BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBS9h08.xg.2.1
(770 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE427268.1|BE427268 PSR6187 ITEC PSR Wheat Pericarp/Test... 44 0.014
gb|BE429792.1|BE429792 TAS003.H01R990624 ITEC TAS Wheat cDN... 40 0.22
gb|BF478520.1|BF478520 WHE2009_F08_K15ZS Chinese Spring whe... 40 0.22
gb|BG909245.1|BG909245 TaLr1175D10R TaLr1 Triticum aestivum... 40 0.22
gb|BJ278207.1|BJ278207 BJ278207 Y. Ogihara unpublished cDNA... 40 0.22
gb|BQ243945.1|BQ243945 TaE15007A04F TaE15 Triticum aestivum... 40 0.22
gb|BQ743299.1|BQ743299 WHE4102_D08_G16ZS Wheat salt-stresse... 40 0.22
gb|CA600699.1|CA600699 waw1c.pk005.j12 waw1c Triticum aesti... 40 0.22
gb|CA618526.1|CA618526 wl1n.pk0038.d4 wl1n Triticum aestivu... 40 0.22
gb|CA626904.1|CA626904 wl1n.pk0145.a2 wl1n Triticum aestivu... 40 0.22
gb|CA635057.1|CA635057 wle1n.pk0095.c12 wle1n Triticum aest... 40 0.22
gb|CA676589.1|CA676589 wlm12.pk0002.f8 wlm12 Triticum aesti... 40 0.22
gb|CA695335.1|CA695335 wlmk8.pk0009.f3 wlmk8 Triticum aesti... 40 0.22
gb|CD453414.1|CD453414 WHE1659-1662_E06_E06ZT CS wheat heat... 40 0.22
gb|CD873600.1|CD873600 AZO3.100D24R011123 AZO3 Triticum aes... 40 0.22
gb|CD873979.1|CD873979 AZO3.101B12R011123 AZO3 Triticum aes... 40 0.22
gb|CD881977.1|CD881977 F1.104O15R010628 F1 Triticum aestivu... 40 0.22
gb|CD884137.1|CD884137 F1.115K06F010507 F1 Triticum aestivu... 40 0.22
gb|CD884138.1|CD884138 F1.115K06R010628 F1 Triticum aestivu... 40 0.22
gb|CD886316.1|CD886316 G118.101P20F010601 G118 Triticum aes... 40 0.22
gb|CK193982.1|CK193982 FGAS002401 Triticum aestivum FGAS: L... 40 0.22
gb|CK212500.1|CK212500 FGAS024374 Triticum aestivum FGAS: L... 40 0.22
gb|CV759922.1|CV759922 FGAS054306 Triticum aestivum FGAS: L... 40 0.22
gb|CV774767.1|CV774767 FGAS069167 Triticum aestivum FGAS: L... 40 0.22
emb|AX658810.1| Sequence 83 from Patent WO03000904 40 0.22
emb|AX660751.1| Sequence 1108 from Patent WO03000906 40 0.22
>gb|BE427268.1|BE427268 PSR6187 ITEC PSR Wheat Pericarp/Testa Library Triticum aestivum
cDNA clone PSR6187, mRNA sequence
Length = 640
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 177 cccgtccaccgccgggctcagc 198
||||||||||||||||||||||
Sbjct: 532 cccgtccaccgccgggctcagc 511
>gb|BE429792.1|BE429792 TAS003.H01R990624 ITEC TAS Wheat cDNA Library Triticum aestivum
cDNA clone TAS003.H01, mRNA sequence
Length = 505
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 190 cgcctcatcttcctcttctc 171
>gb|BF478520.1|BF478520 WHE2009_F08_K15ZS Chinese Spring wheat drought stressed leaf cDNA
library Triticum aestivum cDNA clone WHE2009_F08_K15,
mRNA sequence
Length = 454
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 163 cgcctcatcttcctcttctc 144
>gb|BG909245.1|BG909245 TaLr1175D10R TaLr1 Triticum aestivum cDNA clone TaLr1175D10 5',
mRNA sequence
Length = 582
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 380 cgcctcatcttcctcttctc 399
>gb|BJ278207.1|BJ278207 BJ278207 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr15d14 5', mRNA sequence
Length = 563
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 308 ccgccgccggccgccgcctc 327
||||||||||||||||||||
Sbjct: 105 ccgccgccggccgccgcctc 86
>gb|BQ243945.1|BQ243945 TaE15007A04F TaE15 Triticum aestivum cDNA clone TaE15007A04F, mRNA
sequence
Length = 637
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 365 cgcctcatcttcctcttctc 384
>gb|BQ743299.1|BQ743299 WHE4102_D08_G16ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4102_D08_G16, mRNA sequence
Length = 718
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 308 ccgccgccggccgccgcctc 327
||||||||||||||||||||
Sbjct: 124 ccgccgccggccgccgcctc 105
>gb|CA600699.1|CA600699 waw1c.pk005.j12 waw1c Triticum aestivum cDNA clone waw1c.pk005.j12
5' end, mRNA sequence
Length = 633
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 308 ccgccgccggccgccgcctc 327
||||||||||||||||||||
Sbjct: 108 ccgccgccggccgccgcctc 89
>gb|CA618526.1|CA618526 wl1n.pk0038.d4 wl1n Triticum aestivum cDNA clone wl1n.pk0038.d4 5'
end, mRNA sequence
Length = 564
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 234 cgcctcatcttcctcttctc 215
>gb|CA626904.1|CA626904 wl1n.pk0145.a2 wl1n Triticum aestivum cDNA clone wl1n.pk0145.a2 5'
end, mRNA sequence
Length = 302
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 234 cgcctcatcttcctcttctc 215
>gb|CA635057.1|CA635057 wle1n.pk0095.c12 wle1n Triticum aestivum cDNA clone
wle1n.pk0095.c12 5' end, mRNA sequence
Length = 368
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 308 ccgccgccggccgccgcctc 327
||||||||||||||||||||
Sbjct: 51 ccgccgccggccgccgcctc 32
>gb|CA676589.1|CA676589 wlm12.pk0002.f8 wlm12 Triticum aestivum cDNA clone wlm12.pk0002.f8
5' end, mRNA sequence
Length = 556
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 353 cgcctcatcttcctcttctc 372
>gb|CA695335.1|CA695335 wlmk8.pk0009.f3 wlmk8 Triticum aestivum cDNA clone wlmk8.pk0009.f3
5' end, mRNA sequence
Length = 643
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 220 cgcctcatcttcctcttctc 239
>gb|CD453414.1|CD453414 WHE1659-1662_E06_E06ZT CS wheat heat stressed flag leaf cDNA
library Triticum aestivum cDNA clone
WHE1659-1662_E06_E06, mRNA sequence
Length = 661
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 390 cgcctcatcttcctcttctc 409
>gb|CD873600.1|CD873600 AZO3.100D24R011123 AZO3 Triticum aestivum cDNA clone AZO3100D24,
mRNA sequence
Length = 707
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 316 cgcctcatcttcctcttctc 335
>gb|CD873979.1|CD873979 AZO3.101B12R011123 AZO3 Triticum aestivum cDNA clone AZO3101B12,
mRNA sequence
Length = 645
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 316 cgcctcatcttcctcttctc 335
>gb|CD881977.1|CD881977 F1.104O15R010628 F1 Triticum aestivum cDNA clone F1104O15, mRNA
sequence
Length = 556
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 324 cgcctcatcttcctcttctc 343
>gb|CD884137.1|CD884137 F1.115K06F010507 F1 Triticum aestivum cDNA clone F1115K06, mRNA
sequence
Length = 527
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 258 cgcctcatcttcctcttctc 239
>gb|CD884138.1|CD884138 F1.115K06R010628 F1 Triticum aestivum cDNA clone F1115K06, mRNA
sequence
Length = 404
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 334 cgcctcatcttcctcttctc 353
>gb|CD886316.1|CD886316 G118.101P20F010601 G118 Triticum aestivum cDNA clone G118101P20,
mRNA sequence
Length = 551
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 191 cgcctcatcttcctcttctc 172
>gb|CK193982.1|CK193982 FGAS002401 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 831
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 308 ccgccgccggccgccgcctc 327
||||||||||||||||||||
Sbjct: 213 ccgccgccggccgccgcctc 194
>gb|CK212500.1|CK212500 FGAS024374 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1070
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 394 cgcctcatcttcctcttctc 413
>gb|CV759922.1|CV759922 FGAS054306 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 883
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 308 ccgccgccggccgccgcctc 327
||||||||||||||||||||
Sbjct: 189 ccgccgccggccgccgcctc 170
>gb|CV774767.1|CV774767 FGAS069167 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 841
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 308 ccgccgccggccgccgcctc 327
||||||||||||||||||||
Sbjct: 175 ccgccgccggccgccgcctc 156
>emb|AX658810.1| Sequence 83 from Patent WO03000904
Length = 734
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 371 cgcctcatcttcctcttctc 352
>emb|AX660751.1| Sequence 1108 from Patent WO03000906
Length = 734
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 20 cgcctcatcttcctcttctc 39
||||||||||||||||||||
Sbjct: 371 cgcctcatcttcctcttctc 352
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 198,036
Number of Sequences: 636343
Number of extensions: 198036
Number of successful extensions: 61121
Number of sequences better than 0.5: 28
Number of HSP's better than 0.5 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61092
Number of HSP's gapped (non-prelim): 29
length of query: 770
length of database: 367,240,239
effective HSP length: 19
effective length of query: 751
effective length of database: 355,149,722
effective search space: 266717441222
effective search space used: 266717441222
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)