BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBJ24c04.pg.2.1
(448 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mR... 68 6e-010
gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mR... 68 6e-010
gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) ge... 68 6e-010
gb|BJ265678.1|BJ265678 BJ265678 Y. Ogihara unpublished cDNA... 60 1e-007
gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mR... 60 1e-007
gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) ge... 60 1e-007
gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, compl... 60 1e-007
gb|CD869470.1|CD869470 AZO2.111L18F001120 AZO2 Triticum aes... 40 0.13
gb|CD871909.1|CD871909 AZO2.119F19R010403 AZO2 Triticum aes... 40 0.13
>gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, partial cds
Length = 496
Score = 67.9 bits (34), Expect = 6e-010
Identities = 75/91 (82%)
Strand = Plus / Minus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| || ||||||| || |||||||||||||||||| ||
Sbjct: 273 tccagttggcggggatgacgtccttggcgatgagcttcttgccggactcgctggtgacgc 214
Query: 354 ggatagnnnaggggcccttgagngccttggc 384
|||| | ||||||||||||| | ||||||
Sbjct: 213 ggatggagaaggggcccttgagcggcttggc 183
>gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, complete cds
Length = 1111
Score = 67.9 bits (34), Expect = 6e-010
Identities = 75/91 (82%)
Strand = Plus / Minus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| || ||||||| || |||||||||||||||||| ||
Sbjct: 813 tccagttggcggggatgacgtccttggcgatgagcttcttgccggactcgctggtgacgc 754
Query: 354 ggatagnnnaggggcccttgagngccttggc 384
|||| | ||||||||||||| | ||||||
Sbjct: 753 ggatggagaaggggcccttgagcggcttggc 723
>gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, complete cds
Length = 1149
Score = 67.9 bits (34), Expect = 6e-010
Identities = 75/91 (82%)
Strand = Plus / Minus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| || ||||||| || |||||||||||||||||| ||
Sbjct: 1097 tccagttggcggggatgacgtccttggcgatgagcttcttgccggactcgctggtgacgc 1038
Query: 354 ggatagnnnaggggcccttgagngccttggc 384
|||| | ||||||||||||| | ||||||
Sbjct: 1037 ggatggagaaggggcccttgagcggcttggc 1007
>gb|BJ265678.1|BJ265678 BJ265678 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh22p01 3', mRNA sequence
Length = 685
Score = 60.0 bits (30), Expect = 1e-007
Identities = 74/91 (81%)
Strand = Plus / Plus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| || ||||||| || |||||||||||||||||| ||
Sbjct: 240 tccagttggcggggatgacgtccttggcgatgagcttcttgccggactcgctggtgacgc 299
Query: 354 ggatagnnnaggggcccttgagngccttggc 384
|||| | ||||| ||||||| | ||||||
Sbjct: 300 ggatggagaagggggccttgagcggcttggc 330
>gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, complete cds
Length = 1068
Score = 60.0 bits (30), Expect = 1e-007
Identities = 74/91 (81%)
Strand = Plus / Minus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| || ||||||| || |||||||||||||||||| ||
Sbjct: 783 tccagttggcggggatgacgtccttggcgatgagcttcttgccggactcgctggtgacgc 724
Query: 354 ggatagnnnaggggcccttgagngccttggc 384
|||| | ||||| ||||||| | ||||||
Sbjct: 723 ggatggagaagggggccttgagcggcttggc 693
>gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, complete cds
Length = 1216
Score = 60.0 bits (30), Expect = 1e-007
Identities = 74/91 (81%)
Strand = Plus / Minus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| || ||||||| || |||||||||||||||||| ||
Sbjct: 1018 tccagttggcggggatgacgtccttggcgatgagcttcttgccggactcgctggtgacgc 959
Query: 354 ggatagnnnaggggcccttgagngccttggc 384
|||| | ||||| ||||||| | ||||||
Sbjct: 958 ggatggagaagggggccttgagcggcttggc 928
>gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds
Length = 960
Score = 60.0 bits (30), Expect = 1e-007
Identities = 74/91 (81%)
Strand = Plus / Minus
Query: 294 tccagttcgccgggatgatgtctttagcgatgacctnnntgccggactcgctggtgaggc 353
||||||| || ||||||| ||| || ||||||| || |||||| ||||||||||| ||
Sbjct: 766 tccagttggcggggatgacgtccttggcgatgagcttcttgccgggctcgctggtgacgc 707
Query: 354 ggatagnnnaggggcccttgagngccttggc 384
|||| | ||||||||||||| | ||||||
Sbjct: 706 ggatggagaaggggcccttgagcggcttggc 676
>gb|CD869470.1|CD869470 AZO2.111L18F001120 AZO2 Triticum aestivum cDNA clone AZO2111L18,
mRNA sequence
Length = 383
Score = 40.1 bits (20), Expect = 0.13
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 333 tgccggactcgctggtgaggcgga 356
||||||||||| ||||||||||||
Sbjct: 128 tgccggactcggtggtgaggcgga 105
>gb|CD871909.1|CD871909 AZO2.119F19R010403 AZO2 Triticum aestivum cDNA clone AZO2119F19,
mRNA sequence
Length = 555
Score = 40.1 bits (20), Expect = 0.13
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 333 tgccggactcgctggtgaggcgga 356
||||||||||| ||||||||||||
Sbjct: 254 tgccggactcggtggtgaggcgga 277
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 50,500
Number of Sequences: 636343
Number of extensions: 50500
Number of successful extensions: 14712
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14703
Number of HSP's gapped (non-prelim): 9
length of query: 448
length of database: 367,240,239
effective HSP length: 19
effective length of query: 429
effective length of database: 355,149,722
effective search space: 152359230738
effective search space used: 152359230738
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)