BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBL17f07.xg.2.1
         (657 letters)

Database: Triticum_nucl_with_EST.fasta 
           636,343 sequences; 367,240,239 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CA485857.1|CA485857  WHE4324_A02_B04ZS Wheat meiotic anth...    50   2e-004
gb|CV770951.1|CV770951  FGAS065344 Triticum aestivum FGAS: L...    44   0.012
gb|BE406386.1|BE406386  WHE0414_d05_g10zB Wheat etiolated se...    42   0.047
gb|BE442894.1|BE442894  WHE1107_A11_B21ZS Wheat etiolated se...    42   0.047

>gb|CA485857.1|CA485857 WHE4324_A02_B04ZS Wheat meiotic anther cDNA library Triticum
           aestivum cDNA clone WHE4324_A02_B04, mRNA sequence
          Length = 645

 Score = 50.1 bits (25), Expect = 2e-004
 Identities = 58/71 (81%)
 Strand = Plus / Plus

                                                                       
Query: 522 tttcctcgtcagagtgtgcatctgttcnactcctcctactgnntncaatgncgctnccag 581
           ||||||||| | ||||| ||||| ||| |||| || |||||  | || || |||| ||||
Sbjct: 3   tttcctcgtgaaagtgtccatctattccactcttcatactgccttcactggcgctcccag 62

                      
Query: 582 gaacctgaggg 592
           |||||||||||
Sbjct: 63  gaacctgaggg 73



>gb|CV770951.1|CV770951 FGAS065344 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
           aestivum cDNA, mRNA sequence
          Length = 861

 Score = 44.1 bits (22), Expect = 0.012
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 225 atggtcgtcgccgacctcggatgctc 250
           |||||||||||||||||||| |||||
Sbjct: 224 atggtcgtcgccgacctcggctgctc 249



>gb|BE406386.1|BE406386 WHE0414_d05_g10zB Wheat etiolated seedling root cDNA library
           Triticum aestivum cDNA clone WHE0414_d05_g10, mRNA
           sequence
          Length = 379

 Score = 42.1 bits (21), Expect = 0.047
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 222 accatggtcgtcgccgacctcggatgctc 250
           |||||||||||||| |||||||| |||||
Sbjct: 191 accatggtcgtcgctgacctcggctgctc 219



>gb|BE442894.1|BE442894 WHE1107_A11_B21ZS Wheat etiolated seedling root normalized cDNA
           library Triticum aestivum cDNA clone WHE1107_A11_B21,
           mRNA sequence
          Length = 662

 Score = 42.1 bits (21), Expect = 0.047
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 222 accatggtcgtcgccgacctcggatgctc 250
           |||||||||||||| |||||||| |||||
Sbjct: 173 accatggtcgtcgctgacctcggctgctc 201



  Database: Triticum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  3:01 PM
  Number of letters in database: 367,240,239
  Number of sequences in database:  636,343
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 218,702
Number of Sequences: 636343
Number of extensions: 218702
Number of successful extensions: 87065
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87059
Number of HSP's gapped (non-prelim): 6
length of query: 657
length of database: 367,240,239
effective HSP length: 19
effective length of query: 638
effective length of database: 355,149,722
effective search space: 226585522636
effective search space used: 226585522636
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)