BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QCH2g03.yg.2.1
         (537 letters)

Database: Triticum_nucl_with_EST.fasta 
           636,343 sequences; 367,240,239 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AL818597.1|AL818597  AL818597 l:125 Triticum aestivum cDN...    70   2e-010
gb|BQ743211.1|BQ743211  WHE4101_D09_G17ZS Wheat salt-stresse...    42   0.038
gb|BQ902766.1|BQ902766  Ta03_01c07_R Ta03_AAFC_ECORC_Fusariu...    42   0.038
gb|BU099331.1|BU099331  WHE3306_C03_E06ZS Chinese Spring whe...    42   0.038
gb|CA497978.1|CA497978  WHE3236_G04_N08ZT Wheat meiotic anth...    42   0.038
gb|CA501322.1|CA501322  WHE4032_B11_D22ZT Wheat meiotic anth...    42   0.038

>gb|AL818597.1|AL818597 AL818597 l:125 Triticum aestivum cDNA clone H10_l125_plate_8, mRNA
           sequence
          Length = 107

 Score = 69.9 bits (35), Expect = 2e-010
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 474 caaactatagatatgaatcaggagcactatatggaggagncnttgaaaatgag 526
           ||||| ||||| |||||||||||||| |||||||||||| | |||||||||||
Sbjct: 45  caaaccatagacatgaatcaggagcattatatggaggagacattgaaaatgag 97



>gb|BQ743211.1|BQ743211 WHE4101_D09_G17ZS Wheat salt-stressed root cDNA library Triticum
           aestivum cDNA clone WHE4101_D09_G17, mRNA sequence
          Length = 705

 Score = 42.1 bits (21), Expect = 0.038
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 417 gaaggaaagccagaaaaccaganccatgcaataatattcacccg 460
           ||||| ||||| ||||| || | ||||||||| |||||||||||
Sbjct: 579 gaagggaagcctgaaaatcaaaaccatgcaattatattcacccg 622



>gb|BQ902766.1|BQ902766 Ta03_01c07_R
           Ta03_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_he
           ads Triticum aestivum cDNA clone Ta03_01c07, mRNA
           sequence
          Length = 559

 Score = 42.1 bits (21), Expect = 0.038
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 474 caaactatagatatgaatcaggagcactatatggaggagncnttgaaaatgagnaatctg 533
           ||||| || ||||||||||||||  ||||| | |||||| |  | |||||||| ||||||
Sbjct: 558 caaaccattgatatgaatcaggataactatttcgaggaggcactaaaaatgagaaatctg 499

             
Query: 534 ct 535
           ||
Sbjct: 498 ct 497



>gb|BU099331.1|BU099331 WHE3306_C03_E06ZS Chinese Spring wheat drought stressed root cDNA
           library Triticum aestivum cDNA clone WHE3306_C03_E06,
           mRNA sequence
          Length = 646

 Score = 42.1 bits (21), Expect = 0.038
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 417 gaaggaaagccagaaaaccaganccatgcaataatattcacccg 460
           ||||| ||||| ||||| || | ||||||||| |||||||||||
Sbjct: 373 gaagggaagcctgaaaatcaaaaccatgcaattatattcacccg 416



>gb|CA497978.1|CA497978 WHE3236_G04_N08ZT Wheat meiotic anther cDNA library Triticum
           aestivum cDNA clone WHE3236_G04_N08, mRNA sequence
          Length = 633

 Score = 42.1 bits (21), Expect = 0.038
 Identities = 51/62 (82%)
 Strand = Plus / Plus

                                                                       
Query: 474 caaactatagatatgaatcaggagcactatatggaggagncnttgaaaatgagnaatctg 533
           ||||| || ||||||||||||||  ||||| | |||||| |  | |||||||| ||||||
Sbjct: 243 caaaccattgatatgaatcaggataactatttcgaggaggcactcaaaatgagaaatctg 302

             
Query: 534 ct 535
           ||
Sbjct: 303 ct 304



>gb|CA501322.1|CA501322 WHE4032_B11_D22ZT Wheat meiotic anther cDNA library Triticum
           aestivum cDNA clone WHE4032_B11_D22, mRNA sequence
          Length = 749

 Score = 42.1 bits (21), Expect = 0.038
 Identities = 51/62 (82%)
 Strand = Plus / Plus

                                                                       
Query: 474 caaactatagatatgaatcaggagcactatatggaggagncnttgaaaatgagnaatctg 533
           ||||| || ||||||||||||||  ||||| | |||||| |  | |||||||| ||||||
Sbjct: 436 caaaccattgatatgaatcaggataactatttcgaggaggcactcaaaatgagaaatctg 495

             
Query: 534 ct 535
           ||
Sbjct: 496 ct 497



  Database: Triticum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  3:01 PM
  Number of letters in database: 367,240,239
  Number of sequences in database:  636,343
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 73,009
Number of Sequences: 636343
Number of extensions: 73009
Number of successful extensions: 19495
Number of sequences better than  0.5: 6
Number of HSP's better than  0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19489
Number of HSP's gapped (non-prelim): 6
length of query: 537
length of database: 367,240,239
effective HSP length: 19
effective length of query: 518
effective length of database: 355,149,722
effective search space: 183967555996
effective search space used: 183967555996
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)