BLASTN 2.2.6 [Apr-09-2003] BLASTN 2.2.6 [Apr-09-2003] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 3829406.2.1 (673 letters) Database: mais_NCBI.fasta 836,351 sequences; 669,372,029 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gi|37376645|gb|CF624874.1|CF624874 zmrws05_0A20-010-c09.s4 zmrws... 1132 0.0 gi|15082605|gb|BI389289.1|BI389289 949052C01.x2 949 - Juvenile l... 1128 0.0 gi|37390604|gb|CF632534.1|CF632534 zmrws48_0B20-005-c01.s4 zmrws... 1118 0.0 gi|37381429|gb|CF627600.1|CF627600 zmrws05_0B20-013-b12.s3 zmrws... 991 0.0 gi|15188058|gb|BI417035.1|BI417035 949052C01.y1 949 - Juvenile l... 821 0.0 gi|15589451|gb|BI674067.1|BI674067 949052C01.Y1 949 - Juvenile l... 821 0.0 gi|6952678|gb|AW424746.1|AW424746 707064C07.y1 707 - Mixed adult... 682 0.0 gi|15188089|gb|BI417066.1|BI417066 949052F11.y1 949 - Juvenile l... 676 0.0 gi|15589482|gb|BI674098.1|BI674098 949052F11.Y1 949 - Juvenile l... 676 0.0 gi|78180782|gb|DV551155.1|DV551155 1000063-E10.GAD10-F UGI-Reseq... 658 0.0 gi|37384451|gb|CF629299.1|CF629299 zmrws48_0A10-015-f07.s4 zmrws... 646 0.0 gi|12046382|gb|BF728521.1|BF728521 1000063E10.x1 1000 - Unigene ... 607 e-172 gi|32833926|gb|CD973604.1|CD973604 QAE36f02.yg QAE Zea mays cDNA... 523 e-147 gi|32832593|gb|CD972271.1|CD972271 QAE1e10.yg QAE Zea mays cDNA ... 492 e-137 gi|18181550|gb|BM382760.1|BM382760 MEST554-D03.univ ISUM6 Zea ma... 458 e-127 gi|21209883|gb|AY106805.1| Zea mays PCO131201 mRNA sequence 351 7e-95 gi|21209883|gb|AY106805.1| Zea mays PCO131201 mRNA sequence 351 7e-95 gi|71319077|gb|DR796291.1|DR796291 ZM_BFb0017N12.r ZM_BFb Zea ma... 335 4e-90 gi|71442838|gb|DR823888.1|DR823888 ZM_BFb0065F04.r ZM_BFb Zea ma... 335 4e-90 gi|78122176|gb|DV540560.1|DV540560 ZM_BFb0234P01.r ZM_BFb Zea ma... 335 4e-90 gi|91053034|gb|EB163452.1|EB163452 ZM_BFb0311F12.r ZM_BFb Zea ma... 335 4e-90 gi|91053373|gb|EB163791.1|EB163791 ZM_BFb0311N12.r ZM_BFb Zea ma... 335 4e-90 gi|91057111|gb|EB167529.1|EB167529 ZM_BFb0382J21.r ZM_BFb Zea ma... 335 4e-90 gi|33466455|gb|CF243504.1|CF243504 3530_1_21_1_F01.x_1 3530 - Fu... 327 1e-87 gi|37376852|gb|CF624986.1|CF624986 zmrws05_0A20-011-f07.s3 zmrws... 327 1e-87 gi|50332028|gb|CO527154.1|CO527154 3530_1_17_1_F01.x_1 3530 - Fu... 327 1e-87 gi|37385212|gb|CF629732.1|CF629732 zmrws48_0A20-004-g07.s4 zmrws... 319 3e-85 gi|89250396|gb|DY622182.1|DY622182 ZM_BFb0287I01.f ZM_BFb Zea ma... 319 3e-85 gi|74241426|gb|DT649340.1|DT649340 ZM_BFb0111P07.r ZM_BFb Zea ma... 303 2e-80 gi|37384071|gb|CF629081.1|CF629081 zmrws48_0A10-013-c01.s4 zmrws... 264 1e-68 gi|60400235|gb|DN233042.1|DN233042 MEST916_G02.T7-1 UGA-ZmSAM-XZ... 258 8e-67 gi|33467441|gb|CF244490.1|CF244490 3530_1_2_1_E03.y_1 3530 - Ful... 256 3e-66 gi|15188055|gb|BI417032.1|BI417032 949052B09.y1 949 - Juvenile l... 248 8e-64 gi|15589448|gb|BI674064.1|BI674064 949052B09.Y1 949 - Juvenile l... 248 8e-64 gi|28985891|gb|CB350867.1|CB350867 MEST257-B03.univ ISUM5-RN Zea... 236 3e-60 gi|18174954|gb|BM350342.1|BM350342 MEST264-D12.T3 ISUM5-RN Zea m... 232 5e-59 gi|78025280|gb|DV493667.1|DV493667 1000107-G04.T7-1 UGI-Reseq Ze... 228 7e-58 gi|18175613|gb|BM350864.1|BM350864 MEST214-G08.T3 ISUM5-RN Zea m... 224 1e-56 gi|15080611|gb|BI389127.1|BI389127 949052F11.x1 949 - Juvenile l... 194 1e-47 gi|78122175|gb|DV540559.1|DV540559 ZM_BFb0234P01.f ZM_BFb Zea ma... 167 2e-39 gi|18170563|gb|BM340403.1|BM340403 MEST322-C05.T3 ISUM5-RN Zea m... 159 6e-37 gi|4826186|gb|AI667814.1|AI667814 605028E10.x1 605 - Endosperm c... 157 2e-36 gi|5740408|gb|AI948098.1|AI948098 603034E12.x1 603 - stressed ro... 143 3e-32 gi|6989656|gb|AW447869.1|AW447869 707081D06.x1 707 - Mixed adult... 143 3e-32 gi|18179707|gb|BM380917.1|BM380917 MEST527-B05.univ ISUM6 Zea ma... 143 3e-32 gi|21620943|gb|BQ618949.1|BQ618949 RNOSEQ1F12_T3.ab1 Salt stress... 143 3e-32 gi|21620988|gb|BQ618994.1|BQ618994 RNOSEQ2D06_SK.ab1 Salt stress... 143 3e-32 gi|21621069|gb|BQ619075.1|BQ619075 RNOSEQ3D12_SK.ab1 Salt stress... 143 3e-32 gi|21621121|gb|BQ619127.1|BQ619127 RNOSEQ4B02_SK.ab1 Salt stress... 143 3e-32 gi|21621130|gb|BQ619136.1|BQ619136 RNOSEQ4B09_SK.ab1 Salt stress... 143 3e-32 gi|21621136|gb|BQ619142.1|BQ619142 RNOSEQ4C03_SK.ab1 Salt stress... 143 3e-32 gi|21621163|gb|BQ619169.1|BQ619169 RNOSEQ4E07_SK.ab1 Salt stress... 143 3e-32 gi|21621167|gb|BQ619173.1|BQ619173 RNOSEQ4E11_SK.ab1 Salt stress... 143 3e-32 gi|21621509|gb|BQ619515.1|BQ619515 RESEQ1B09_SK.ab1 Salt stresse... 143 3e-32 gi|21211983|gb|AY108760.1| Zea mays PCO149616 mRNA sequence 143 3e-32 gi|21211983|gb|AY108760.1| Zea mays PCO149616 mRNA sequence 143 3e-32 gi|28986153|gb|CB350995.1|CB350995 MEST258-H05.univ ISUM5-RN Zea... 139 5e-31 gi|18650158|gb|BM498977.1|BM498977 949006C06.x1 949 - Juvenile l... 135 8e-30 gi|32835368|gb|CD975046.1|CD975046 QAE52g06.yg QAE Zea mays cDNA... 135 8e-30 gi|32836216|gb|CD975894.1|CD975894 QAF10f02.yg QAF Zea mays cDNA... 131 1e-28 gi|18660945|gb|BM501131.1|BM501131 PAC000000001197 Pioneer AF-1 ... 127 2e-27 gi|32837549|gb|CD977227.1|CD977227 QAF27g08.yg QAF Zea mays cDNA... 127 2e-27 gi|32837810|gb|CD977488.1|CD977488 QAF30d09.yg QAF Zea mays cDNA... 127 2e-27 gi|32839158|gb|CD978839.1|CD978839 QAF5g05.yg QAF Zea mays cDNA ... 127 2e-27 gi|16920407|gb|BM074642.1|BM074642 MEST295-F07.T3 ISUM5-RN Zea m... 115 7e-24 gi|37376238|gb|CF624627.1|CF624627 zmrws05_0A20-005-h03.s4 zmrws... 92 1e-16 gi|60343504|gb|DN210477.1|DN210477 MEST898_H09.T7-1 UGA-ZmSAM-XZ... 92 1e-16 gi|67027654|gb|CO456403.1|CO456403 MZCCS15005H08.g Maize Endospe... 92 1e-16 gi|5018475|gb|AI714668.1|AI714668 605068H12.x1 605 - Endosperm c... 86 7e-15 gi|14569314|gb|BI097637.1|BI097637 949016E02.y1 949 - Juvenile l... 84 3e-14 gi|45846919|gb|CN070862.1|CN070862 1021004D11.x2 1021 - Unigene ... 84 3e-14 gi|60352067|gb|DN219040.1|DN219040 MEST1075_E10.T7-1 UGA-ZmSAM-X... 84 3e-14 gi|21211129|gb|AY108051.1| Zea mays PCO108087 mRNA sequence 84 3e-14 gi|21211129|gb|AY108051.1| Zea mays PCO108087 mRNA sequence 84 3e-14 gi|5525288|gb|AI861127.1|AI861127 603012E07.x1 603 - stressed ro... 68 2e-09 gi|17931129|gb|BM268089.1|BM268089 MEST376-E07.T3 ISUM5-RN Zea m... 48 0.001 gi|50339380|gb|CO534506.1|CO534506 3530_1_228_1_A08.y_1 3530 - F... 40 0.35 gi|71448143|gb|DR829193.1|DR829193 ZM_BFb0074N20.r ZM_BFb Zea ma... 40 0.35 gi|93014290|gb|EB639810.1|EB639810 ZM_BFb0328A07.r ZM_BFb Zea ma... 40 0.35 gi|91065017|gb|AC184793.1| Zea mays chromosome UNK clone CH201-1... 40 0.35 gi|71450303|gb|DR831353.1|DR831353 ZM_BFb0079O18.r ZM_BFb Zea ma... 38 1.4 gi|4775809|gb|AI657401.2|AI657401 605001E01.x1 605 - Endosperm c... 36 5.5 gi|4826106|gb|AI667734.1|AI667734 605026F09.x1 605 - Endosperm c... 36 5.5 gi|4885770|gb|AI676890.1|AI676890 605046D04.x1 605 - Endosperm c... 36 5.5 gi|4885810|gb|AI676930.1|AI676930 605046H04.x1 605 - Endosperm c... 36 5.5 gi|5005680|gb|AI711742.1|AI711742 605061A09.x1 605 - Endosperm c... 36 5.5 gi|5005823|gb|AI711885.1|AI711885 605066F05.x1 605 - Endosperm c... 36 5.5 gi|5006004|gb|AI712066.1|AI712066 605062A10.x1 605 - Endosperm c... 36 5.5 gi|5069683|gb|AI737648.1|AI737648 605036C06.x2 605 - Endosperm c... 36 5.5 gi|5124324|gb|AI746060.1|AI746060 605079E06.x1 605 - Endosperm c... 36 5.5 gi|5455972|gb|AI833662.1|AI833662 605093F01.x1 605 - Endosperm c... 36 5.5 gi|5456162|gb|AI833852.1|AI833852 605096C07.x2 605 - Endosperm c... 36 5.5 gi|5761986|gb|AI967034.1|AI967034 496020D06.x1 496 - stressed sh... 36 5.5 gi|5928828|gb|AW056120.1|AW056120 660004D12.y1 660 - Mixed stage... 36 5.5 gi|7216943|gb|AW563050.1|AW563050 660071G03.y1 660 - Mixed stage... 36 5.5 gi|7227766|gb|AW566407.1|AW566407 660071G03.X1 660 - Mixed stage... 36 5.5 gi|8577326|gb|BE129963.1|BE129963 945033H04.X1 945 - Mixed adult... 36 5.5 gi|8665586|gb|BE186402.1|BE186402 946005E02.X3 946 - tassel prim... 36 5.5 gi|8665737|gb|BE186553.1|BE186553 946008B06.X1 946 - tassel prim... 36 5.5 gi|8665286|gb|BE186102.1|BE186102 946005E02.X2 946 - tassel prim... 36 5.5 gi|9733877|gb|BE512629.1|BE512629 946073G03.x1 946 - tassel prim... 36 5.5 gi|9794419|gb|BE552727.1|BE552727 946084H04.y1 946 - tassel prim... 36 5.5 gi|14202690|gb|BG836367.1|BG836367 Zm06_02b10_R Zm06_AAFC_ECORC_... 36 5.5 gi|14203314|gb|BG836991.1|BG836991 Zm08_08g11_A Zm08_AAFC_ECORC_... 36 5.5 gi|14242650|gb|BG840385.2|BG840385 MEST12-B11.T7-1 ISUM4-TN Zea ... 36 5.5 gi|14243150|gb|BG840815.2|BG840815 MEST12-B11.T3 ISUM4-TN Zea ma... 36 5.5 gi|14996977|gb|BI319098.1|BI319098 949039C09.x2 949 - Juvenile l... 36 5.5 gi|15057175|gb|BI361147.1|BI361147 949056E02.x2 949 - Juvenile l... 36 5.5 gi|15199168|gb|BI423693.1|BI423693 949056E02.y1 949 - Juvenile l... 36 5.5 gi|15214934|gb|BI431103.1|BI431103 949069F03.x1 949 - Juvenile l... 36 5.5 gi|15499643|gb|BI596156.1|BI596156 949078F08.x1 949 - Juvenile l... 36 5.5 gi|15632660|gb|BI679753.1|BI679753 949078F08.y2 949 - Juvenile l... 36 5.5 gi|16920487|gb|BM074680.1|BM074680 MEST296-B10.T3 ISUM5-RN Zea m... 36 5.5 gi|16925858|gb|BM078926.1|BM078926 MEST87-A11.T3 ISUM4-TN Zea ma... 36 5.5 gi|17931611|gb|BM268571.1|BM268571 MEST397-C12.univ ISUM5-RN Zea... 36 5.5 gi|17932055|gb|BM269015.1|BM269015 MEST403-E12.univ ISUM5-RN Zea... 36 5.5 gi|18167674|gb|BM337514.1|BM337514 MEST208-A02.T3 ISUM5-RN Zea m... 36 5.5 gi|18172933|gb|BM348321.1|BM348321 MEST289-C11.T3 ISUM5-RN Zea m... 36 5.5 gi|18178107|gb|BM379317.1|BM379317 MEST503-H07.univ ISUM6 Zea ma... 36 5.5 gi|18180064|gb|BM381274.1|BM381274 MEST532-D12.univ ISUM6 Zea ma... 36 5.5 gi|19436381|gb|BM952791.1|BM952791 952059B07.x1 952 - BMS tissue... 36 5.5 gi|19769359|gb|BQ034080.1|BQ034080 1091001G07.x2 1091 - Immature... 36 5.5 gi|19769763|gb|BQ034484.1|BQ034484 1091001G07.x3 1091 - Immature... 36 5.5 gi|19769820|gb|BQ034541.1|BQ034541 1091003F05.x2 1091 - Immature... 36 5.5 gi|19821976|gb|BQ047985.1|BQ047985 1091001C08.y1 1091 - Immature... 36 5.5 gi|19822096|gb|BQ048120.1|BQ048120 1091003B06.y1 1091 - Immature... 36 5.5 gi|19822254|gb|BQ048278.1|BQ048278 1091005F01.y1 1091 - Immature... 36 5.5 gi|19822286|gb|BQ048310.1|BQ048310 1091006B02.y1 1091 - Immature... 36 5.5 gi|22520720|gb|BU079531.1|BU079531 946145B05.y1 946 - tassel pri... 36 5.5 gi|22546042|gb|BU098363.1|BU098363 946134F06.y1 946 - tassel pri... 36 5.5 gi|22819022|gb|BU499112.1|BU499112 946172D01.y1 946 - tassel pri... 36 5.5 gi|24768226|gb|CA403355.1|CA403355 EL01N0450E09.g Endosperm_4 Ze... 36 5.5 gi|26455865|gb|CA827448.1|CA827448 1114014H05.y3 1114 - Unigene ... 36 5.5 gi|26557536|gb|CA829771.1|CA829771 3529_1_8_1_G10.y_1 3529 - 2 m... 36 5.5 gi|26557773|gb|CA830008.1|CA830008 3529_1_3_1_E12.y_1 3529 - 2 m... 36 5.5 gi|28568851|gb|CB280726.1|CB280726 3529_1_14_1_B03.y_5 3529 - 2 ... 36 5.5 gi|28568886|gb|CB280761.1|CB280761 3529_1_14_1_E12.y_5 3529 - 2 ... 36 5.5 gi|28873438|gb|CB329428.1|CB329428 3529_1_30_1_A07.y_1 3529 - 2 ... 36 5.5 gi|28873923|gb|CB329848.1|CB329848 3529_1_24_1_E08.x_1 3529 - 2 ... 36 5.5 gi|28873924|gb|CB329849.1|CB329849 3529_1_24_1_E08.y_1 3529 - 2 ... 36 5.5 gi|28909552|gb|CB330986.1|CB330986 3529_1_25_1_G01.y_1 3529 - 2 ... 36 5.5 gi|28910005|gb|CB331209.1|CB331209 3529_1_34_1_F11.y_1 3529 - 2 ... 36 5.5 gi|28910256|gb|CB331348.1|CB331348 3529_1_36_1_D09.y_1 3529 - 2 ... 36 5.5 gi|28910914|gb|CB331678.1|CB331678 3529_1_34_1_F11.x_1 3529 - 2 ... 36 5.5 gi|28930793|gb|CB334154.1|CB334154 3529_1_21_1_A01.y_2 3529 - 2 ... 36 5.5 gi|28930825|gb|CB334186.1|CB334186 3529_1_21_1_C12.y_2 3529 - 2 ... 36 5.5 gi|28931147|gb|CB334508.1|CB334508 3529_1_25_1_G01.x_1 3529 - 2 ... 36 5.5 gi|28986952|gb|CB351390.1|CB351390 3529_1_22_1_D01.x_4 3529 - 2 ... 36 5.5 gi|29167751|gb|CB411011.1|CB411011 3529_1_48_1_E10.y_1 3529 - 2 ... 36 5.5 gi|29167956|gb|CB411216.1|CB411216 3529_1_60_1_D01.y_1 3529 - 2 ... 36 5.5 gi|29577010|gb|CB617122.1|CB617122 3529_1_69_1_B08.y_1 3529 - 2 ... 36 5.5 gi|30031732|gb|CB833583.1|CB833583 3529_1_82_1_C09.y_1 3529 - 2 ... 36 5.5 gi|30031754|gb|CB833605.1|CB833605 3529_1_82_1_E10.y_1 3529 - 2 ... 36 5.5 gi|30032031|gb|CB833882.1|CB833882 3529_1_85_1_A03.x_1 3529 - 2 ... 36 5.5 gi|30086987|gb|CB885195.1|CB885195 3529_1_82_1_C09.x_1 3529 - 2 ... 36 5.5 gi|30087009|gb|CB885217.1|CB885217 3529_1_82_1_E10.x_1 3529 - 2 ... 36 5.5 gi|30087048|gb|CB885256.1|CB885256 3529_1_85_1_A03.y_1 3529 - 2 ... 36 5.5 gi|30087136|gb|CB885344.1|CB885344 3529_1_86_1_B12.y_1 3529 - 2 ... 36 5.5 gi|30088308|gb|CB886513.1|CB886513 3529_1_96_1_C04.x_1 3529 - 2 ... 36 5.5 gi|30705133|gb|CD058670.1|CD058670 3529_1_105_1_H04.x_1 3529 - 2... 36 5.5 gi|30705137|gb|CD058671.1|CD058671 3529_1_105_1_H04.y_1 3529 - 2... 36 5.5 gi|30705480|gb|CD058796.1|CD058796 3529_1_107_1_C10.y_1 3529 - 2... 36 5.5 gi|30705498|gb|CD058802.1|CD058802 3529_1_107_1_D06.y_1 3529 - 2... 36 5.5 gi|30705595|gb|CD058837.1|CD058837 3529_1_107_1_H04.y_1 3529 - 2... 36 5.5 gi|30706033|gb|CD059007.1|CD059007 3529_1_107_1_A09.x_1 3529 - 2... 36 5.5 gi|30706104|gb|CD059029.1|CD059029 3529_1_107_1_C10.x_1 3529 - 2... 36 5.5 gi|30706127|gb|CD059036.1|CD059036 3529_1_107_1_D06.x_1 3529 - 2... 36 5.5 gi|30706239|gb|CD059074.1|CD059074 3529_1_107_1_H04.x_1 3529 - 2... 36 5.5 gi|29129698|gb|CB380402.1|CB380402 3529_1_21_1_C12.x_2 3529 - 2 ... 36 5.5 gi|29129757|gb|CB380461.1|CB380461 3529_1_22_1_D01.y_2 3529 - 2 ... 36 5.5 gi|29129842|gb|CB380546.1|CB380546 3529_1_21_1_A01.x_4 3529 - 2 ... 36 5.5 gi|29129873|gb|CB380577.1|CB380577 3529_1_21_1_C12.x_4 3529 - 2 ... 36 5.5 gi|29130055|gb|CB380759.1|CB380759 3529_1_24_1_E08.x_4 3529 - 2 ... 36 5.5 gi|29130336|gb|CB381040.1|CB381040 3529_1_49_1_G09.y_1 3529 - 2 ... 36 5.5 gi|29130355|gb|CB381059.1|CB381059 3529_1_50_1_A08.y_1 3529 - 2 ... 36 5.5 gi|29130705|gb|CB381409.1|CB381409 3529_1_46_1_H08.y_1 3529 - 2 ... 36 5.5 gi|29543403|gb|CB603799.1|CB603799 3529_1_54_1_G05.x_1 3529 - 2 ... 36 5.5 gi|29543726|gb|CB604106.1|CB604106 3529_1_54_1_G05.y_1 3529 - 2 ... 36 5.5 gi|29544048|gb|CB604428.1|CB604428 3529_1_63_1_B12.x_1 3529 - 2 ... 36 5.5 gi|29544534|gb|CB604914.1|CB604914 3529_1_63_1_B12.y_1 3529 - 2 ... 36 5.5 gi|29544664|gb|CB605044.1|CB605044 3529_1_59_1_A09.x_1 3529 - 2 ... 36 5.5 gi|29544768|gb|CB605376.1|CB605376 3529_1_60_1_D01.x_1 3529 - 2 ... 36 5.5 gi|29544989|gb|CB605167.1|CB605167 3529_1_69_1_B08.x_1 3529 - 2 ... 36 5.5 gi|29945828|gb|CB815840.1|CB815840 3529_1_77_1_D12.x_1 3529 - 2 ... 36 5.5 gi|29945879|gb|CB815866.1|CB815866 3529_1_77_1_G07.x_1 3529 - 2 ... 36 5.5 gi|29946882|gb|CB816371.1|CB816371 3529_1_77_1_D12.y_1 3529 - 2 ... 36 5.5 gi|29946935|gb|CB816398.1|CB816398 3529_1_77_1_G07.y_1 3529 - 2 ... 36 5.5 gi|31353146|gb|CD437503.1|CD437503 EL01N0501F11.b Endosperm_5 Ze... 36 5.5 gi|31360994|gb|CD445351.1|CD445351 EL01N0450E09.b Endosperm_4 Ze... 36 5.5 gi|31405928|gb|CD484660.1|CD484660 3529_1_116_1_B12.x_1 3529 - 2... 36 5.5 gi|31557931|gb|CD527143.1|CD527143 3529_1_116_1_B12.y_1 3529 - 2... 36 5.5 gi|31558146|gb|CD527358.1|CD527358 3529_1_120_1_A05.y_1 3529 - 2... 36 5.5 gi|31558533|gb|CD527745.1|CD527745 3529_1_122_1_G12.y_1 3529 - 2... 36 5.5 gi|31558726|gb|CD527938.1|CD527938 3529_1_124_1_A11.x_1 3529 - 2... 36 5.5 gi|31558727|gb|CD527939.1|CD527939 3529_1_124_1_A11.y_1 3529 - 2... 36 5.5 gi|31612179|gb|CD568801.1|CD568801 3529_1_97_1_H09.y_1 3529 - 2 ... 36 5.5 gi|31664182|gb|CD572907.1|CD572907 3529_1_122_1_G12.x_1 3529 - 2... 36 5.5 gi|31909337|gb|CD650868.1|CD650868 3529_1_132_1_D06.x_2 3529 - 2... 36 5.5 gi|31911004|gb|CD651708.1|CD651708 3529_1_136_1_A03.y_1 3529 - 2... 36 5.5 gi|32854760|gb|CD994441.1|CD994441 QBB15e12.pg QBB Zea mays cDNA... 36 5.5 gi|32854761|gb|CD994442.1|CD994442 QBB15e12.xg QBB Zea mays cDNA... 36 5.5 gi|32863980|gb|CF003662.1|CF003662 QBH21g11.pg QBH Zea mays cDNA... 36 5.5 gi|32863981|gb|CF003663.1|CF003663 QBH21g11.xg QBH Zea mays cDNA... 36 5.5 gi|32868780|gb|CF008462.1|CF008462 QBJ10h01.xg QBJ Zea mays cDNA... 36 5.5 gi|32868792|gb|CF008474.1|CF008474 QBJ11a02.xg QBJ Zea mays cDNA... 36 5.5 gi|32868869|gb|CF008551.1|CF008551 QBJ11h01.xg QBJ Zea mays cDNA... 36 5.5 gi|32868975|gb|CF008657.1|CF008657 QBJ13a10.xg QBJ Zea mays cDNA... 36 5.5 gi|32869018|gb|CF008700.1|CF008700 QBJ13e09.xg QBJ Zea mays cDNA... 36 5.5 gi|32869075|gb|CF008757.1|CF008757 QBJ14c03.xg QBJ Zea mays cDNA... 36 5.5 gi|32869651|gb|CF009333.1|CF009333 QBJ19h07.xg QBJ Zea mays cDNA... 36 5.5 gi|32870271|gb|CF009953.1|CF009953 QBJ24g05.xg QBJ Zea mays cDNA... 36 5.5 gi|32870452|gb|CF010134.1|CF010134 QBJ26b07.xg QBJ Zea mays cDNA... 36 5.5 gi|32870753|gb|CF010435.1|CF010435 QBJ28f08.xg QBJ Zea mays cDNA... 36 5.5 gi|37376580|gb|CF624831.1|CF624831 zmrws05_0A20-009-g10.s1 zmrws... 36 5.5 gi|37378430|gb|CF625905.1|CF625905 zmrws05_0B10-007-d02.s4 zmrws... 36 5.5 gi|37378671|gb|CF626041.1|CF626041 zmrws05_0B10-009-a09.s1 zmrws... 36 5.5 gi|37378754|gb|CF626084.1|CF626084 zmrws05_0B10-009-e09.s1 zmrws... 36 5.5 gi|37382702|gb|CF628311.1|CF628311 zmrws48_0A10-004-d07.s3 zmrws... 36 5.5 gi|37384189|gb|CF629149.1|CF629149 zmrws48_0A10-014-a06.s3 zmrws... 36 5.5 gi|37384680|gb|CF629433.1|CF629433 zmrws48_0A20-001-c07.s3 zmrws... 36 5.5 gi|37386542|gb|CF630457.1|CF630457 zmrws48_0A20-013-a12.s1 zmrws... 36 5.5 gi|37396016|gb|CF635295.1|CF635295 zmrww00_0A20-008-h06.s1 zmrww... 36 5.5 gi|37397041|gb|CF635815.1|CF635815 zmrww00_0A20-015-h03.s0 zmrww... 36 5.5 gi|37400343|gb|CF637523.1|CF637523 zmrww00_0B20-006-g08.s1 zmrww... 36 5.5 gi|37401069|gb|CF637897.1|CF637897 zmrww00_0B20-011-b08.s1 zmrww... 36 5.5 gi|40335351|gb|CK369421.1|CK369421 zmrws485_0A10-004-d07.s0 zmrw... 36 5.5 gi|40337516|gb|CK371586.1|CK371586 zmrww005_0B20-006-g08.s0 zmrw... 36 5.5 gi|45847513|gb|CN071456.1|CN071456 1021012G02.x1 1021 - Unigene ... 36 5.5 gi|45848013|gb|CN071956.1|CN071956 1021022E04.x2 1021 - Unigene ... 36 5.5 gi|60337953|gb|DN204926.1|DN204926 MEST811_E07.T7-1 UGA-ZmSAM-XZ... 36 5.5 gi|60341329|gb|DN208302.1|DN208302 MEST867_A11.T7-1 UGA-ZmSAM-XZ... 36 5.5 gi|60343480|gb|DN210453.1|DN210453 MEST898_G05.T7-1 UGA-ZmSAM-XZ... 36 5.5 gi|60343771|gb|DN210744.1|DN210744 MEST915_B03.T7-1 UGA-ZmSAM-XZ... 36 5.5 gi|60346279|gb|DN213252.1|DN213252 MEST962_E09.T7-1 UGA-ZmSAM-XZ... 36 5.5 gi|60346999|gb|DN213972.1|DN213972 MEST990_C01.T7-1 UGA-ZmSAM-XZ... 36 5.5 gi|60347081|gb|DN214054.1|DN214054 MEST991_E01.T7-1 UGA-ZmSAM-XZ... 36 5.5 gi|60358384|gb|DN225357.1|DN225357 MEST1173_D07.T7-1 UGA-ZmSAM-X... 36 5.5 gi|61118332|gb|DN559293.1|DN559293 ME1-G07-T3-96-R1 E7PCR Zea ma... 36 5.5 gi|67012778|gb|CO441527.1|CO441527 MZCCL10032H04.g Maize Endospe... 36 5.5 gi|67015096|gb|CO443845.1|CO443845 MZCCL10063E11.g Maize Endospe... 36 5.5 gi|67015876|gb|CO444625.1|CO444625 MZCCL10074A07.g Maize Endospe... 36 5.5 gi|67021436|gb|CO450185.1|CO450185 MZCCL10146E12.g Maize Endospe... 36 5.5 gi|67024489|gb|CO453238.1|CO453238 MZCCL10180H09.g Maize Endospe... 36 5.5 gi|71313599|gb|DR793375.1|DR793375 ZM_BFb0013J17.r ZM_BFb Zea ma... 36 5.5 gi|71427682|gb|DR808732.1|DR808732 ZM_BFb0035J22.r ZM_BFb Zea ma... 36 5.5 gi|71428007|gb|DR809057.1|DR809057 ZM_BFb0036B12.r ZM_BFb Zea ma... 36 5.5 gi|71432686|gb|DR813736.1|DR813736 ZM_BFb0043A24.f ZM_BFb Zea ma... 36 5.5 gi|71432687|gb|DR813737.1|DR813737 ZM_BFb0043A24.r ZM_BFb Zea ma... 36 5.5 gi|71442866|gb|DR823916.1|DR823916 ZM_BFb0065F22.r ZM_BFb Zea ma... 36 5.5 gi|71444667|gb|DR825717.1|DR825717 ZM_BFb0068C14.r ZM_BFb Zea ma... 36 5.5 gi|71761200|gb|DR959137.1|DR959137 ZM_BFb0065F22.f ZM_BFb Zea ma... 36 5.5 gi|71770964|gb|DR968901.1|DR968901 ZM_BFb0090G15.f ZM_BFb Zea ma... 36 5.5 gi|71770965|gb|DR968902.1|DR968902 ZM_BFb0090G15.r ZM_BFb Zea ma... 36 5.5 gi|71771098|gb|DR969035.1|DR969035 ZM_BFb0090J14.f ZM_BFb Zea ma... 36 5.5 gi|71771099|gb|DR969036.1|DR969036 ZM_BFb0090J14.r ZM_BFb Zea ma... 36 5.5 gi|74244487|gb|DT652401.1|DT652401 ZM_BFb0118K14.r ZM_BFb Zea ma... 36 5.5 gi|74245727|gb|DT653641.1|DT653641 ZM_BFb0125H19.f ZM_BFb Zea ma... 36 5.5 gi|74245728|gb|DT653642.1|DT653642 ZM_BFb0125H19.r ZM_BFb Zea ma... 36 5.5 gi|76011233|gb|DT938403.1|DT938403 ZM_BFb0118K14.f ZM_BFb Zea ma... 36 5.5 gi|76020917|gb|DT948087.1|DT948087 ZM_BFb0136K20.f ZM_BFb Zea ma... 36 5.5 gi|76020918|gb|DT948088.1|DT948088 ZM_BFb0136K20.r ZM_BFb Zea ma... 36 5.5 gi|76928594|gb|DV171679.1|DV171679 ZM_BFb0172G05.r ZM_BFb Zea ma... 36 5.5 gi|78027226|gb|DV495613.1|DV495613 1000105-B03.T7-1 UGI-Reseq Ze... 36 5.5 gi|78112084|gb|DV530480.1|DV530480 ZM_BFb0220E13.f ZM_BFb Zea ma... 36 5.5 gi|78112085|gb|DV530481.1|DV530481 ZM_BFb0220E13.r ZM_BFb Zea ma... 36 5.5 gi|78112798|gb|DV531192.1|DV531192 ZM_BFb0221D24.r ZM_BFb Zea ma... 36 5.5 gi|78123784|gb|DV542168.1|DV542168 ZM_BFb0237E02.r ZM_BFb Zea ma... 36 5.5 gi|78180925|gb|DV551298.1|DV551298 1000077-E05.GAD10-F UGI-Reseq... 36 5.5 gi|78544113|gb|DV621611.1|DV621611 IV-1091-401B-H05.T7-1 UGIV-10... 36 5.5 gi|89758386|gb|DY687583.1|DY687583 ZM_BFb0279K08.r ZM_BFb Zea ma... 36 5.5 gi|91050457|gb|EB160875.1|EB160875 ZM_BFb0299B14.r ZM_BFb Zea ma... 36 5.5 gi|91877070|gb|EB407027.1|EB407027 ZM_BFb0318M16.r ZM_BFb Zea ma... 36 5.5 gi|93015512|gb|EB641032.1|EB641032 ZM_BFb0330F13.r ZM_BFb Zea ma... 36 5.5 gi|93015828|gb|EB641348.1|EB641348 ZM_BFb0330N10.r ZM_BFb Zea ma... 36 5.5 gi|37681570|gb|AY344632.1| Zea mays beta-glucanase (gla3) mRNA, ... 36 5.5 gi|54652534|gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA se... 36 5.5 gi|21209310|gb|AY106232.1| Zea mays PCO147906 mRNA sequence 36 5.5 gi|21216728|gb|AY112138.1| Zea mays CL6987_1 mRNA sequence 36 5.5 gi|45676797|gb|BV137274.1| PZA00071 Zea mays ssp. parviglumis Wi... 36 5.5 gi|45676794|gb|BV137271.1| PZA00071 Zea mays ssp. parviglumis JS... 36 5.5 gi|45676793|gb|BV137270.1| PZA00071 Zea mays ssp. parviglumis US... 36 5.5 gi|45676792|gb|BV137269.1| PZA00071 Zea mays ssp. parviglumis CI... 36 5.5 gi|45676791|gb|BV137268.1| PZA00071 Zea mays ssp. parviglumis JS... 36 5.5 gi|45676789|gb|BV137266.1| PZA00071 Zea mays ssp. parviglumis JS... 36 5.5 gi|45676788|gb|BV137265.1| PZA00071 Zea mays ssp. parviglumis JS... 36 5.5 gi|45676787|gb|BV137264.1| PZA00071 Zea mays ssp. parviglumis CI... 36 5.5 gi|45676786|gb|BV137263.1| PZA00071 Zea mays ssp. parviglumis JS... 36 5.5 gi|45676784|gb|BV137261.1| PZA00071 Zea mays ssp. mays CML69 Zea... 36 5.5 gi|45676783|gb|BV137260.1| PZA00071 Zea mays ssp. mays CML322 Ze... 36 5.5 gi|45676782|gb|BV137259.1| PZA00071 Zea mays ssp. mays CML333 Ze... 36 5.5 gi|45676781|gb|BV137258.1| PZA00071 Zea mays ssp. mays Kul3 Zea ... 36 5.5 gi|45676780|gb|BV137257.1| PZA00071 Zea mays ssp. mays NC350 Zea... 36 5.5 gi|45676779|gb|BV137256.1| PZA00071 Zea mays ssp. mays CML247 Ze... 36 5.5 gi|45676778|gb|BV137255.1| PZA00071 Zea mays ssp. mays Hp301 Zea... 36 5.5 gi|45676777|gb|BV137254.1| PZA00071 Zea mays ssp. mays M37W Zea ... 36 5.5 gi|45676776|gb|BV137253.1| PZA00071 Zea mays ssp. mays Ky21 Zea ... 36 5.5 gi|45676775|gb|BV137252.1| PZA00071 Zea mays ssp. mays Mo17(2) Z... 36 5.5 gi|45676774|gb|BV137251.1| PZA00071 Zea mays ssp. mays Mo17(1) Z... 36 5.5 gi|45676773|gb|BV137250.1| PZA00071 Zea mays ssp. mays Il14H Zea... 36 5.5 gi|45676772|gb|BV137249.1| PZA00071 Zea mays ssp. mays Oh43 Zea ... 36 5.5 gi|45676771|gb|BV137248.1| PZA00071 Zea mays ssp. mays B73(2) Ze... 36 5.5 gi|45676770|gb|BV137247.1| PZA00071 Zea mays ssp. mays B73(1) Ze... 36 5.5 gi|54652534|gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA se... 36 5.5 gi|37681570|gb|AY344632.1| Zea mays beta-glucanase (gla3) mRNA, ... 36 5.5 gi|21216728|gb|AY112138.1| Zea mays CL6987_1 mRNA sequence 36 5.5 gi|21209310|gb|AY106232.1| Zea mays PCO147906 mRNA sequence 36 5.5 gi|91206525|gb|AC184873.1| Zea mays chromosome UNK clone CH201-1... 36 5.5 gi|90568149|gb|AC183937.1| Zea mays chromosome UNK clone CH201-3... 36 5.5 >gi|37376645|gb|CF624874.1|CF624874 zmrws05_0A20-010-c09.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 623 Score = 1132 bits (571), Expect = 0.0 Identities = 577/579 (99%) Strand = Plus / Plus Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacact 94 ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 45 gtccaagaagacaggttttatttcgaggatgcaggacagtatctctggaaccctgacact 104 Query: 95 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 105 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 164 Query: 155 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 165 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 224 Query: 215 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 284 Query: 275 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 285 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 344 Query: 335 gggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttgatcccg 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 345 gggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttgatcccg 404 Query: 395 gacttcttggccgtcttggacagcatgacggcgcagaggcactgggggctctgcttcccg 454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 405 gacttcttggccgtcttggacagcatgacggcgcagaggcactgggggctctgcttcccg 464 Query: 455 atggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcg 514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 465 atggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcg 524 Query: 515 gacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgccc 574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 525 gacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgccc 584 Query: 575 gcgccgcggacggtcacgaggcatgcagcggacgcgacc 613 ||||||||||||||||||||||||||||||||||||||| Sbjct: 585 gcgccgcggacggtcacgaggcatgcagcggacgcgacc 623 >gi|15082605|gb|BI389289.1|BI389289 949052C01.x2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 570 Score = 1128 bits (569), Expect = 0.0 Identities = 569/569 (100%) Strand = Plus / Plus Query: 75 atctctggaaccctgacacttacatacgatacgacccatatttcttttgaagattgtgag 134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2 atctctggaaccctgacacttacatacgatacgacccatatttcttttgaagattgtgag 61 Query: 135 acactcatatcacactggacttccacatgtatggtaatcacaacaagtgccgcgacgttt 194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 62 acactcatatcacactggacttccacatgtatggtaatcacaacaagtgccgcgacgttt 121 Query: 195 attaccaacgcacacatacactgacacgtcaccgtcacttcctgcggacgtcgtgctaac 254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 122 attaccaacgcacacatacactgacacgtcaccgtcacttcctgcggacgtcgtgctaac 181 Query: 255 tccgacggatcatgcacatgtgctcaagcagctctcgcgcagctcatggcagagtgtaat 314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 182 tccgacggatcatgcacatgtgctcaagcagctctcgcgcagctcatggcagagtgtaat 241 Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 242 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 301 Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 302 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 361 Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 362 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 421 Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 422 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 481 Query: 555 gcgtcgccccgcactcgcccgcgccgcggacggtcacgaggcatgcagcggacgcgacca 614 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 482 gcgtcgccccgcactcgcccgcgccgcggacggtcacgaggcatgcagcggacgcgacca 541 Query: 615 gggcgaggacgagcaacaagaggcccttc 643 ||||||||||||||||||||||||||||| Sbjct: 542 gggcgaggacgagcaacaagaggcccttc 570 >gi|37390604|gb|CF632534.1|CF632534 zmrws48_0B20-005-c01.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 585 Score = 1118 bits (564), Expect = 0.0 Identities = 572/575 (99%) Strand = Plus / Plus Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacact 94 ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 11 gtccaagaagacaggttttatttcgaggatgcaggacagtatctctggaaccctgacact 70 Query: 95 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 71 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 130 Query: 155 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 131 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 190 Query: 215 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 250 Query: 275 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 251 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 310 Query: 335 gggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttgatcccg 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 311 gggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttgatcccg 370 Query: 395 gacttcttggccgtcttggacagcatgacggcgcagaggcactgggggctctgcttcccg 454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 371 gacttcttggccgtcttggacagcatgacggcgcagaggcactgggggctctgcttcccg 430 Query: 455 atggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcg 514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 431 atggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcg 490 Query: 515 gacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgccc 574 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 491 gacgcgcacggcgccagcttcagcgccatcctgtccggcggngtcgccccgcactcgccc 550 Query: 575 gcgccgcggacggtcacgaggcatgcagcggacgc 609 ||||||||||||||||||||||||||||||||||| Sbjct: 551 gcgccgcggacggtcacgaggcatgcagcggacgc 585 >gi|37381429|gb|CF627600.1|CF627600 zmrws05_0B20-013-b12.s3 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 653 Score = 991 bits (500), Expect = 0.0 Identities = 521/527 (98%), Gaps = 2/527 (0%) Strand = Plus / Plus Query: 132 gagacactcatatcacactggacttccacatgtatggtaatcacaacaagtgccgcgacg 191 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 71 gagacactcatatcatactggacttccacatgtatggtaatcacaacaagtgccgcgacg 130 Query: 192 tttattaccaacgcacacatacactgacacgtcaccgtcacttcctgcggacgtcgtgct 251 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 131 tttattaccaacgcacacatacactgacacgtcaccgtcacttcctgcggacgtcgtgct 190 Query: 252 aactccgac--ggatcatgcacatgtgctcaagcagctctcgcgcagctcatggcagagt 309 ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 aactccgacacggatcatgcacatgtgctcaagcagctctcgcgcagctcatggcagagt 250 Query: 310 gtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggt 369 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 251 gtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggt 310 Query: 370 gatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgca 429 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 311 gatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgca 370 Query: 430 gaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacgg 489 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 371 gaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacgg 430 Query: 490 cgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtc 549 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 431 cgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtc 490 Query: 550 cggcggcgtcgccccgcactcgcccgcgccgcggacggtcacgaggcatgcagcggacgc 609 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 491 cggcggcgtcgccccgcactcgcccgcgccgcggacggccacgaggcatgcagcggacgc 550 Query: 610 gaccagggcgaggacgagcaacaagaggcccttcatatcggtagcct 656 |||||||||||||||||||||| ||||||||||||| |||||||||| Sbjct: 551 gaccagggcgaggacgagcaacgagaggcccttcatctcggtagcct 597 Score = 143 bits (72), Expect = 3e-32 Identities = 72/72 (100%) Strand = Plus / Plus Query: 37 ccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacactta 96 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacactta 60 Query: 97 catacgatacga 108 |||||||||||| Sbjct: 61 catacgatacga 72 >gi|15188058|gb|BI417035.1|BI417035 949052C01.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 441 Score = 821 bits (414), Expect = 0.0 Identities = 428/430 (99%), Gaps = 2/430 (0%) Strand = Plus / Minus Query: 227 cgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatgtgctcaagcagc 286 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 441 cgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatgtgctcaagcagc 382 Query: 287 tctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacg 346 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 381 tctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacg 322 Query: 347 aggttgcagcgcttggggatggtgatggccacctcgggcttgatcccggacttcttggcc 406 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 321 aggttgcagcgcttggggatggtgatggccacctcgggcttgatcccggacttcttggcc 262 Query: 407 gtcttggacagcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcacc 466 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 261 gtcttggacagcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcacc 202 Query: 467 gccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggc 526 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 201 gccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggc 142 Query: 527 gccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccgcggacg 586 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 141 gccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgcccgc-ccgcggacg 83 Query: 587 gtcacgaggcatgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcata 646 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 82 gtcac-aggcatgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcata 24 Query: 647 tcggtagcct 656 |||||||||| Sbjct: 23 tcggtagcct 14 >gi|15589451|gb|BI674067.1|BI674067 949052C01.Y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 441 Score = 821 bits (414), Expect = 0.0 Identities = 428/430 (99%), Gaps = 2/430 (0%) Strand = Plus / Minus Query: 227 cgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatgtgctcaagcagc 286 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 441 cgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatgtgctcaagcagc 382 Query: 287 tctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacg 346 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 381 tctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacg 322 Query: 347 aggttgcagcgcttggggatggtgatggccacctcgggcttgatcccggacttcttggcc 406 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 321 aggttgcagcgcttggggatggtgatggccacctcgggcttgatcccggacttcttggcc 262 Query: 407 gtcttggacagcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcacc 466 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 261 gtcttggacagcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcacc 202 Query: 467 gccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggc 526 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 201 gccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggc 142 Query: 527 gccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccgcggacg 586 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 141 gccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgcccgc-ccgcggacg 83 Query: 587 gtcacgaggcatgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcata 646 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 82 gtcac-aggcatgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcata 24 Query: 647 tcggtagcct 656 |||||||||| Sbjct: 23 tcggtagcct 14 >gi|6952678|gb|AW424746.1|AW424746 707064C07.y1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 403 Score = 682 bits (344), Expect = 0.0 Identities = 353/355 (99%), Gaps = 1/355 (0%) Strand = Plus / Minus Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacact 94 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 369 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacact 310 Query: 95 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 309 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 250 Query: 155 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 214 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 249 ttccacatgtatggtaatcacaacaagtnccgcgacgtttattaccaacgcacacataca 190 Query: 215 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 189 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 130 Query: 275 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 129 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 70 Query: 335 gggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttga 389 ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 69 gggcggtcgacgaggttgcagcg-ttggggatggtgatggccacctcgggcttga 16 >gi|15188089|gb|BI417066.1|BI417066 949052F11.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 348 Score = 676 bits (341), Expect = 0.0 Identities = 348/349 (99%), Gaps = 1/349 (0%) Strand = Plus / Minus Query: 325 gtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcggg 384 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 348 gtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcggg 289 Query: 385 cttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactgggggct 444 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 288 cttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactgggggct 229 Query: 445 ctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggtt 504 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 228 ctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggtt 169 Query: 505 ctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcccc 564 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 168 ctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcccc 109 Query: 565 gcactcgcccgcgccgcggacggtcacgaggcatgcagcggacgcgaccagggcgaggac 624 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 108 gcactcgcccgcgccgcggacggtcacgaggcatgcagcggacgcgaccagggcgaggac 49 Query: 625 gagcaacaagaggcccttcatatcggtagcctgtctccactcccctgcc 673 |||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 48 gagcaacaagaggcccttcatatcgg-agcctgtctccactcccctgcc 1 >gi|15589482|gb|BI674098.1|BI674098 949052F11.Y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 348 Score = 676 bits (341), Expect = 0.0 Identities = 348/349 (99%), Gaps = 1/349 (0%) Strand = Plus / Minus Query: 325 gtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcggg 384 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 348 gtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcggg 289 Query: 385 cttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactgggggct 444 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 288 cttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactgggggct 229 Query: 445 ctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggtt 504 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 228 ctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggtt 169 Query: 505 ctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcccc 564 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 168 ctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcccc 109 Query: 565 gcactcgcccgcgccgcggacggtcacgaggcatgcagcggacgcgaccagggcgaggac 624 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 108 gcactcgcccgcgccgcggacggtcacgaggcatgcagcggacgcgaccagggcgaggac 49 Query: 625 gagcaacaagaggcccttcatatcggtagcctgtctccactcccctgcc 673 |||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 48 gagcaacaagaggcccttcatatcgg-agcctgtctccactcccctgcc 1 >gi|78180782|gb|DV551155.1|DV551155 1000063-E10.GAD10-F UGI-Reseq Zea mays cDNA, mRNA sequence Length = 377 Score = 658 bits (332), Expect = 0.0 Identities = 348/352 (98%), Gaps = 1/352 (0%) Strand = Plus / Plus Query: 35 gtccaagaag-acaagttttatttcgaggatgcaggacagcatctctggaaccctgacac 93 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 26 gtccaagaagcacaagttttatttcgaggatgcaggacagcatctctggaaccctgacac 85 Query: 94 ttacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactgga 153 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 86 ttacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactgga 145 Query: 154 cttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacatac 213 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 146 cttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacatac 205 Query: 214 actgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacat 273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 206 actgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacat 265 Query: 274 gtgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgac 333 |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| Sbjct: 266 gtgctcaagcagctctcgcgcagctcatggcagaatgtaatctccgcacttgtatccgac 325 Query: 334 ggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggc 385 ||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 326 ggggcggtcgacgaggttgcagcgcctggggatggtgatggccacctcgggc 377 >gi|37384451|gb|CF629299.1|CF629299 zmrws48_0A10-015-f07.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 355 Score = 646 bits (326), Expect = 0.0 Identities = 332/334 (99%) Strand = Plus / Plus Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacact 94 ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 11 gtccaagaagacaggttttatttcgaggatgcaggacagtatctctggaaccctgacact 70 Query: 95 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 71 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 130 Query: 155 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 131 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 190 Query: 215 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 191 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatg 250 Query: 275 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 251 tgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacg 310 Query: 335 gggcggtcgacgaggttgcagcgcttggggatgg 368 |||||||||||||||||||||||||||||||||| Sbjct: 311 gggcggtcgacgaggttgcagcgcttggggatgg 344 >gi|12046382|gb|BF728521.1|BF728521 1000063E10.x1 1000 - Unigene I from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 329 Score = 607 bits (306), Expect = e-172 Identities = 324/329 (98%), Gaps = 2/329 (0%) Strand = Plus / Plus Query: 41 gaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacacttacata 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacacttacata 60 Query: 101 cgatacgacccatatttcttttgaagattgtgagacactcatatcacactggacttccac 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 cgatacgacccatatttcttttgaagattgtgagacactcatatcacactggacttccac 120 Query: 161 atgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacatacactg--a 218 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 atgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacatacactgtat 180 Query: 219 cacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatgtgct 278 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 ctcgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcacatgtgct 240 Query: 279 caagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgtagccgacggggc 338 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 241 caagcagctctcgcgcagctcatggcagagcgtaatctccgcacttgtagccgacggggc 300 Query: 339 ggtcgacgaggttgcagcgcttggggatg 367 ||||||||||||||||||||||||||||| Sbjct: 301 ggtcgacgaggttgcagcgcttggggatg 329 >gi|32833926|gb|CD973604.1|CD973604 QAE36f02.yg QAE Zea mays cDNA clone QAE36f02, mRNA sequence Length = 313 Score = 523 bits (264), Expect = e-147 Identities = 301/313 (96%), Gaps = 9/313 (2%) Strand = Plus / Plus Query: 37 ccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacactta 96 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 1 ccaagaagacaagttttatttcgaggatgcaggacagcatctttggaaccctgacactta 60 Query: 97 catacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggactt 156 ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 61 catacgatacgacccatatttcttttgaagactgtgagacactcatatcatactggactt 120 Query: 157 ccacatgtatggtaatcacaacaagtgc-------cgcgacgtttattaccaacgcacac 209 |||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 121 ccacatgtatggtaatcacaacaagtgcggagtgccgcgacgtttattaccaacgcacac 180 Query: 210 atacactgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgac--ggatcat 267 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 181 atacactgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacacggatcat 240 Query: 268 gcacatgtgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgta 327 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 gcacatgtgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgta 300 Query: 328 gccgacggggcgg 340 ||||||||||||| Sbjct: 301 gccgacggggcgg 313 >gi|32832593|gb|CD972271.1|CD972271 QAE1e10.yg QAE Zea mays cDNA clone QAE1e10, mRNA sequence Length = 314 Score = 492 bits (248), Expect = e-137 Identities = 297/313 (94%), Gaps = 9/313 (2%) Strand = Plus / Plus Query: 37 ccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacactta 96 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 2 ccaagaagacaagttttatttcgaggatgcaggacagaatttctggaaccctgacactta 61 Query: 97 catacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggactt 156 ||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||| Sbjct: 62 catacgatacgacccatatttctttggaagactgtgagacactcatatcatactggactt 121 Query: 157 ccacatgtatggtaatcacaacaagtgc-------cgcgacgtttattaccaacgcacac 209 |||||||||||| || |||||||||||| ||||||||||||||||||||||||| Sbjct: 122 ccacatgtatggaaaccacaacaagtgcggagtgccgcgacgtttattaccaacgcacac 181 Query: 210 atacactgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgac--ggatcat 267 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 182 atacactgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacacggatcat 241 Query: 268 gcacatgtgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgta 327 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 242 gcacatgtgctcaagcagctctcgcgcagctcatggcagagtgtaatctccgcacttgta 301 Query: 328 gccgacggggcgg 340 ||||||||||||| Sbjct: 302 gccgacggggcgg 314 >gi|18181550|gb|BM382760.1|BM382760 MEST554-D03.univ ISUM6 Zea mays cDNA clone MEST554-D03 3', mRNA sequence Length = 284 Score = 458 bits (231), Expect = e-127 Identities = 246/250 (98%), Gaps = 1/250 (0%) Strand = Plus / Plus Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacact 94 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaaccctgacact 94 Query: 95 tacatacgatacgacccatatttcttttgaagattgtgagacactcatatcacactggac 154 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 95 tacatacgataggacccatatttcttttgaagattgtgagacactcatatcacactggac 154 Query: 155 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 155 ttccacatgtatggtaatcacaacaagtgccgcgacgtttattaccaacgcacacataca 214 Query: 215 ctgacacgtcaccgtcacttcctgcggacgtcgtgctaactccgacggatca-tgcacat 273 ||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 215 ctgacacgtcaccatcacttcctgcggacgtngtgctaactccgacggatcactgcacat 274 Query: 274 gtgctcaagc 283 |||||||||| Sbjct: 275 gtgctcaagc 284 >gi|21209883|gb|AY106805.1| Zea mays PCO131201 mRNA sequence Length = 760 Score = 351 bits (177), Expect = 7e-95 Identities = 258/285 (90%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 433 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 374 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 373 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 314 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 313 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 254 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | |||||||||||||| ||||| || |||||| |||||||||||||||||| || Sbjct: 253 caggagccggacggcgccgagccggggtcctccgccgccgacgcgcacggcgccagcctc 194 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | ||||||||||||||||||||||||||||||||||| Sbjct: 193 agcgccaccgtgtccggcggcgtcgccccgcactcgcccgcgccg 149 >gi|21209883|gb|AY106805.1| Zea mays PCO131201 mRNA sequence Length = 760 Score = 351 bits (177), Expect = 7e-95 Identities = 258/285 (90%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 433 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 374 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 373 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 314 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 313 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 254 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | |||||||||||||| ||||| || |||||| |||||||||||||||||| || Sbjct: 253 caggagccggacggcgccgagccggggtcctccgccgccgacgcgcacggcgccagcctc 194 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | ||||||||||||||||||||||||||||||||||| Sbjct: 193 agcgccaccgtgtccggcggcgtcgccccgcactcgcccgcgccg 149 >gi|71319077|gb|DR796291.1|DR796291 ZM_BFb0017N12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 596 Score = 335 bits (169), Expect = 4e-90 Identities = 256/285 (89%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 368 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 309 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 308 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 249 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 248 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 189 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 188 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 129 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 128 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 84 >gi|71442838|gb|DR823888.1|DR823888 ZM_BFb0065F04.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 680 Score = 335 bits (169), Expect = 4e-90 Identities = 256/285 (89%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 445 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 386 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 385 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 326 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 325 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 266 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 265 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 206 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 205 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 161 >gi|78122176|gb|DV540560.1|DV540560 ZM_BFb0234P01.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 719 Score = 335 bits (169), Expect = 4e-90 Identities = 256/285 (89%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 439 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 380 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 379 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 320 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 319 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 260 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 259 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 200 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 199 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 155 >gi|91053034|gb|EB163452.1|EB163452 ZM_BFb0311F12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 650 Score = 335 bits (169), Expect = 4e-90 Identities = 256/285 (89%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 446 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 387 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 386 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 327 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 326 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 267 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 266 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 207 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 206 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 162 >gi|91053373|gb|EB163791.1|EB163791 ZM_BFb0311N12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 600 Score = 335 bits (169), Expect = 4e-90 Identities = 256/285 (89%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 446 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 387 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 386 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 327 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 326 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 267 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 266 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 207 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 206 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 162 >gi|91057111|gb|EB167529.1|EB167529 ZM_BFb0382J21.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 669 Score = 335 bits (169), Expect = 4e-90 Identities = 256/285 (89%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 445 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 386 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 385 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 326 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 325 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 266 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 265 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 206 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 205 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 161 >gi|33466455|gb|CF243504.1|CF243504 3530_1_21_1_F01.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 680 Score = 327 bits (165), Expect = 1e-87 Identities = 255/285 (89%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 297 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 356 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 357 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 416 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 |||||||||||||| |||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 417 agcatgacggcgcaaaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 476 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 477 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 536 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 537 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 581 >gi|37376852|gb|CF624986.1|CF624986 zmrws05_0A20-011-f07.s3 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 654 Score = 327 bits (165), Expect = 1e-87 Identities = 255/285 (89%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 283 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 342 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 343 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 402 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 |||||||| |||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 403 agcatgacagcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 462 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 463 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 522 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | ||||||||||||||||||||||||||||||||||| Sbjct: 523 agcgccaccgtgtccggcggcgtcgccccgcactcgcccgcgccg 567 >gi|50332028|gb|CO527154.1|CO527154 3530_1_17_1_F01.x_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 680 Score = 327 bits (165), Expect = 1e-87 Identities = 255/285 (89%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 297 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 356 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 357 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 416 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 |||||||||||||| |||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 417 agcatgacggcgcaaaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 476 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 477 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 536 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 537 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 581 >gi|37385212|gb|CF629732.1|CF629732 zmrws48_0A20-004-g07.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 657 Score = 319 bits (161), Expect = 3e-85 Identities = 254/285 (89%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 302 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 361 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 362 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 421 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 422 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 481 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| ||||||||||| |||||| || Sbjct: 482 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggagccagcctc 541 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 542 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 586 >gi|89250396|gb|DY622182.1|DY622182 ZM_BFb0287I01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 585 Score = 319 bits (161), Expect = 3e-85 Identities = 254/285 (89%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 |||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 272 gctcatggcaaagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 331 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 332 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 391 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 |||||||||||||| |||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 392 agcatgacggcgcaaaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 451 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 452 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 511 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 512 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 556 >gi|74241426|gb|DT649340.1|DT649340 ZM_BFb0111P07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 511 Score = 303 bits (153), Expect = 2e-80 Identities = 252/285 (88%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 444 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 385 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || | ||||||||||||||| |||||| ||||||||||| || |||| || |||||| Sbjct: 384 cgttaggggatggtgatggcgacctcgaccttgatcccggcgctcctggcggtgttggac 325 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 |||| |||||||||||||||| ||||||||||||||||| || ||||||||| ||||| Sbjct: 324 agcacgacggcgcagaggcacctggggctctgcttcccgagggcgtgcaccgcgctgcag 265 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 ||| | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 264 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 205 Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580 ||||||| | |||||||||||||||| |||||||||||||||||| Sbjct: 204 agcgccaccgtgtccggcggcgtcgcaccgcactcgcccgcgccg 160 >gi|37384071|gb|CF629081.1|CF629081 zmrws48_0A10-013-c01.s4 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 556 Score = 264 bits (133), Expect = 1e-68 Identities = 226/257 (87%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 300 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 359 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 360 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 419 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||| Sbjct: 420 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcac 479 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535 || | ||||||||| |||| ||||| || |||||| |||||||||||||||||| || Sbjct: 480 catgagccggacggcgcggagccggggtcctccgccgccgacgcgcacggcgccagcctc 539 Query: 536 agcgccatcctgtccgg 552 ||||||| | ||||||| Sbjct: 540 agcgccaccgtgtccgg 556 >gi|60400235|gb|DN233042.1|DN233042 MEST916_G02.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 499 Score = 258 bits (130), Expect = 8e-67 Identities = 207/233 (88%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 267 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 326 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 327 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 386 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 387 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 446 Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgc 528 ||| | ||||||||| |||| ||||| || |||||| ||||||| |||||| Sbjct: 447 caggagccggacggcgcggagccggggtcctccgccgccgacgcgcncggcgc 499 >gi|33467441|gb|CF244490.1|CF244490 3530_1_2_1_E03.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 391 Score = 256 bits (129), Expect = 3e-66 Identities = 219/249 (87%) Strand = Plus / Minus Query: 332 acggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttgatc 391 |||||||||||| ||||||||||||| ||||||||||||||||| ||||||| ||||||| Sbjct: 387 acggggcggtcggcgaggttgcagcgtttggggatggtgatggcgacctcggccttgatc 328 Query: 392 ccggacttcttggccgtcttggacagcatgacggcgcagaggcactgggggctctgcttc 451 |||| || |||| || ||||||||||||||||||||||||||| ||||||||||||| Sbjct: 327 ccggcgctcctggcggtgttggacagcatgacggcgcagaggcacctggggctctgcttc 268 Query: 452 ccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctggggttctgcgcc 511 ||||||| ||||||||| |||||||| | ||||||||| |||| ||||| || | || Sbjct: 267 ccgatggcgtgcaccgcgctgcagcaggagccggacggcgcggagccggggtcctcctcc 208 Query: 512 gcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgccccgcactcg 571 || |||||||||||||||||| |||||||| | |||||||||||||||| ||||||||| Sbjct: 207 gccgacgcgcacggcgccagcctcagcgcctccgtgtccggcggcgtcgcaccgcactcg 148 Query: 572 cccgcgccg 580 ||||||||| Sbjct: 147 cccgcgccg 139 >gi|15188055|gb|BI417032.1|BI417032 949052B09.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 131 Score = 248 bits (125), Expect = 8e-64 Identities = 125/125 (100%) Strand = Plus / Minus Query: 538 cgccatcctgtccggcggcgtcgccccgcactcgcccgcgccgcggacggtcacgaggca 597 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 131 cgccatcctgtccggcggcgtcgccccgcactcgcccgcgccgcggacggtcacgaggca 72 Query: 598 tgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcatatcggtagcctg 657 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 71 tgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcatatcggtagcctg 12 Query: 658 tctcc 662 ||||| Sbjct: 11 tctcc 7 >gi|15589448|gb|BI674064.1|BI674064 949052B09.Y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 131 Score = 248 bits (125), Expect = 8e-64 Identities = 125/125 (100%) Strand = Plus / Minus Query: 538 cgccatcctgtccggcggcgtcgccccgcactcgcccgcgccgcggacggtcacgaggca 597 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 131 cgccatcctgtccggcggcgtcgccccgcactcgcccgcgccgcggacggtcacgaggca 72 Query: 598 tgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcatatcggtagcctg 657 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 71 tgcagcggacgcgaccagggcgaggacgagcaacaagaggcccttcatatcggtagcctg 12 Query: 658 tctcc 662 ||||| Sbjct: 11 tctcc 7 >gi|28985891|gb|CB350867.1|CB350867 MEST257-B03.univ ISUM5-RN Zea mays cDNA clone MEST257-B03 3', mRNA sequence Length = 484 Score = 236 bits (119), Expect = 3e-60 Identities = 167/183 (91%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 287 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 346 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 347 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 406 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 407 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 466 Query: 476 cag 478 ||| Sbjct: 467 cag 469 >gi|18174954|gb|BM350342.1|BM350342 MEST264-D12.T3 ISUM5-RN Zea mays cDNA clone MEST264-D12 3', mRNA sequence Length = 464 Score = 232 bits (117), Expect = 5e-59 Identities = 159/173 (91%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 288 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 347 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 348 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 407 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgc 468 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 408 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgc 460 >gi|78025280|gb|DV493667.1|DV493667 1000107-G04.T7-1 UGI-Reseq Zea mays cDNA, mRNA sequence Length = 517 Score = 228 bits (115), Expect = 7e-58 Identities = 166/183 (90%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 325 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 384 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 385 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 444 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475 ||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| Sbjct: 445 agcatgacggcgcagaggcacctggggctctgcttcccgatggcgtgcaccgcgctgcag 504 Query: 476 cag 478 ||| Sbjct: 505 cag 507 >gi|18175613|gb|BM350864.1|BM350864 MEST214-G08.T3 ISUM5-RN Zea mays cDNA clone MEST214-G08 3', mRNA sequence Length = 463 Score = 224 bits (113), Expect = 1e-56 Identities = 158/173 (91%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 287 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 346 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 347 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 406 Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgc 468 |||||||||||||| |||||| |||||||||||||||||||| ||||||||| Sbjct: 407 agcatgacggcgcataggcacctggggctctgcttcccgatggcgtgcaccgc 459 >gi|15080611|gb|BI389127.1|BI389127 949052F11.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 102 Score = 194 bits (98), Expect = 1e-47 Identities = 101/102 (99%) Strand = Plus / Plus Query: 50 ttttatttcgaggatgcaggacagcatctctggaaccctgacacttacatacgatacgac 109 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 1 ttttatttcgaggatgcaggacagtatctctggaaccctgacacttacatacgatacgac 60 Query: 110 ccatatttcttttgaagattgtgagacactcatatcacactg 151 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ccatatttcttttgaagattgtgagacactcatatcacactg 102 >gi|78122175|gb|DV540559.1|DV540559 ZM_BFb0234P01.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 399 Score = 167 bits (84), Expect = 2e-39 Identities = 117/128 (91%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 272 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 331 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415 || ||||||||||||||||| ||||||| ||||||||||| || |||| || |||||| Sbjct: 332 cgtttggggatggtgatggcgacctcggccttgatcccggcgctcctggcggtgttggac 391 Query: 416 agcatgac 423 |||||||| Sbjct: 392 agcatgac 399 >gi|18170563|gb|BM340403.1|BM340403 MEST322-C05.T3 ISUM5-RN Zea mays cDNA clone MEST322-C05 3', mRNA sequence Length = 396 Score = 159 bits (80), Expect = 6e-37 Identities = 95/100 (95%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 287 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 346 Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccgg 395 || ||||||||||||||||| ||||||| ||||||||||| Sbjct: 347 cgtttggggatggtgatggcgacctcggccttgatcccgg 386 >gi|4826186|gb|AI667814.1|AI667814 605028E10.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 176 Score = 157 bits (79), Expect = 2e-36 Identities = 112/123 (91%) Strand = Plus / Plus Query: 314 tctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatg 373 ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||| Sbjct: 52 tctccgcacttgtagccaacggggcggtcggcgaggttgcagcgtttggggatggtgatg 111 Query: 374 gccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagagg 433 || ||||||| ||||||||||| || |||| || |||||||||||||||||||||||| Sbjct: 112 gcgacctcggccttgatcccggcgctcctggcggtgttggacagcatgacggcgcagagg 171 Query: 434 cac 436 ||| Sbjct: 172 cac 174 >gi|5740408|gb|AI948098.1|AI948098 603034E12.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 531 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Plus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 232 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 292 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 351 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 352 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 406 >gi|6989656|gb|AW447869.1|AW447869 707081D06.x1 707 - Mixed adult tissues from Walbot lab (SK) Zea mays cDNA, mRNA sequence Length = 495 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 269 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 210 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 209 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 150 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 149 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 95 >gi|18179707|gb|BM380917.1|BM380917 MEST527-B05.univ ISUM6 Zea mays cDNA clone MEST527-B05 3', mRNA sequence Length = 655 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Plus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 259 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 318 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 319 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 378 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 379 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 433 >gi|21620943|gb|BQ618949.1|BQ618949 RNOSEQ1F12_T3.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ1F12_T3.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 950 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 403 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 344 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 343 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 284 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 283 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 229 >gi|21620988|gb|BQ618994.1|BQ618994 RNOSEQ2D06_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ2D06_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 950 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 403 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 344 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 343 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 284 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 283 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 229 >gi|21621069|gb|BQ619075.1|BQ619075 RNOSEQ3D12_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ3D12_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 950 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 403 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 344 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 343 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 284 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 283 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 229 >gi|21621121|gb|BQ619127.1|BQ619127 RNOSEQ4B02_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ4B02_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 950 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 403 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 344 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 343 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 284 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 283 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 229 >gi|21621130|gb|BQ619136.1|BQ619136 RNOSEQ4B09_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ4B09_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 490 Score = 143 bits (72), Expect = 3e-32 Identities = 84/88 (95%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 120 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 61 Query: 356 cgcttggggatggtgatggccacctcgg 383 || ||||||||||||||||| ||||||| Sbjct: 60 cgtttggggatggtgatggcgacctcgg 33 >gi|21621136|gb|BQ619142.1|BQ619142 RNOSEQ4C03_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ4C03_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 490 Score = 143 bits (72), Expect = 3e-32 Identities = 84/88 (95%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 120 gctcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 61 Query: 356 cgcttggggatggtgatggccacctcgg 383 || ||||||||||||||||| ||||||| Sbjct: 60 cgtttggggatggtgatggcgacctcgg 33 >gi|21621163|gb|BQ619169.1|BQ619169 RNOSEQ4E07_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ4E07_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 950 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 403 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 344 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 343 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 284 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 283 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 229 >gi|21621167|gb|BQ619173.1|BQ619173 RNOSEQ4E11_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RNOSEQ4E11_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 950 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 403 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 344 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 343 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 284 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 283 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 229 >gi|21621509|gb|BQ619515.1|BQ619515 RESEQ1B09_SK.ab1 Salt stressed Zea mays roots cDNA library Zea mays cDNA clone RESEQ1B09_SK.ab1 similar to NP_190966.1| (NM_115258) putative protein [Arabidopsis thaliana] gi|11357822|pir|T45938 hypothetical protein F5K20.280 - Arabidopsis thaliana gi|7630018|emb|CAB88360.1| (AL..., mRNA sequence Length = 950 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 403 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 344 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 343 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 284 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 283 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 229 >gi|21211983|gb|AY108760.1| Zea mays PCO149616 mRNA sequence Length = 644 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 385 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 326 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 325 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 266 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 265 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 211 >gi|21211983|gb|AY108760.1| Zea mays PCO149616 mRNA sequence Length = 644 Score = 143 bits (72), Expect = 3e-32 Identities = 152/178 (85%), Gaps = 3/178 (1%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 385 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 326 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| || |||||||||| Sbjct: 325 gggatggtaatggcgacctccggcttgatcccggcagccctggcggtgccggacagcatg 266 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 265 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 211 >gi|28986153|gb|CB350995.1|CB350995 MEST258-H05.univ ISUM5-RN Zea mays cDNA clone MEST258-H05 3', mRNA sequence Length = 417 Score = 139 bits (70), Expect = 5e-31 Identities = 91/98 (92%) Strand = Plus / Plus Query: 298 tcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcg 357 ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| | Sbjct: 289 tcatggcagagtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcagtg 348 Query: 358 cttggggatggtgatggccacctcgggcttgatcccgg 395 | ||||||||||||||| ||||||| ||||||||||| Sbjct: 349 ttcggggatggtgatggcgacctcggccttgatcccgg 386 >gi|18650158|gb|BM498977.1|BM498977 949006C06.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 507 Score = 135 bits (68), Expect = 8e-30 Identities = 151/178 (84%), Gaps = 3/178 (1%) Strand = Plus / Plus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 174 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 233 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| ||||| ||||||||||||| | |||| | |||||||||| Sbjct: 234 gggatggtaatggcgacctccggcttgatcccggcagccctggcggcgccggacagcatg 293 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 294 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 348 >gi|32835368|gb|CD975046.1|CD975046 QAE52g06.yg QAE Zea mays cDNA clone QAE52g06, mRNA sequence Length = 315 Score = 135 bits (68), Expect = 8e-30 Identities = 83/88 (94%) Strand = Plus / Minus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 101 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 42 Query: 356 cgcttggggatggtgatggccacctcgg 383 || ||||||||||||||||| ||||||| Sbjct: 41 cgtttggggatggtgatggcgacctcgg 14 >gi|32836216|gb|CD975894.1|CD975894 QAF10f02.yg QAF Zea mays cDNA clone QAF10f02, mRNA sequence Length = 277 Score = 131 bits (66), Expect = 1e-28 Identities = 84/90 (93%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 178 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 237 Query: 356 cgcttggggatggtgatggccacctcgggc 385 || |||||||||| |||||| ||||||||| Sbjct: 238 cgtttggggatggcgatggcgacctcgggc 267 >gi|18660945|gb|BM501131.1|BM501131 PAC000000001197 Pioneer AF-1 array Zea mays cDNA, mRNA sequence Length = 443 Score = 127 bits (64), Expect = 2e-27 Identities = 151/178 (84%), Gaps = 4/178 (2%) Strand = Plus / Minus Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361 ||||| |||||||||||||||||||||||||||||||||||| | | ||||||||||||| Sbjct: 376 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 317 Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421 |||||||| ||||| | ||| ||||||||||||| | |||| || |||||||||| Sbjct: 316 gggatggtaatggcga-ctccggcttgatcccggcagccctggcggtgccggacagcatg 258 Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479 |||||||| ||||| ||||||||| ||||||||||||||| || | |||||||| Sbjct: 257 acggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagcagcagc 203 >gi|32837549|gb|CD977227.1|CD977227 QAF27g08.yg QAF Zea mays cDNA clone QAF27g08, mRNA sequence Length = 227 Score = 127 bits (64), Expect = 2e-27 Identities = 76/80 (95%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 147 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 206 Query: 356 cgcttggggatggtgatggc 375 || ||||||||||||||||| Sbjct: 207 cgtttggggatggtgatggc 226 >gi|32837810|gb|CD977488.1|CD977488 QAF30d09.yg QAF Zea mays cDNA clone QAF30d09, mRNA sequence Length = 227 Score = 127 bits (64), Expect = 2e-27 Identities = 76/80 (95%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 147 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 206 Query: 356 cgcttggggatggtgatggc 375 || ||||||||||||||||| Sbjct: 207 cgtttggggatggtgatggc 226 >gi|32839158|gb|CD978839.1|CD978839 QAF5g05.yg QAF Zea mays cDNA clone QAF5g05, mRNA sequence Length = 227 Score = 127 bits (64), Expect = 2e-27 Identities = 76/80 (95%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 ||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| Sbjct: 147 gctcatggcagggtgtaatctccgcacttgtagccaacggggcggtcggcgaggttgcag 206 Query: 356 cgcttggggatggtgatggc 375 || ||||||||||||||||| Sbjct: 207 cgtttggggatggtgatggc 226 >gi|16920407|gb|BM074642.1|BM074642 MEST295-F07.T3 ISUM5-RN Zea mays cDNA clone MEST295-F07 3', mRNA sequence Length = 364 Score = 115 bits (58), Expect = 7e-24 Identities = 73/78 (93%) Strand = Plus / Plus Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355 |||||||||| |||||||| ||||||||||||||| |||||||||||| ||||||||||| Sbjct: 287 gctcatggcatagtgtaatttccgcacttgtagccaacggggcggtcggcgaggttgcag 346 Query: 356 cgcttggggatggtgatg 373 || ||||||||||||||| Sbjct: 347 cgtttggggatggtgatg 364 >gi|37376238|gb|CF624627.1|CF624627 zmrws05_0A20-005-h03.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 661 Score = 91.7 bits (46), Expect = 1e-16 Identities = 106/126 (84%) Strand = Plus / Plus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 ||||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 198 ccgcacttgtagccgacggggcggttggcgatggcgcagcgcttggggatggtcatggcc 257 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 258 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 317 Query: 437 tggggg 442 | |||| Sbjct: 318 ttgggg 323 >gi|60343504|gb|DN210477.1|DN210477 MEST898_H09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 734 Score = 91.7 bits (46), Expect = 1e-16 Identities = 106/126 (84%) Strand = Plus / Plus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 ||||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 216 ccgcacttgtagccgacggggcggttggcgatggcgcagcgcttggggatggtcatggcc 275 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 276 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 335 Query: 437 tggggg 442 | |||| Sbjct: 336 ttgggg 341 >gi|67027654|gb|CO456403.1|CO456403 MZCCS15005H08.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 514 Score = 91.7 bits (46), Expect = 1e-16 Identities = 106/126 (84%) Strand = Plus / Plus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 ||||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 276 ccgcacttgtagccgacggggcggttggcgatggcgcagcgcttggggatggtcatggcc 335 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 336 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 395 Query: 437 tggggg 442 | |||| Sbjct: 396 ttgggg 401 >gi|5018475|gb|AI714668.1|AI714668 605068H12.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 566 Score = 85.7 bits (43), Expect = 7e-15 Identities = 105/126 (83%) Strand = Plus / Plus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 ||||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 178 ccgcacttgtagccgacggggcggttggcgatggcgcagcgcttggggatggtcatggcc 237 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 238 acggnaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 297 Query: 437 tggggg 442 | |||| Sbjct: 298 ttgggg 303 >gi|14569314|gb|BI097637.1|BI097637 949016E02.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 508 Score = 83.8 bits (42), Expect = 3e-14 Identities = 105/126 (83%) Strand = Plus / Minus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 |||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 354 ccgcacttgtagccgacggggcggctggcgatggcgcagcgcttggggatggtcatggcc 295 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 294 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 235 Query: 437 tggggg 442 | |||| Sbjct: 234 ttgggg 229 >gi|45846919|gb|CN070862.1|CN070862 1021004D11.x2 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 556 Score = 83.8 bits (42), Expect = 3e-14 Identities = 105/126 (83%) Strand = Plus / Plus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 |||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 161 ccgcacttgtagccgacggggcggctggcgatggcgcagcgcttggggatggtcatggcc 220 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 221 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 280 Query: 437 tggggg 442 | |||| Sbjct: 281 ttgggg 286 >gi|60352067|gb|DN219040.1|DN219040 MEST1075_E10.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 702 Score = 83.8 bits (42), Expect = 3e-14 Identities = 105/126 (83%) Strand = Plus / Plus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 |||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 239 ccgcacttgtagccgacggggcggctggcgatggcgcagcgcttggggatggtcatggcc 298 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 299 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 358 Query: 437 tggggg 442 | |||| Sbjct: 359 ttgggg 364 >gi|21211129|gb|AY108051.1| Zea mays PCO108087 mRNA sequence Length = 692 Score = 83.8 bits (42), Expect = 3e-14 Identities = 105/126 (83%) Strand = Plus / Minus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 |||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 408 ccgcacttgtagccgacggggcggctggcgatggcgcagcgcttggggatggtcatggcc 349 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 348 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 289 Query: 437 tggggg 442 | |||| Sbjct: 288 ttgggg 283 >gi|21211129|gb|AY108051.1| Zea mays PCO108087 mRNA sequence Length = 692 Score = 83.8 bits (42), Expect = 3e-14 Identities = 105/126 (83%) Strand = Plus / Minus Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376 |||||||||||||||||||||||| | ||| | |||||||||||||||||| |||||| Sbjct: 408 ccgcacttgtagccgacggggcggctggcgatggcgcagcgcttggggatggtcatggcc 349 Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436 || | ||||||| |||| |||| || || | |||||||||||||||||| |||||| Sbjct: 348 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 289 Query: 437 tggggg 442 | |||| Sbjct: 288 ttgggg 283 >gi|5525288|gb|AI861127.1|AI861127 603012E07.x1 603 - stressed root cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 252 Score = 67.9 bits (34), Expect = 2e-09 Identities = 101/122 (82%), Gaps = 1/122 (0%) Strand = Plus / Plus Query: 321 acttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacct 380 ||||||||||||||||||||| | ||| | ||| |||||||||||||| |||||||| Sbjct: 21 acttgtagccgacggggcggtgg-cgatggcgcaacgcttggggatggtcatggccacgg 79 Query: 381 cgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggg 440 | ||||||| |||| |||| || || | |||||||||||||||||| ||||||| || Sbjct: 80 caggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcacttgg 139 Query: 441 gg 442 || Sbjct: 140 gg 141 >gi|17931129|gb|BM268089.1|BM268089 MEST376-E07.T3 ISUM5-RN Zea mays cDNA clone MEST376-E07 3', mRNA sequence Length = 630 Score = 48.1 bits (24), Expect = 0.001 Identities = 56/66 (84%), Gaps = 3/66 (4%) Strand = Plus / Minus Query: 414 acagcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgc 473 |||||||||||||||| ||||| ||||||||| ||||||||||||||| || | || Sbjct: 630 acagcatgacggcgcacaggcagctggggctctg---cccgatggtgtgcacagcggagc 574 Query: 474 agcagc 479 |||||| Sbjct: 573 agcagc 568 >gi|50339380|gb|CO534506.1|CO534506 3530_1_228_1_A08.y_1 3530 - Full length cDNA library created by Invitrogen from multiple tissues Zea mays cDNA, mRNA sequence Length = 506 Score = 40.1 bits (20), Expect = 0.35 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 gccgttggacggcgccgagc 497 |||||||||||||||||||| Sbjct: 420 gccgttggacggcgccgagc 401 >gi|71448143|gb|DR829193.1|DR829193 ZM_BFb0074N20.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 639 Score = 40.1 bits (20), Expect = 0.35 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 gccgttggacggcgccgagc 497 |||||||||||||||||||| Sbjct: 394 gccgttggacggcgccgagc 375 >gi|93014290|gb|EB639810.1|EB639810 ZM_BFb0328A07.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 513 Score = 40.1 bits (20), Expect = 0.35 Identities = 20/20 (100%) Strand = Plus / Minus Query: 478 gccgttggacggcgccgagc 497 |||||||||||||||||||| Sbjct: 394 gccgttggacggcgccgagc 375 >gi|91065017|gb|AC184793.1| Zea mays chromosome UNK clone CH201-11H16; ZMMBBc0011H16, *** SEQUENCING IN PROGRESS ***, 22 unordered pieces Length = 202926 Score = 40.1 bits (20), Expect = 0.35 Identities = 20/20 (100%) Strand = Plus / Minus Query: 454 gatggtgtgcaccgccgtgc 473 |||||||||||||||||||| Sbjct: 7461 gatggtgtgcaccgccgtgc 7442 >gi|71450303|gb|DR831353.1|DR831353 ZM_BFb0079O18.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 253 Score = 38.2 bits (19), Expect = 1.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 509 gccgcggacgcgcacggcg 527 ||||||||||||||||||| Sbjct: 185 gccgcggacgcgcacggcg 167 >gi|4775809|gb|AI657401.2|AI657401 605001E01.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 286 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 47 ggacttcttggccgtctt 64 >gi|4826106|gb|AI667734.1|AI667734 605026F09.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 524 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 305 gcggacgcgaccagcgcgagga 326 >gi|4885770|gb|AI676890.1|AI676890 605046D04.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 385 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 146 ggacttcttggccgtctt 163 >gi|4885810|gb|AI676930.1|AI676930 605046H04.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 611 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 403 ggacttcttggccgtctt 420 >gi|5005680|gb|AI711742.1|AI711742 605061A09.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 545 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 309 ggacttcttggccgtctt 326 >gi|5005823|gb|AI711885.1|AI711885 605066F05.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 438 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 367 ggacttcttggccgtctt 384 >gi|5006004|gb|AI712066.1|AI712066 605062A10.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 617 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 410 ggacttcttggccgtctt 427 >gi|5069683|gb|AI737648.1|AI737648 605036C06.x2 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 516 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 359 gcggacgcgaccagcgcgagga 380 >gi|5124324|gb|AI746060.1|AI746060 605079E06.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 568 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 367 gcggacgcgaccagcgcgagga 388 >gi|5455972|gb|AI833662.1|AI833662 605093F01.x1 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 559 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 357 ggacttcttggccgtctt 374 >gi|5456162|gb|AI833852.1|AI833852 605096C07.x2 605 - Endosperm cDNA library from Schmidt lab Zea mays cDNA, mRNA sequence Length = 560 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 357 ggacttcttggccgtctt 374 >gi|5761986|gb|AI967034.1|AI967034 496020D06.x1 496 - stressed shoot cDNA library from Wang/Bohnert lab Zea mays cDNA, mRNA sequence Length = 500 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 295 ggacttcttggccgtctt 312 >gi|5928828|gb|AW056120.1|AW056120 660004D12.y1 660 - Mixed stages of anther and pollen Zea mays cDNA, mRNA sequence Length = 448 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 41 ggacttcttggccgtctt 24 >gi|7216943|gb|AW563050.1|AW563050 660071G03.y1 660 - Mixed stages of anther and pollen Zea mays cDNA, mRNA sequence Length = 281 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 34 ggacttcttggccgtctt 17 >gi|7227766|gb|AW566407.1|AW566407 660071G03.X1 660 - Mixed stages of anther and pollen Zea mays cDNA, mRNA sequence Length = 448 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 356 ggacttcttggccgtctt 373 >gi|8577326|gb|BE129963.1|BE129963 945033H04.X1 945 - Mixed adult tissues from Walbot lab, same as 707 (SK) Zea mays cDNA, mRNA sequence Length = 591 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 397 cttcttggccgtcttggacagc 418 ||||||||||||||||| |||| Sbjct: 31 cttcttggccgtcttgggcagc 10 >gi|8665586|gb|BE186402.1|BE186402 946005E02.X3 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 547 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 357 gcggacgcgaccagcgcgagga 378 >gi|8665737|gb|BE186553.1|BE186553 946008B06.X1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 519 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 307 gcggacgcgaccagcgcgagga 328 >gi|8665286|gb|BE186102.1|BE186102 946005E02.X2 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 577 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 374 gcggacgcgaccagcgcgagga 395 >gi|9733877|gb|BE512629.1|BE512629 946073G03.x1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 391 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 344 gcggacgcgaccagcgcgagga 365 >gi|9794419|gb|BE552727.1|BE552727 946084H04.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 482 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 173 gcggacgcgaccagcgcgagga 152 >gi|14202690|gb|BG836367.1|BG836367 Zm06_02b10_R Zm06_AAFC_ECORC_Fusarium_graminearum_inoculated_corn_ear tip Zea mays cDNA clone Zm06_02b10, mRNA sequence Length = 609 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 535 cagcgccatcctgtccggcggc 556 ||||||||||| |||||||||| Sbjct: 474 cagcgccatccagtccggcggc 495 >gi|14203314|gb|BG836991.1|BG836991 Zm08_08g11_A Zm08_AAFC_ECORC_Fusarium_graminearum_inoculated_corn_ear Zea mays cDNA clone Zm08_08g11, mRNA sequence Length = 599 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 366 ggacttcttggccgtctt 383 >gi|14242650|gb|BG840385.2|BG840385 MEST12-B11.T7-1 ISUM4-TN Zea mays cDNA clone MEST12-B11 5', mRNA sequence Length = 424 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 206 gcggacgcgaccagcgcgagga 185 >gi|14243150|gb|BG840815.2|BG840815 MEST12-B11.T3 ISUM4-TN Zea mays cDNA clone MEST12-B11 3', mRNA sequence Length = 514 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 309 gcggacgcgaccagcgcgagga 330 >gi|14996977|gb|BI319098.1|BI319098 949039C09.x2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 207 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 184 gcggacgcgaccagcgcgagga 205 >gi|15057175|gb|BI361147.1|BI361147 949056E02.x2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 429 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 235 ggacttcttggccgtctt 252 >gi|15199168|gb|BI423693.1|BI423693 949056E02.y1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 544 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 192 ggacttcttggccgtctt 175 >gi|15214934|gb|BI431103.1|BI431103 949069F03.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 579 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 362 ggacttcttggccgtctt 379 >gi|15499643|gb|BI596156.1|BI596156 949078F08.x1 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 517 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 389 ggacttcttggccgtctt 406 >gi|15632660|gb|BI679753.1|BI679753 949078F08.y2 949 - Juvenile leaf and shoot cDNA from Steve Moose Zea mays cDNA, mRNA sequence Length = 519 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 123 ggacttcttggccgtctt 106 >gi|16920487|gb|BM074680.1|BM074680 MEST296-B10.T3 ISUM5-RN Zea mays cDNA clone MEST296-B10 3', mRNA sequence Length = 643 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 403 ggacttcttggccgtctt 420 >gi|16925858|gb|BM078926.1|BM078926 MEST87-A11.T3 ISUM4-TN Zea mays cDNA clone MEST87-A11 3', mRNA sequence Length = 600 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 395 gcggacgcgaccagcgcgagga 416 >gi|17931611|gb|BM268571.1|BM268571 MEST397-C12.univ ISUM5-RN Zea mays cDNA clone MEST397-C12 3', mRNA sequence Length = 600 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 389 gcggacgcgaccagcgcgagga 410 >gi|17932055|gb|BM269015.1|BM269015 MEST403-E12.univ ISUM5-RN Zea mays cDNA clone MEST403-E12 3', mRNA sequence Length = 729 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 402 ggacttcttggccgtctt 419 >gi|18167674|gb|BM337514.1|BM337514 MEST208-A02.T3 ISUM5-RN Zea mays cDNA clone MEST208-A02 3', mRNA sequence Length = 587 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 404 ggacttcttggccgtctt 421 >gi|18172933|gb|BM348321.1|BM348321 MEST289-C11.T3 ISUM5-RN Zea mays cDNA clone MEST289-C11 3', mRNA sequence Length = 731 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 404 ggacttcttggccgtctt 421 >gi|18178107|gb|BM379317.1|BM379317 MEST503-H07.univ ISUM6 Zea mays cDNA clone MEST503-H07 3', mRNA sequence Length = 527 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 373 gcggacgcgaccagcgcgagga 394 >gi|18180064|gb|BM381274.1|BM381274 MEST532-D12.univ ISUM6 Zea mays cDNA clone MEST532-D12 3', mRNA sequence Length = 666 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 419 ggacttcttggccgtctt 436 >gi|19436381|gb|BM952791.1|BM952791 952059B07.x1 952 - BMS tissue from Walbot Lab (reduced rRNA) Zea mays cDNA, mRNA sequence Length = 594 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 191 ggacttcttggccgtctt 174 >gi|19769359|gb|BQ034080.1|BQ034080 1091001G07.x2 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 437 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 344 gcggacgcgaccagcgcgagga 365 >gi|19769763|gb|BQ034484.1|BQ034484 1091001G07.x3 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 437 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 344 gcggacgcgaccagcgcgagga 365 >gi|19769820|gb|BQ034541.1|BQ034541 1091003F05.x2 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 537 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 340 gcggacgcgaccagcgcgagga 361 >gi|19821976|gb|BQ047985.1|BQ047985 1091001C08.y1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 552 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 146 gcggacgcgaccagcgcgagga 125 >gi|19822096|gb|BQ048120.1|BQ048120 1091003B06.y1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 455 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 50 gcggacgcgaccagcgcgagga 29 >gi|19822254|gb|BQ048278.1|BQ048278 1091005F01.y1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 554 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 154 gcggacgcgaccagcgcgagga 133 >gi|19822286|gb|BQ048310.1|BQ048310 1091006B02.y1 1091 - Immature ear with common ESTs screened by Schmidt lab Zea mays cDNA, mRNA sequence Length = 527 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 173 gcggacgcgaccagcgcgagga 152 >gi|22520720|gb|BU079531.1|BU079531 946145B05.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 554 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 187 gcggacgcgaccagcgcgagga 166 >gi|22546042|gb|BU098363.1|BU098363 946134F06.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 636 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 223 gcggacgcgaccagcgcgagga 202 >gi|22819022|gb|BU499112.1|BU499112 946172D01.y1 946 - tassel primordium prepared by Schmidt lab Zea mays cDNA, mRNA sequence Length = 550 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 193 gcggacgcgaccagcgcgagga 172 >gi|24768226|gb|CA403355.1|CA403355 EL01N0450E09.g Endosperm_4 Zea mays cDNA, mRNA sequence Length = 537 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 419 ggacttcttggccgtctt 436 >gi|26455865|gb|CA827448.1|CA827448 1114014H05.y3 1114 - Unigene IV from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 521 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 206 gcggacgcgaccagcgcgagga 185 >gi|26557536|gb|CA829771.1|CA829771 3529_1_8_1_G10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 543 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 209 gcggacgcgaccagcgcgagga 188 >gi|26557773|gb|CA830008.1|CA830008 3529_1_3_1_E12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 505 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 180 gcggacgcgaccagcgcgagga 159 >gi|28568851|gb|CB280726.1|CB280726 3529_1_14_1_B03.y_5 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 609 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 236 ggacttcttggccgtctt 219 >gi|28568886|gb|CB280761.1|CB280761 3529_1_14_1_E12.y_5 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 595 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 204 gcggacgcgaccagcgcgagga 183 >gi|28873438|gb|CB329428.1|CB329428 3529_1_30_1_A07.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 573 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 220 gcggacgcgaccagcgcgagga 199 >gi|28873923|gb|CB329848.1|CB329848 3529_1_24_1_E08.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 402 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 381 ggacttcttggccgtctt 398 >gi|28873924|gb|CB329849.1|CB329849 3529_1_24_1_E08.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 577 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 234 ggacttcttggccgtctt 217 >gi|28909552|gb|CB330986.1|CB330986 3529_1_25_1_G01.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 526 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 215 gcggacgcgaccagcgcgagga 194 >gi|28910005|gb|CB331209.1|CB331209 3529_1_34_1_F11.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 644 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 246 ggacttcttggccgtctt 229 >gi|28910256|gb|CB331348.1|CB331348 3529_1_36_1_D09.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 552 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 221 gcggacgcgaccagcgcgagga 200 >gi|28910914|gb|CB331678.1|CB331678 3529_1_34_1_F11.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 636 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 395 ggacttcttggccgtctt 412 >gi|28930793|gb|CB334154.1|CB334154 3529_1_21_1_A01.y_2 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 560 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 208 gcggacgcgaccagcgcgagga 187 >gi|28930825|gb|CB334186.1|CB334186 3529_1_21_1_C12.y_2 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 576 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 222 gcggacgcgaccagcgcgagga 201 >gi|28931147|gb|CB334508.1|CB334508 3529_1_25_1_G01.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 327 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 282 gcggacgcgaccagcgcgagga 303 >gi|28986952|gb|CB351390.1|CB351390 3529_1_22_1_D01.x_4 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 482 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 270 gcggacgcgaccagcgcgagga 291 >gi|29167751|gb|CB411011.1|CB411011 3529_1_48_1_E10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 488 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 229 ggacttcttggccgtctt 212 >gi|29167956|gb|CB411216.1|CB411216 3529_1_60_1_D01.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 641 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 235 ggacttcttggccgtctt 218 >gi|29577010|gb|CB617122.1|CB617122 3529_1_69_1_B08.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 599 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 221 gcggacgcgaccagcgcgagga 200 >gi|30031732|gb|CB833583.1|CB833583 3529_1_82_1_C09.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 549 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 200 gcggacgcgaccagcgcgagga 179 >gi|30031754|gb|CB833605.1|CB833605 3529_1_82_1_E10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 619 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 235 ggacttcttggccgtctt 218 >gi|30032031|gb|CB833882.1|CB833882 3529_1_85_1_A03.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 452 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 231 gcggacgcgaccagcgcgagga 252 >gi|30086987|gb|CB885195.1|CB885195 3529_1_82_1_C09.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 522 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 309 gcggacgcgaccagcgcgagga 330 >gi|30087009|gb|CB885217.1|CB885217 3529_1_82_1_E10.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 545 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 339 ggacttcttggccgtctt 356 >gi|30087048|gb|CB885256.1|CB885256 3529_1_85_1_A03.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 500 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 175 gcggacgcgaccagcgcgagga 154 >gi|30087136|gb|CB885344.1|CB885344 3529_1_86_1_B12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 514 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 130 gcggacgcgaccagcgcgagga 109 >gi|30088308|gb|CB886513.1|CB886513 3529_1_96_1_C04.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 489 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 268 gcggacgcgaccagcgcgagga 289 >gi|30705133|gb|CD058670.1|CD058670 3529_1_105_1_H04.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 296 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 110 gcggacgcgaccagcgcgagga 131 >gi|30705137|gb|CD058671.1|CD058671 3529_1_105_1_H04.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 564 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 212 gcggacgcgaccagcgcgagga 191 >gi|30705480|gb|CD058796.1|CD058796 3529_1_107_1_C10.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 493 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 139 gcggacgcgaccagcgcgagga 118 >gi|30705498|gb|CD058802.1|CD058802 3529_1_107_1_D06.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 620 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 231 ggacttcttggccgtctt 214 >gi|30705595|gb|CD058837.1|CD058837 3529_1_107_1_H04.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 426 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 102 gcggacgcgaccagcgcgagga 81 >gi|30706033|gb|CD059007.1|CD059007 3529_1_107_1_A09.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 533 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 312 gcggacgcgaccagcgcgagga 333 >gi|30706104|gb|CD059029.1|CD059029 3529_1_107_1_C10.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 490 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 269 gcggacgcgaccagcgcgagga 290 >gi|30706127|gb|CD059036.1|CD059036 3529_1_107_1_D06.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 584 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 340 ggacttcttggccgtctt 357 >gi|30706239|gb|CD059074.1|CD059074 3529_1_107_1_H04.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 489 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 268 gcggacgcgaccagcgcgagga 289 >gi|29129698|gb|CB380402.1|CB380402 3529_1_21_1_C12.x_2 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 523 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 318 gcggacgcgaccagcgcgagga 339 >gi|29129757|gb|CB380461.1|CB380461 3529_1_22_1_D01.y_2 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 550 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 213 gcggacgcgaccagcgcgagga 192 >gi|29129842|gb|CB380546.1|CB380546 3529_1_21_1_A01.x_4 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 461 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 240 gcggacgcgaccagcgcgagga 261 >gi|29129873|gb|CB380577.1|CB380577 3529_1_21_1_C12.x_4 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 502 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 281 gcggacgcgaccagcgcgagga 302 >gi|29130055|gb|CB380759.1|CB380759 3529_1_24_1_E08.x_4 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 586 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 341 ggacttcttggccgtctt 358 >gi|29130336|gb|CB381040.1|CB381040 3529_1_49_1_G09.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 318 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 39 ggacttcttggccgtctt 22 >gi|29130355|gb|CB381059.1|CB381059 3529_1_50_1_A08.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 530 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 150 ggacttcttggccgtctt 133 >gi|29130705|gb|CB381409.1|CB381409 3529_1_46_1_H08.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 572 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 238 ggacttcttggccgtctt 221 >gi|29543403|gb|CB603799.1|CB603799 3529_1_54_1_G05.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 451 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 230 gcggacgcgaccagcgcgagga 251 >gi|29543726|gb|CB604106.1|CB604106 3529_1_54_1_G05.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 534 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 180 gcggacgcgaccagcgcgagga 159 >gi|29544048|gb|CB604428.1|CB604428 3529_1_63_1_B12.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 492 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 281 gcggacgcgaccagcgcgagga 302 >gi|29544534|gb|CB604914.1|CB604914 3529_1_63_1_B12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 568 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 202 gcggacgcgaccagcgcgagga 181 >gi|29544664|gb|CB605044.1|CB605044 3529_1_59_1_A09.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 555 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 310 ggacttcttggccgtctt 327 >gi|29544768|gb|CB605376.1|CB605376 3529_1_60_1_D01.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 549 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 306 ggacttcttggccgtctt 323 >gi|29544989|gb|CB605167.1|CB605167 3529_1_69_1_B08.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 509 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 310 gcggacgcgaccagcgcgagga 331 >gi|29945828|gb|CB815840.1|CB815840 3529_1_77_1_D12.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 507 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 304 gcggacgcgaccagcgcgagga 325 >gi|29945879|gb|CB815866.1|CB815866 3529_1_77_1_G07.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 460 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 244 gcggacgcgaccagcgcgagga 265 >gi|29946882|gb|CB816371.1|CB816371 3529_1_77_1_D12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 514 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 203 gcggacgcgaccagcgcgagga 182 >gi|29946935|gb|CB816398.1|CB816398 3529_1_77_1_G07.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 564 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 212 gcggacgcgaccagcgcgagga 191 >gi|31353146|gb|CD437503.1|CD437503 EL01N0501F11.b Endosperm_5 Zea mays cDNA, mRNA sequence Length = 704 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 255 ggacttcttggccgtctt 238 >gi|31360994|gb|CD445351.1|CD445351 EL01N0450E09.b Endosperm_4 Zea mays cDNA, mRNA sequence Length = 537 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 119 ggacttcttggccgtctt 102 >gi|31405928|gb|CD484660.1|CD484660 3529_1_116_1_B12.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 570 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 331 ggacttcttggccgtctt 348 >gi|31557931|gb|CD527143.1|CD527143 3529_1_116_1_B12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 501 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 196 ggacttcttggccgtctt 179 >gi|31558146|gb|CD527358.1|CD527358 3529_1_120_1_A05.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 488 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 203 gcggacgcgaccagcgcgagga 182 >gi|31558533|gb|CD527745.1|CD527745 3529_1_122_1_G12.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 613 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 194 ggacttcttggccgtctt 177 >gi|31558726|gb|CD527938.1|CD527938 3529_1_124_1_A11.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 583 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 338 ggacttcttggccgtctt 355 >gi|31558727|gb|CD527939.1|CD527939 3529_1_124_1_A11.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 619 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 235 ggacttcttggccgtctt 218 >gi|31612179|gb|CD568801.1|CD568801 3529_1_97_1_H09.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 562 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 237 gcggacgcgaccagcgcgagga 216 >gi|31664182|gb|CD572907.1|CD572907 3529_1_122_1_G12.x_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 542 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 309 ggacttcttggccgtctt 326 >gi|31909337|gb|CD650868.1|CD650868 3529_1_132_1_D06.x_2 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 443 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 238 gcggacgcgaccagcgcgagga 259 >gi|31911004|gb|CD651708.1|CD651708 3529_1_136_1_A03.y_1 3529 - 2 mm ear tissue from Schmidt and Hake labs Zea mays cDNA, mRNA sequence Length = 541 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 222 gcggacgcgaccagcgcgagga 201 >gi|32854760|gb|CD994441.1|CD994441 QBB15e12.pg QBB Zea mays cDNA clone QBB15e12, mRNA sequence Length = 475 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 213 cactgacacgtcaccgtc 230 |||||||||||||||||| Sbjct: 285 cactgacacgtcaccgtc 302 >gi|32854761|gb|CD994442.1|CD994442 QBB15e12.xg QBB Zea mays cDNA clone QBB15e12, mRNA sequence Length = 484 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 213 cactgacacgtcaccgtc 230 |||||||||||||||||| Sbjct: 192 cactgacacgtcaccgtc 175 >gi|32863980|gb|CF003662.1|CF003662 QBH21g11.pg QBH Zea mays cDNA clone QBH21g11, mRNA sequence Length = 562 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 334 gcggacgcgaccagcgcgagga 355 >gi|32863981|gb|CF003663.1|CF003663 QBH21g11.xg QBH Zea mays cDNA clone QBH21g11, mRNA sequence Length = 562 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 229 gcggacgcgaccagcgcgagga 208 >gi|32868780|gb|CF008462.1|CF008462 QBJ10h01.xg QBJ Zea mays cDNA clone QBJ10h01, mRNA sequence Length = 569 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 146 tgtccggcggcgtcgccc 129 >gi|32868792|gb|CF008474.1|CF008474 QBJ11a02.xg QBJ Zea mays cDNA clone QBJ11a02, mRNA sequence Length = 525 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 146 tgtccggcggcgtcgccc 129 >gi|32868869|gb|CF008551.1|CF008551 QBJ11h01.xg QBJ Zea mays cDNA clone QBJ11h01, mRNA sequence Length = 525 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 146 tgtccggcggcgtcgccc 129 >gi|32868975|gb|CF008657.1|CF008657 QBJ13a10.xg QBJ Zea mays cDNA clone QBJ13a10, mRNA sequence Length = 579 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 146 tgtccggcggcgtcgccc 129 >gi|32869018|gb|CF008700.1|CF008700 QBJ13e09.xg QBJ Zea mays cDNA clone QBJ13e09, mRNA sequence Length = 577 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 144 tgtccggcggcgtcgccc 127 >gi|32869075|gb|CF008757.1|CF008757 QBJ14c03.xg QBJ Zea mays cDNA clone QBJ14c03, mRNA sequence Length = 569 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 144 tgtccggcggcgtcgccc 127 >gi|32869651|gb|CF009333.1|CF009333 QBJ19h07.xg QBJ Zea mays cDNA clone QBJ19h07, mRNA sequence Length = 449 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 168 tgtccggcggcgtcgccc 151 >gi|32870271|gb|CF009953.1|CF009953 QBJ24g05.xg QBJ Zea mays cDNA clone QBJ24g05, mRNA sequence Length = 316 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 146 tgtccggcggcgtcgccc 129 >gi|32870452|gb|CF010134.1|CF010134 QBJ26b07.xg QBJ Zea mays cDNA clone QBJ26b07, mRNA sequence Length = 742 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 146 tgtccggcggcgtcgccc 129 >gi|32870753|gb|CF010435.1|CF010435 QBJ28f08.xg QBJ Zea mays cDNA clone QBJ28f08, mRNA sequence Length = 750 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 546 tgtccggcggcgtcgccc 563 |||||||||||||||||| Sbjct: 146 tgtccggcggcgtcgccc 129 >gi|37376580|gb|CF624831.1|CF624831 zmrws05_0A20-009-g10.s1 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 495 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 436 ggacttcttggccgtctt 453 >gi|37378430|gb|CF625905.1|CF625905 zmrws05_0B10-007-d02.s4 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 631 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 384 ggacttcttggccgtctt 401 >gi|37378671|gb|CF626041.1|CF626041 zmrws05_0B10-009-a09.s1 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 627 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 384 ggacttcttggccgtctt 401 >gi|37378754|gb|CF626084.1|CF626084 zmrws05_0B10-009-e09.s1 zmrws05 Zea mays cDNA 3', mRNA sequence Length = 510 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 386 ggacttcttggccgtctt 403 >gi|37382702|gb|CF628311.1|CF628311 zmrws48_0A10-004-d07.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 647 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 400 ggacttcttggccgtctt 417 >gi|37384189|gb|CF629149.1|CF629149 zmrws48_0A10-014-a06.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 454 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 383 ggacttcttggccgtctt 400 >gi|37384680|gb|CF629433.1|CF629433 zmrws48_0A20-001-c07.s3 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 572 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 375 ggacttcttggccgtctt 392 >gi|37386542|gb|CF630457.1|CF630457 zmrws48_0A20-013-a12.s1 zmrws48 Zea mays cDNA 3', mRNA sequence Length = 552 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 375 gcggacgcgaccagcgcgagga 396 >gi|37396016|gb|CF635295.1|CF635295 zmrww00_0A20-008-h06.s1 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 647 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 405 ggacttcttggccgtctt 422 >gi|37397041|gb|CF635815.1|CF635815 zmrww00_0A20-015-h03.s0 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 444 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 378 ggacttcttggccgtctt 395 >gi|37400343|gb|CF637523.1|CF637523 zmrww00_0B20-006-g08.s1 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 573 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 375 gcggacgcgaccagcgcgagga 396 >gi|37401069|gb|CF637897.1|CF637897 zmrww00_0B20-011-b08.s1 zmrww00 Zea mays cDNA 3', mRNA sequence Length = 567 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 348 gcggacgcgaccagcgcgagga 369 >gi|40335351|gb|CK369421.1|CK369421 zmrws485_0A10-004-d07.s0 zmrws485 Zea mays cDNA 5', mRNA sequence Length = 674 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 255 ggacttcttggccgtctt 238 >gi|40337516|gb|CK371586.1|CK371586 zmrww005_0B20-006-g08.s0 zmrww005 Zea mays cDNA 5', mRNA sequence Length = 603 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 206 gcggacgcgaccagcgcgagga 185 >gi|45847513|gb|CN071456.1|CN071456 1021012G02.x1 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 537 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 337 gcggacgcgaccagcgcgagga 358 >gi|45848013|gb|CN071956.1|CN071956 1021022E04.x2 1021 - Unigene II from Maize Genome Project Zea mays cDNA, mRNA sequence Length = 515 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 304 ggacttcttggccgtctt 321 >gi|60337953|gb|DN204926.1|DN204926 MEST811_E07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 577 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 347 ggacttcttggccgtctt 364 >gi|60341329|gb|DN208302.1|DN208302 MEST867_A11.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 555 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 325 ggacttcttggccgtctt 342 >gi|60343480|gb|DN210453.1|DN210453 MEST898_G05.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 555 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 197 gcggacgcgaccagcgcgagga 176 >gi|60343771|gb|DN210744.1|DN210744 MEST915_B03.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 583 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 339 ggacttcttggccgtctt 356 >gi|60346279|gb|DN213252.1|DN213252 MEST962_E09.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 555 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 325 ggacttcttggccgtctt 342 >gi|60346999|gb|DN213972.1|DN213972 MEST990_C01.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 582 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 339 ggacttcttggccgtctt 356 >gi|60347081|gb|DN214054.1|DN214054 MEST991_E01.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 583 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 339 ggacttcttggccgtctt 356 >gi|60358384|gb|DN225357.1|DN225357 MEST1173_D07.T7-1 UGA-ZmSAM-XZ2 Zea mays cDNA, mRNA sequence Length = 648 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 418 ggacttcttggccgtctt 435 >gi|61118332|gb|DN559293.1|DN559293 ME1-G07-T3-96-R1 E7PCR Zea mays cDNA clone E7PCRME107G, mRNA sequence Length = 468 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 259 ggacttcttggccgtctt 242 >gi|67012778|gb|CO441527.1|CO441527 MZCCL10032H04.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 605 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 213 ggacttcttggccgtctt 196 >gi|67015096|gb|CO443845.1|CO443845 MZCCL10063E11.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 537 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 245 gcggacgcgaccagcgcgagga 224 >gi|67015876|gb|CO444625.1|CO444625 MZCCL10074A07.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 682 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 276 ggacttcttggccgtctt 259 >gi|67021436|gb|CO450185.1|CO450185 MZCCL10146E12.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 593 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 248 gcggacgcgaccagcgcgagga 227 >gi|67024489|gb|CO453238.1|CO453238 MZCCL10180H09.g Maize Endosperm cDNA Library Zea mays cDNA, mRNA sequence Length = 614 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 208 ggacttcttggccgtctt 191 >gi|71313599|gb|DR793375.1|DR793375 ZM_BFb0013J17.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 787 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Plus Query: 397 cttcttggccgtcttggacagc 418 ||||||||||||||||| |||| Sbjct: 85 cttcttggccgtcttgggcagc 106 >gi|71427682|gb|DR808732.1|DR808732 ZM_BFb0035J22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 595 Score = 36.2 bits (18), Expect = 5.5 Identities = 21/22 (95%) Strand = Plus / Minus Query: 602 gcggacgcgaccagggcgagga 623 |||||||||||||| ||||||| Sbjct: 210 gcggacgcgaccagcgcgagga 189 >gi|71428007|gb|DR809057.1|DR809057 ZM_BFb0036B12.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 912 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 416 agcatgacggcgcagagg 433 |||||||||||||||||| Sbjct: 357 agcatgacggcgcagagg 340 >gi|71432686|gb|DR813736.1|DR813736 ZM_BFb0043A24.f ZM_BFb Zea mays cDNA 3', mRNA sequence Length = 653 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Plus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 401 ggacttcttggccgtctt 418 >gi|71432687|gb|DR813737.1|DR813737 ZM_BFb0043A24.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 561 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 253 ggacttcttggccgtctt 236 >gi|71442866|gb|DR823916.1|DR823916 ZM_BFb0065F22.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 563 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 394 ggacttcttggccgtctt 411 |||||||||||||||||| Sbjct: 204 ggacttcttggccgtctt 187 >gi|71444667|gb|DR825717.1|DR825717 ZM_BFb0068C14.r ZM_BFb Zea mays cDNA 5', mRNA sequence Length = 922 Score = 36.2 bits (18), Expect = 5.5 Identities = 18/18 (100%) Strand = Plus / Minus Query: 416 agcatgacggcgcagagg 433 |||||||||||||||||| Sbjct: 420 agcatgacggcgcagagg 403 Database: mais_NCBI.fasta Posted date: Apr 26, 2006 11:51 AM Number of letters in database: 669,372,029 Number of sequences in database: 836,351 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 295,152 Number of Sequences: 836351 Number of extensions: 295152 Number of successful extensions: 23832 Number of sequences better than 10.0: 309 Number of HSP's better than 10.0 without gapping: 309 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 23451 Number of HSP's gapped (non-prelim): 337 length of query: 673 length of database: 669,372,029 effective HSP length: 19 effective length of query: 654 effective length of database: 653,481,360 effective search space: 427376809440 effective search space used: 427376809440 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)