BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= QCH13e05.yg.2.1 (577 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|88753660|gb|DY537801.1|DY537801 ZM_BFb0281A07.f ZM_BFb Zea ma... 468 e-130 gi|32800137|gb|CD952373.1|CD952373 SBB_89 GeneTag2 Zea mays cDNA... 168 5e-40 gi|14203609|gb|BG837286.1|BG837286 Zm10_07g05_A Zm10_AAFC_ECORC_... 40 0.30 gi|32857404|gb|CD997085.1|CD997085 QBD3d02.xg QBD Zea mays cDNA ... 40 0.30 gi|32864244|gb|CF003926.1|CF003926 QBH24d05.pg QBH Zea mays cDNA... 40 0.30 gi|32907749|gb|CF012562.1|CF012562 QBK18d11.xg QBK Zea mays cDNA... 40 0.30 gi|32929394|gb|CF034206.1|CF034206 QCF2d09.yg QCF Zea mays cDNA ... 40 0.30 gi|66841007|emb|AJ890023.1| Zea mays partial mRNA for KED-like p... 40 0.30 gi|66841007|emb|AJ890023.1| Zea mays partial mRNA for KED-like p... 40 0.30 gi|5871619|gb|AW018090.1|AW018090 614066F08.x1 614 - root cDNA l... 38 1.2 gi|6031496|gb|AW076398.1|AW076398 614066F08.y1 614 - root cDNA l... 38 1.2 gi|28987472|gb|CB351652.1|CB351652 3529_1_42_1_G10.y_1 3529 - 2 ... 38 1.2 gi|71422070|gb|DR805609.1|DR805609 ZM_BFb0031C21.r ZM_BFb Zea ma... 38 1.2 gi|78022953|gb|DV491340.1|DV491340 1000034-B04.T7-1 UGI-Reseq Ze... 38 1.2 gi|91630496|gb|AC185109.1| Zea mays chromosome UNK clone ZMMBBb-... 38 1.2 gi|91206510|gb|AC184858.1| Zea mays chromosome UNK clone CH201-1... 38 1.2 gi|58082329|gb|AC155468.2| Zea mays strain B73 clone ZMMBBb0530P... 38 1.2 gi|71319768|gb|DR796641.1|DR796641 ZM_BFb0018G02.r ZM_BFb Zea ma... 36 4.7 gi|78106820|gb|DV525238.1|DV525238 ZM_BFb0212F09.r ZM_BFb Zea ma... 36 4.7 gi|89257770|gb|AC177818.2| Zea mays chromosome UNK clone CH201-2... 36 4.7 gi|48762564|gb|AC146796.5| Zea mays clone ZMMBBb0356D13, *** SEQ... 36 4.7 >gi|88753660|gb|DY537801.1|DY537801 ZM_BFb0281A07.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 676 Score = 468 bits (236), Expect = e-130 Identities = 290/308 (94%) Strand = Plus / Plus Query: 140 tcaagaacgttttagcgtgaaggtgtctattcaagcaacggccaacagcagccaccgtaa 199 |||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||| Sbjct: 369 tcaagaacgttttagcgtgacggtgtctgttcaagcaacggccaacagcaaccaccgtaa 428 Query: 200 cataaaacaccattcgcatgatttctgttattctttgcaacatgttcctcgttttgtttt 259 ||||| || |||| |||| || ||||||||||||||||||||||||||||||||||||| Sbjct: 429 aataaagcatcatttgcattatctctgttattctttgcaacatgttcctcgttttgtttt 488 Query: 260 ctgaaactgatcccagaggcacatcatatcccttggttcttggtaatgagcaatcacata 319 |||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||| Sbjct: 489 ctgaaacttatcccagaggcacatcatatcccttggttcttgggagtgagcaatcacata 548 Query: 320 gccatcctcgcatccttcaaccaaaatcctcccatcattctcatacttgacatccaagcc 379 ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| Sbjct: 549 cccatcctcgcatccttcaaccaagatcctcccatcattcttatacttgacatccaagcc 608 Query: 380 atccttcttcatctcattgatccatattcccattgcgacatcctccagcttgaacatctt 439 ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 609 atccttcttcatctcattgatccatattcccatcgcgacatcctccagcttgaaaatctt 668 Query: 440 taactccc 447 ||| |||| Sbjct: 669 taattccc 676 Score = 54.0 bits (27), Expect = 2e-05 Identities = 40/43 (93%), Gaps = 1/43 (2%) Strand = Plus / Plus Query: 21 tagtttgacttgaaactcttcaaactgcagacgaaacaaactt 63 |||||||||| |||||||||||||||| |||||||||||||| Sbjct: 255 tagtttgactagaaactcttcaaactg-ggacgaaacaaactt 296 >gi|32800137|gb|CD952373.1|CD952373 SBB_89 GeneTag2 Zea mays cDNA, mRNA sequence Length = 120 Score = 168 bits (85), Expect = 5e-40 Identities = 110/117 (94%), Gaps = 1/117 (0%) Strand = Plus / Plus Query: 462 ctgtaaacttctttagctatgtc-ctttgaaacaatatatcctggtccatgcgcccaggg 520 ||||||||||||||| ||||||| ||||||||||||||||||| || ||||||||||||| Sbjct: 4 ctgtaaacttctttatctatgtcactttgaaacaatatatccttgtacatgcgcccaggg 63 Query: 521 aggataactctcctcaggccattcctcaggggttatgtaccacttgctatacggatc 577 |||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||| Sbjct: 64 aggataactctcctcatgccattcctcaggggttatgtaccatttgctatatggatc 120 >gi|14203609|gb|BG837286.1|BG837286 Zm10_07g05_A Zm10_AAFC_ECORC_Fusarium_graminearum_corn_silk Zea mays cDNA clone Zm10_07g05, mRNA sequence Length = 972 Score = 40.1 bits (20), Expect = 0.30 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 ccttccagttccagctcttt 110 |||||||||||||||||||| Sbjct: 293 ccttccagttccagctcttt 312 >gi|32857404|gb|CD997085.1|CD997085 QBD3d02.xg QBD Zea mays cDNA clone QBD3d02, mRNA sequence Length = 514 Score = 40.1 bits (20), Expect = 0.30 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 ccttccagttccagctcttt 110 |||||||||||||||||||| Sbjct: 179 ccttccagttccagctcttt 160 >gi|32864244|gb|CF003926.1|CF003926 QBH24d05.pg QBH Zea mays cDNA clone QBH24d05, mRNA sequence Length = 557 Score = 40.1 bits (20), Expect = 0.30 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 ccttccagttccagctcttt 110 |||||||||||||||||||| Sbjct: 448 ccttccagttccagctcttt 467 >gi|32907749|gb|CF012562.1|CF012562 QBK18d11.xg QBK Zea mays cDNA clone QBK18d11, mRNA sequence Length = 475 Score = 40.1 bits (20), Expect = 0.30 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 ccttccagttccagctcttt 110 |||||||||||||||||||| Sbjct: 146 ccttccagttccagctcttt 127 >gi|32929394|gb|CF034206.1|CF034206 QCF2d09.yg QCF Zea mays cDNA clone QCF2d09, mRNA sequence Length = 441 Score = 40.1 bits (20), Expect = 0.30 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 ccttccagttccagctcttt 110 |||||||||||||||||||| Sbjct: 44 ccttccagttccagctcttt 63 >gi|66841007|emb|AJ890023.1| Zea mays partial mRNA for KED-like protein (1-19 gene), cultivar A69Y, from endosperm tissue Length = 562 Score = 40.1 bits (20), Expect = 0.30 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 ccttccagttccagctcttt 110 |||||||||||||||||||| Sbjct: 206 ccttccagttccagctcttt 187 >gi|66841007|emb|AJ890023.1| Zea mays partial mRNA for KED-like protein (1-19 gene), cultivar A69Y, from endosperm tissue Length = 562 Score = 40.1 bits (20), Expect = 0.30 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 ccttccagttccagctcttt 110 |||||||||||||||||||| Sbjct: 206 ccttccagttccagctcttt 187 >gi|5871619|gb|AW018090.1|AW018090 614066F08.x1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 530 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 92 cttccagttccagctcttt 110 ||||||||||||||||||| Sbjct: 315 cttccagttccagctcttt 333 >gi|6031496|gb|AW076398.1|AW076398 614066F08.y1 614 - root cDNA library from Walbot Lab Zea mays cDNA, mRNA sequence Length = 548 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 92 cttccagttccagctcttt 110 ||||||||||||||||||| Sbjct: 189 cttccagttccagctcttt 171 >gi|28987472|gb|CB351652.1|CB351652 3529_1_42_1_G10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 624 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 414 gcgacatcctccagcttga 432 ||||||||||||||||||| Sbjct: 624 gcgacatcctccagcttga 606 >gi|71422070|gb|DR805609.1|DR805609 ZM_BFb0031C21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 792 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 196 gtaacataaaacaccattc 214 ||||||||||||||||||| Sbjct: 592 gtaacataaaacaccattc 574 >gi|78022953|gb|DV491340.1|DV491340 1000034-B04.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 572 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 92 cttccagttccagctcttt 110 ||||||||||||||||||| Sbjct: 356 cttccagttccagctcttt 374 >gi|91630496|gb|AC185109.1| Zea mays chromosome UNK clone ZMMBBb-585B15; ZMMBBb0585B15, *** SEQUENCING IN PROGRESS ***, 11 unordered pieces Length = 118555 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 500 tcctggtccatgcgcccag 518 ||||||||||||||||||| Sbjct: 85209 tcctggtccatgcgcccag 85191 >gi|91206510|gb|AC184858.1| Zea mays chromosome UNK clone CH201-189H18; ZMMBBc0189H18, *** SEQUENCING IN PROGRESS ***, 14 unordered pieces Length = 178916 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 382 ccttcttcatctcattgat 400 ||||||||||||||||||| Sbjct: 174068 ccttcttcatctcattgat 174050 >gi|58082329|gb|AC155468.2| Zea mays strain B73 clone ZMMBBb0530P04, *** SEQUENCING IN PROGRESS ***, 10 unordered pieces Length = 113669 Score = 38.2 bits (19), Expect = 1.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 512 cgcccagggaggataactc 530 ||||||||||||||||||| Sbjct: 47471 cgcccagggaggataactc 47489 >gi|71319768|gb|DR796641.1|DR796641 ZM_BFb0018G02.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 559 Score = 36.2 bits (18), Expect = 4.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 555 atgtaccacttgctatac 572 |||||||||||||||||| Sbjct: 431 atgtaccacttgctatac 448 >gi|78106820|gb|DV525238.1|DV525238 ZM_BFb0212F09.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 818 Score = 36.2 bits (18), Expect = 4.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 378 ccatccttcttcatctca 395 |||||||||||||||||| Sbjct: 151 ccatccttcttcatctca 168 >gi|89257770|gb|AC177818.2| Zea mays chromosome UNK clone CH201-231C8; ZMMBBc0231C08, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces Length = 173273 Score = 36.2 bits (18), Expect = 4.7 Identities = 18/18 (100%) Strand = Plus / Plus Query: 53 gaaacaaacttgaagata 70 |||||||||||||||||| Sbjct: 91747 gaaacaaacttgaagata 91764 >gi|48762564|gb|AC146796.5| Zea mays clone ZMMBBb0356D13, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces Length = 139195 Score = 36.2 bits (18), Expect = 4.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 atgatttctgttattctt 234 |||||||||||||||||| Sbjct: 121028 atgatttctgttattctt 121011 Score = 36.2 bits (18), Expect = 4.7 Identities = 18/18 (100%) Strand = Plus / Minus Query: 217 atgatttctgttattctt 234 |||||||||||||||||| Sbjct: 114042 atgatttctgttattctt 114025 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 207,391 Number of Sequences: 836351 Number of extensions: 207391 Number of successful extensions: 14942 Number of sequences better than 10.0: 21 Number of HSP's better than 10.0 without gapping: 21 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 14904 Number of HSP's gapped (non-prelim): 36 length of query: 577 length of database: 669,372,029 effective HSP length: 19 effective length of query: 558 effective length of database: 653,481,360 effective search space: 364642598880 effective search space used: 364642598880 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)