||||||| Sbjct: 49 ttttttgcaaataaaaaa 32 >gi|40334995|gb|CK369065.1|CK369065 zmrws055_0B20-002-h06.s0 zmrws055 Zea mays cDNA 5', mRNA sequence Length = 706 Score = 36.2 bits (18), Expect = 4.2 Identities = 24/26 (92%) Strand = Plus / Minus Query: 150 cccaaaggcgaagctgctcttcagaa 175 |||||| |||||||||||| |||||| Sbjct: 702 cccaaaagcgaagctgctcatcagaa 677 >gi|55741088|gb|AY664418.1| Zea mays cultivar Mo17 locus 9008, complete sequence Length = 282600 Score = 36.2 bits (18), Expect = 4.2 Identities = 18/18 (100%) Strand = Plus / Minus Query: 259 caaataaaaaaggatgga 276 |||||||||||||||||| Sbjct: 27385 caaataaaaaaggatgga 27368 >gi|88900596|gb|AC183308.1| Zea mays chromosome UNK clone ZMMBBb-333D19; ZMMBBb0333D19, *** SEQUENCING IN PROGRESS ***, 10 unordered pieces Length = 153567 Score = 36.2 bits (18), Expect = 4.2 Identities = 18/18 (100%) Strand = Plus / Plus Query: 259 caaataaaaaaggatgga 276 |||||||||||||||||| Sbjct: 9016 caaataaaaaaggatgga 9033 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 190,578 Number of Sequences: 836351 Number of extensions: 190578 Number of successful extensions: 14212 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 14185 Number of HSP's gapped (non-prelim): 27 length of query: 513 length of database: 669,372,029 effective HSP length: 19 effective length of query: 494 effective length of database: 653,481,360 effective search space: 322819791840 effective search space used: 322819791840 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)