BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCA13d08.yg.2.1
(511 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CD882024.1|CD882024 F1.105A20F010331 F1 Triticum aestivu... 194 4e-048
gb|CV761646.1|CV761646 FGAS056034 Triticum aestivum FGAS: L... 178 2e-043
gb|CA660005.1|CA660005 wlm1.pk0014.d7 wlm1 Triticum aestivu... 165 4e-039
gb|CD490351.1|CD490351 WHE2496_E01_I02ZT Triticum monococcu... 125 3e-027
gb|BE418822.1|BE418822 SCL081.G08R990731 ITEC SCL Wheat Lea... 62 4e-008
gb|BF428596.1|BF428596 WHE1411_A01_B01ZS Wheat drought stre... 62 4e-008
gb|BG604938.1|BG604938 WHE2325_B12_C23ZS Wheat pre-anthesis... 62 4e-008
gb|BG905103.1|BG905103 TaLr1137C05R TaLr1 Triticum aestivum... 62 4e-008
gb|BG905104.1|BG905104 TaLr1137C05F TaLr1 Triticum aestivum... 62 4e-008
gb|BG906915.1|BG906915 TaLr1155C09R TaLr1 Triticum aestivum... 62 4e-008
gb|BJ231336.1|BJ231336 BJ231336 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ255745.1|BJ255745 BJ255745 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ261274.1|BJ261274 BJ261274 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ225363.1|BJ225363 BJ225363 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ230176.1|BJ230176 BJ230176 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ230177.1|BJ230177 BJ230177 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ233901.1|BJ233901 BJ233901 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ239767.1|BJ239767 BJ239767 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ245778.1|BJ245778 BJ245778 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ246019.1|BJ246019 BJ246019 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ259108.1|BJ259108 BJ259108 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ260276.1|BJ260276 BJ260276 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ264584.1|BJ264584 BJ264584 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ277254.1|BJ277254 BJ277254 Y. Ogihara unpublished cDNA... 62 4e-008
gb|BJ282438.1|BJ282438 BJ282438 Y. Ogihara unpublished cDNA... 62 4e-008
gb|CA485856.1|CA485856 WHE4323_H10_P19ZS Wheat meiotic anth... 62 4e-008
gb|CD491542.1|CD491542 WHE3089_H06_P11ZT CS wheat cold-stre... 62 4e-008
gb|CD863977.1|CD863977 AZO1.108M12F010131 AZO1 Triticum aes... 62 4e-008
gb|CD897611.1|CD897611 G174.106I04F010824 G174 Triticum aes... 62 4e-008
gb|CD938750.1|CD938750 OV.110O06F010312 OV Triticum aestivu... 62 4e-008
gb|CD938751.1|CD938751 OV.110O06R010406 OV Triticum aestivu... 62 4e-008
gb|CK161313.1|CK161313 FGAS013881 Triticum aestivum FGAS: L... 62 4e-008
gb|CK163271.1|CK163271 FGAS015893 Triticum aestivum FGAS: L... 62 4e-008
gb|CK212406.1|CK212406 FGAS024278 Triticum aestivum FGAS: L... 62 4e-008
gb|AJ613106.1|AJ613106 AJ613106 Triticum turgidum subsp. du... 62 4e-008
gb|CV763707.1|CV763707 FGAS058090 Triticum aestivum FGAS: L... 62 4e-008
gb|CV764617.1|CV764617 FGAS059002 Triticum aestivum FGAS: L... 62 4e-008
gb|CV764626.1|CV764626 FGAS059011 Triticum aestivum FGAS: L... 62 4e-008
gb|CV770608.1|CV770608 FGAS065001 Triticum aestivum FGAS: L... 62 4e-008
gb|BG906747.1|BG906747 TaLr1152C04R TaLr1 Triticum aestivum... 60 2e-007
gb|CA658006.1|CA658006 wlm0.pk040.a10 wlm0 Triticum aestivu... 48 6e-004
gb|CA600946.1|CA600946 wl1.pk0006.c8 wl1 Triticum aestivum ... 46 0.002
gb|CA666952.1|CA666952 wlsu1.pk0009.f5 wlsu1 Triticum aesti... 46 0.002
gb|CK217050.1|CK217050 FGAS029051 Triticum aestivum FGAS: L... 46 0.002
>gb|CD882024.1|CD882024 F1.105A20F010331 F1 Triticum aestivum cDNA clone F1105A20, mRNA
sequence
Length = 698
Score = 194 bits (98), Expect = 4e-048
Identities = 350/434 (80%)
Strand = Plus / Plus
Query: 43 acactagtttaccagccttttgcctttggaataaccctcatcatgacatattatgaagca 102
|||||||| ||||||||||||||||||||| | ||| | || | |||| |||||||||
Sbjct: 243 acactagtataccagccttttgcctttggactcacctgcttctttgcatactatgaagca 302
Query: 103 aagatgaacacaagattgagaaatcttgcaggattttcccttttcttcctcggttctttt 162
| ||||||||| || ||||||||| || || ||| | ||||||||||| | |||||
Sbjct: 303 acgatgaacacgaggaagagaaatctagctggttttgcacttttcttccttagctctttc 362
Query: 163 gcattgataattctggatgttgcaactaaaggacatggtgggcttggtgttttcgttggt 222
|| || ||| | ||||| |||| ||||||||||||||||| || | | | |||||
Sbjct: 363 gcgttaatattgctggacgttggtactaaaggacatggtggaattccagcatacattggt 422
Query: 223 gtatgcataattagcgccatatttgggacagctgatgctaattgtcaaggcgcactggtt 282
||||||||||| || ||| | ||||||||| |||||||| | |||||| | |||||
Sbjct: 423 gtatgcataatcagtgccttttttgggacatctgatgctcttgttcaaggtggcttggtt 482
Query: 283 ggcgacctttctttaatgtgcccagagttcattcagtccttcatggcgggactagctgca 342
|||||||||||||| |||||||| |||||||||||||||||| || | || | ||||||
Sbjct: 483 ggcgacctttctttgatgtgcccggagttcattcagtccttcctgtcaggcttggctgca 542
Query: 343 tcaggggtcctaacatcagctttgagattagttaccaaggcagcttttgagagctcaaaa 402
||||| || ||||||||||||||||| || |||| ||||||||||| |||| |||| ||
Sbjct: 543 tcaggagttataacatcagctttgagactaattacaaaggcagctttcgagaactcacaa 602
Query: 403 gatggtcttcgcattggagctatactgttcttttcaatcacatgcctgttcgagctggtg 462
|||||||||| | ||||||||| || ||||| || | |||||| |||||||||| |
Sbjct: 603 aatggtcttcgaaatggagctatgctattcttctcggtaacatgcatgttcgagctagct 662
Query: 463 tgcctcctgctata 476
|||||||| |||||
Sbjct: 663 tgcctcctcctata 676
>gb|CV761646.1|CV761646 FGAS056034 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 843
Score = 178 bits (90), Expect = 2e-043
Identities = 243/294 (82%)
Strand = Plus / Plus
Query: 218 ttggtgtatgcataattagcgccatatttgggacagctgatgctaattgtcaaggcgcac 277
|||||||||||||||| || ||| | ||||||||| ||||||| | |||||| |
Sbjct: 159 ttggtgtatgcataatcagtgccttttttgggacatctgatgcgcttgttcaaggtggct 218
Query: 278 tggttggcgacctttctttaatgtgcccagagttcattcagtccttcatggcgggactag 337
||||||||||||||||||| |||||||| |||||||||||||||||| || | || | |
Sbjct: 219 tggttggcgacctttctttgatgtgcccggagttcattcagtccttcctgtcaggcttgg 278
Query: 338 ctgcatcaggggtcctaacatcagctttgagattagttaccaaggcagcttttgagagct 397
|||||||||| || ||||||||||||||||| || |||| ||||||||||| |||| ||
Sbjct: 279 ctgcatcaggagttataacatcagctttgagactaattacaaaggcagctttcgagaact 338
Query: 398 caaaagatggtcttcgcattggagctatactgttcttttcaatcacatgcctgttcgagc 457
|| || |||||||||| | ||||||||| || ||||| || | |||||| |||||||||
Sbjct: 339 cacaaaatggtcttcgaaatggagctatgctattcttctcggtaacatgcatgttcgagc 398
Query: 458 tggtgtgcctcctgctatacacattcgtcttcggcaaactacccatcgtgaagt 511
| | |||||||| |||||| |||| ||||| |||| |||||||||||||||
Sbjct: 399 tagcttgcctcctcctatacgcatttgtctttcccaaattacccatcgtgaagt 452
>gb|CA660005.1|CA660005 wlm1.pk0014.d7 wlm1 Triticum aestivum cDNA clone wlm1.pk0014.d7 5'
end, mRNA sequence
Length = 513
Score = 165 bits (83), Expect = 4e-039
Identities = 243/295 (82%), Gaps = 1/295 (0%)
Strand = Plus / Plus
Query: 218 ttggtgtatgcataattagcgccatatttgggacagctgatgctaattgtcaaggcgcac 277
|||||||||||||||| || ||| | ||||||||| ||||||| | |||||| |
Sbjct: 41 ttggtgtatgcataatcagtgccttttttgggacatctgatgcgcttgttcaaggtggct 100
Query: 278 tggttggcgacctttctttaatgtgcccagagttcattcagtccttcatggcgggactag 337
||||||||||||||||||| |||||||| |||||||||||||||||| || | || | |
Sbjct: 101 tggttggcgacctttctttgatgtgcccggagttcattcagtccttcctgtcaggcttgg 160
Query: 338 ctgcatcaggggtcctaacatcagctttgagattagttaccaaggcagcttttgagagct 397
|||||||||| || ||||||||||||||||| || |||| ||||||||||| |||| ||
Sbjct: 161 ctgcatcaggagttataacatcagctttgagactaattacaaaggcagctttcgagaact 220
Query: 398 caaaagatggtcttcgcattggagctatactgttcttttcaatcacatgcctgtt-cgag 456
|| || |||||||||| | ||||||||| || ||||| || | |||||| |||| ||||
Sbjct: 221 cacaaaatggtcttcgaaatggagctatgctattcttctcggtaacatgcatgttccgag 280
Query: 457 ctggtgtgcctcctgctatacacattcgtcttcggcaaactacccatcgtgaagt 511
|| | |||||||| |||||| |||| ||||| |||| |||||||||||||||
Sbjct: 281 ctagcttgcctcctcctatacgcatttgtctttcccaaattacccatcgtgaagt 335
>gb|CD490351.1|CD490351 WHE2496_E01_I02ZT Triticum monococcum DV92 early reproductive apex
cDNA library Triticum monococcum cDNA clone
WHE2496_E01_I02, mRNA sequence
Length = 636
Score = 125 bits (63), Expect = 3e-027
Identities = 261/327 (79%)
Strand = Plus / Plus
Query: 43 acactagtttaccagccttttgcctttggaataaccctcatcatgacatattatgaagca 102
|||||||| ||||||||||||||||||||| | ||| | || | |||| |||||||||
Sbjct: 304 acactagtataccagccttttgcctttggactcacctgcttctttgcatactatgaagca 363
Query: 103 aagatgaacacaagattgagaaatcttgcaggattttcccttttcttcctcggttctttt 162
| ||||||||| || ||||||||| || || ||| | ||||||||||| | |||||
Sbjct: 364 acgatgaacacgaggaagagaaatctagctggttttgcacttttcttccttagctctttc 423
Query: 163 gcattgataattctggatgttgcaactaaaggacatggtgggcttggtgttttcgttggt 222
|| || ||| | ||||| |||| ||||||||||||||||| || | | | |||||
Sbjct: 424 gcgttaatattgctggacgttggtactaaaggacatggtggaattccagcatacattggt 483
Query: 223 gtatgcataattagcgccatatttgggacagctgatgctaattgtcaaggcgcactggtt 282
||||||||||| || ||| | ||||||||| |||||||| | |||||| | |||||
Sbjct: 484 gtatgcataatcagtgccttttttgggacatctgatgctcttgttcaaggtggcttggtt 543
Query: 283 ggcgacctttctttaatgtgcccagagttcattcagtccttcatggcgggactagctgca 342
|||||||||||||| |||| || |||||||||||||||||| || | || | ||||||
Sbjct: 544 ggcgacctttctttgatgtcgccggagttcattcagtccttcctgtcaggcttggctgca 603
Query: 343 tcaggggtcctaacatcagctttgaga 369
||||| || |||||||||||||||||
Sbjct: 604 tcaggagttataacatcagctttgaga 630
>gb|BE418822.1|BE418822 SCL081.G08R990731 ITEC SCL Wheat Leaf Library Triticum aestivum
cDNA clone SCL081.G08, mRNA sequence
Length = 930
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 415 cccgccgtgccggagctgatggcgctctccgccacgtac 377
>gb|BF428596.1|BF428596 WHE1411_A01_B01ZS Wheat drought stressed leaf cDNA library Triticum
aestivum cDNA clone WHE1411_A01_B01, mRNA sequence
Length = 395
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 377 cccgccgtgccggagctgatggcgctctccgccacgtac 339
>gb|BG604938.1|BG604938 WHE2325_B12_C23ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2325_B12_C23, mRNA sequence
Length = 395
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 375 cccgccgtgccggagctgatggcgctctccgccacgtac 337
>gb|BG905103.1|BG905103 TaLr1137C05R TaLr1 Triticum aestivum cDNA clone TaLr1137C05 5',
mRNA sequence
Length = 435
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 391 cccgccgtgccggagctgatggcgctctccgccacgtac 353
>gb|BG905104.1|BG905104 TaLr1137C05F TaLr1 Triticum aestivum cDNA clone TaLr1137C05 3',
mRNA sequence
Length = 555
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 506 cccgccgtgccggagctgatggcgctctccgccacgtac 544
>gb|BG906915.1|BG906915 TaLr1155C09R TaLr1 Triticum aestivum cDNA clone TaLr1155C09 5',
mRNA sequence
Length = 459
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 248 cccgccgtgccggagctgatggcgctctccgccacgtac 210
>gb|BJ231336.1|BJ231336 BJ231336 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl26h01 3', mRNA sequence
Length = 649
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 416 cccgccgtgccggagctgatggcgctctccgccacgtac 454
>gb|BJ255745.1|BJ255745 BJ255745 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh2d10 5', mRNA sequence
Length = 674
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 399 cccgccgtgccggagctgatggcgctctccgccacgtac 361
>gb|BJ261274.1|BJ261274 BJ261274 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh2d10 3', mRNA sequence
Length = 676
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 527 cccgccgtgccggagctgatggcgctctccgccacgtac 565
>gb|BJ225363.1|BJ225363 BJ225363 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl21l03 5', mRNA sequence
Length = 554
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 476 cccgccgtgccggagctgatggcgctctccgccacgtac 438
>gb|BJ230176.1|BJ230176 BJ230176 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl21l03 3', mRNA sequence
Length = 607
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 487 cccgccgtgccggagctgatggcgctctccgccacgtac 525
>gb|BJ230177.1|BJ230177 BJ230177 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl21l04 3', mRNA sequence
Length = 658
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 485 cccgccgtgccggagctgatggcgctctccgccacgtac 523
>gb|BJ233901.1|BJ233901 BJ233901 Y. Ogihara unpublished cDNA library, Wh_e Triticum
aestivum cDNA clone whe7l17 5', mRNA sequence
Length = 676
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 424 cccgccgtgccggagctgatggcgctctccgccacgtac 386
>gb|BJ239767.1|BJ239767 BJ239767 Y. Ogihara unpublished cDNA library, Wh_e Triticum
aestivum cDNA clone whe7l17 3', mRNA sequence
Length = 635
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 486 cccgccgtgccggagctgatggcgctctccgccacgtac 524
>gb|BJ245778.1|BJ245778 BJ245778 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf20b21 5', mRNA sequence
Length = 577
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 417 cccgccgtgccggagctgatggcgctctccgccacgtac 379
>gb|BJ246019.1|BJ246019 BJ246019 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf21b21 5', mRNA sequence
Length = 565
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 461 cccgccgtgccggagctgatggcgctctccgccacgtac 423
>gb|BJ259108.1|BJ259108 BJ259108 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh14p06 5', mRNA sequence
Length = 689
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 406 cccgccgtgccggagctgatggcgctctccgccacgtac 368
>gb|BJ260276.1|BJ260276 BJ260276 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh24e09 5', mRNA sequence
Length = 500
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 395 cccgccgtgccggagctgatggcgctctccgccacgtac 357
>gb|BJ264584.1|BJ264584 BJ264584 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh14p06 3', mRNA sequence
Length = 652
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 578 cccgccgtgccggagctgatggcgctctccgccacgtac 616
>gb|BJ277254.1|BJ277254 BJ277254 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr10j20 5', mRNA sequence
Length = 544
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 476 cccgccgtgccggagctgatggcgctctccgccacgtac 438
>gb|BJ282438.1|BJ282438 BJ282438 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr10j20 3', mRNA sequence
Length = 710
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 440 cccgccgtgccggagctgatggcgctctccgccacgtac 478
>gb|CA485856.1|CA485856 WHE4323_H10_P19ZS Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4323_H10_P19, mRNA sequence
Length = 523
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 372 cccgccgtgccggagctgatggcgctctccgccacgtac 334
>gb|CD491542.1|CD491542 WHE3089_H06_P11ZT CS wheat cold-stressed seedling subtracted cDNA
library Triticum aestivum cDNA clone WHE3089_H06_P11,
mRNA sequence
Length = 657
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 604 cccgccgtgccggagctgatggcgctctccgccacgtac 642
>gb|CD863977.1|CD863977 AZO1.108M12F010131 AZO1 Triticum aestivum cDNA clone AZO1108M12,
mRNA sequence
Length = 691
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 388 cccgccgtgccggagctgatggcgctctccgccacgtac 350
>gb|CD897611.1|CD897611 G174.106I04F010824 G174 Triticum aestivum cDNA clone G174106I04,
mRNA sequence
Length = 613
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 394 cccgccgtgccggagctgatggcgctctccgccacgtac 356
>gb|CD938750.1|CD938750 OV.110O06F010312 OV Triticum aestivum cDNA clone OV110O06, mRNA
sequence
Length = 710
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 478 cccgccgtgccggagctgatggcgctctccgccacgtac 440
>gb|CD938751.1|CD938751 OV.110O06R010406 OV Triticum aestivum cDNA clone OV110O06, mRNA
sequence
Length = 687
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 217 cccgccgtgccggagctgatggcgctctccgccacgtac 255
>gb|CK161313.1|CK161313 FGAS013881 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1143
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 394 cccgccgtgccggagctgatggcgctctccgccacgtac 356
>gb|CK163271.1|CK163271 FGAS015893 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1079
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 431 cccgccgtgccggagctgatggcgctctccgccacgtac 393
>gb|CK212406.1|CK212406 FGAS024278 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1008
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 581 cccgccgtgccggagctgatggcgctctccgccacgtac 619
>gb|AJ613106.1|AJ613106 AJ613106 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 08291R, mRNA
sequence
Length = 493
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 281 cccgccgtgccggagctgatggcgctctccgccacgtac 243
>gb|CV763707.1|CV763707 FGAS058090 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 818
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 582 cccgccgtgccggagctgatggcgctctccgccacgtac 544
>gb|CV764617.1|CV764617 FGAS059002 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 849
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 588 cccgccgtgccggagctgatggcgctctccgccacgtac 550
>gb|CV764626.1|CV764626 FGAS059011 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 868
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 505 cccgccgtgccggagctgatggcgctctccgccacgtac 467
>gb|CV770608.1|CV770608 FGAS065001 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 855
Score = 61.9 bits (31), Expect = 4e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||||||| ||||| |||||||||
Sbjct: 495 cccgccgtgccggagctgatggcgctctccgccacgtac 457
>gb|BG906747.1|BG906747 TaLr1152C04R TaLr1 Triticum aestivum cDNA clone TaLr1152C04 5',
mRNA sequence
Length = 399
Score = 60.0 bits (30), Expect = 2e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 ccgccgtgccggagctgatggcactctcggccacgtac 40
|||||||||||||||||||||| ||||| |||||||||
Sbjct: 380 ccgccgtgccggagctgatggcgctctccgccacgtac 343
>gb|CA658006.1|CA658006 wlm0.pk040.a10 wlm0 Triticum aestivum cDNA clone wlm0.pk040.a10 5'
end, mRNA sequence
Length = 443
Score = 48.1 bits (24), Expect = 6e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 9 tgccggagctgatggcactctcggccacgtac 40
|||||||||||||||| ||||| |||||||||
Sbjct: 337 tgccggagctgatggcgctctccgccacgtac 306
>gb|CA600946.1|CA600946 wl1.pk0006.c8 wl1 Triticum aestivum cDNA clone wl1.pk0006.c8 5'
end, mRNA sequence
Length = 552
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 2 cccgccgtgccggagctgatggc 24
|||||||||||||||||||||||
Sbjct: 256 cccgccgtgccggagctgatggc 234
>gb|CA666952.1|CA666952 wlsu1.pk0009.f5 wlsu1 Triticum aestivum cDNA clone wlsu1.pk0009.f5
5' end, mRNA sequence
Length = 586
Score = 46.1 bits (23), Expect = 0.002
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 2 cccgccgtgccggagctgatggcactctcggcca 35
|||||||||||||||||||| || ||||| ||||
Sbjct: 468 cccgccgtgccggagctgatngcgctctccgcca 501
>gb|CK217050.1|CK217050 FGAS029051 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1090
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 6 ccgtgccggagctgatggcactctcggccacgtac 40
||||||||||||||||||| || || |||||||||
Sbjct: 551 ccgtgccggagctgatggcgctgtccgccacgtac 517
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 103,094
Number of Sequences: 636343
Number of extensions: 103094
Number of successful extensions: 27018
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26959
Number of HSP's gapped (non-prelim): 54
length of query: 511
length of database: 367,240,239
effective HSP length: 19
effective length of query: 492
effective length of database: 355,149,722
effective search space: 174733663224
effective search space used: 174733663224
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)