BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AF019146.2.1
(1761 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA624339.1|CA624339 wl1n.pk0116.h3 wl1n Triticum aestivu... 412 e-113
gb|BG907904.1|BG907904 TaLr1163F10R TaLr1 Triticum aestivum... 119 7e-025
gb|BJ246149.1|BJ246149 BJ246149 Y. Ogihara unpublished cDNA... 119 7e-025
gb|BJ281046.1|BJ281046 BJ281046 Y. Ogihara unpublished cDNA... 119 7e-025
gb|CK162728.1|CK162728 FGAS015327 Triticum aestivum FGAS: L... 119 7e-025
gb|CK196115.1|CK196115 FGAS004562 Triticum aestivum FGAS: L... 119 7e-025
gb|CK198665.1|CK198665 FGAS007152 Triticum aestivum FGAS: L... 119 7e-025
gb|DR736403.1|DR736403 FGAS081773 Triticum aestivum FGAS: L... 119 7e-025
gb|BG604924.1|BG604924 WHE2325_A07_A13ZS Wheat pre-anthesis... 103 4e-020
gb|BJ256066.1|BJ256066 BJ256066 Y. Ogihara unpublished cDNA... 103 4e-020
gb|BJ279435.1|BJ279435 BJ279435 Y. Ogihara unpublished cDNA... 103 4e-020
gb|BJ280379.1|BJ280379 BJ280379 Y. Ogihara unpublished cDNA... 103 4e-020
gb|BJ302114.1|BJ302114 BJ302114 Y. Ogihara unpublished cDNA... 103 4e-020
gb|CA655008.1|CA655008 wlm0.pk0007.h3 wlm0 Triticum aestivu... 103 4e-020
gb|CA656075.1|CA656075 wlm0.pk0020.e10 wlm0 Triticum aestiv... 103 4e-020
gb|CA665072.1|CA665072 wlk1.pk0011.h9 wlk1 Triticum aestivu... 103 4e-020
gb|CA678674.1|CA678674 wlm4.pk0009.f4 wlm4 Triticum aestivu... 103 4e-020
gb|CA693700.1|CA693700 wlmk4.pk0006.g2 wlmk4 Triticum aesti... 103 4e-020
gb|CA700982.1|CA700982 wkm1c.pk006.f24 wkm1c Triticum aesti... 103 4e-020
gb|CD863088.1|CD863088 AZO1.105K12F010130 AZO1 Triticum aes... 103 4e-020
gb|CD864936.1|CD864936 AZO2.001P06F000629 AZO2 Triticum aes... 103 4e-020
gb|CD877779.1|CD877779 AZO4.101B18F010930 AZO4 Triticum aes... 103 4e-020
gb|CK162446.1|CK162446 FGAS015040 Triticum aestivum FGAS: L... 103 4e-020
gb|CK162470.1|CK162470 FGAS015065 Triticum aestivum FGAS: L... 103 4e-020
gb|CK193338.1|CK193338 FGAS001752 Triticum aestivum FGAS: L... 103 4e-020
gb|CK198623.1|CK198623 FGAS007110 Triticum aestivum FGAS: L... 103 4e-020
gb|CK198655.1|CK198655 FGAS007142 Triticum aestivum FGAS: L... 103 4e-020
gb|CK203028.1|CK203028 FGAS011554 Triticum aestivum FGAS: L... 103 4e-020
gb|CK209946.1|CK209946 FGAS021736 Triticum aestivum FGAS: L... 103 4e-020
gb|CV768379.1|CV768379 FGAS062770 Triticum aestivum FGAS: L... 103 4e-020
gb|CV773132.1|CV773132 FGAS067528 Triticum aestivum FGAS: L... 103 4e-020
gb|CV774019.1|CV774019 FGAS068416 Triticum aestivum FGAS: L... 103 4e-020
gb|CV776852.1|CV776852 FGAS071256 Triticum aestivum FGAS: L... 103 4e-020
gb|CV779499.1|CV779499 FGAS073908 Triticum aestivum FGAS: L... 103 4e-020
gb|CV780500.1|CV780500 FGAS074911 Triticum aestivum FGAS: L... 103 4e-020
gb|CV780777.1|CV780777 FGAS075188 Triticum aestivum FGAS: L... 103 4e-020
gb|CV781105.1|CV781105 FGAS075516 Triticum aestivum FGAS: L... 103 4e-020
gb|DR735498.1|DR735498 FGAS081168 Triticum aestivum FGAS: L... 103 4e-020
gb|DR735764.1|DR735764 FGAS081398 Triticum aestivum FGAS: L... 103 4e-020
gb|DR739783.1|DR739783 FGAS000050 Triticum aestivum FGAS: L... 103 4e-020
gb|DR740002.1|DR740002 FGAS000268 Triticum aestivum FGAS: L... 103 4e-020
gb|BJ211118.1|BJ211118 BJ211118 Y. Ogihara unpublished cDNA... 100 6e-019
gb|BJ212113.1|BJ212113 BJ212113 Y. Ogihara unpublished cDNA... 100 6e-019
gb|CA677854.1|CA677854 wlm12.pk0013.e5 wlm12 Triticum aesti... 100 6e-019
gb|BE428351.1|BE428351 MTD006.A08F990616 ITEC MTD Durum Whe... 92 2e-016
gb|BJ281453.1|BJ281453 BJ281453 Y. Ogihara unpublished cDNA... 92 2e-016
gb|BQ295179.1|BQ295179 WHE2867_A12_A23ZS Wheat unstressed r... 92 2e-016
gb|BQ483540.1|BQ483540 WHE3509_G11_M21ZS Wheat unstressed r... 92 2e-016
gb|CA608618.1|CA608618 wr1.pk0092.e9 wr1 Triticum aestivum ... 92 2e-016
gb|CK155031.1|CK155031 FGAS033751 Triticum aestivum FGAS: T... 92 2e-016
gb|CK162781.1|CK162781 FGAS015380 Triticum aestivum FGAS: L... 92 2e-016
gb|CK162782.1|CK162782 FGAS015381 Triticum aestivum FGAS: L... 92 2e-016
gb|CK163258.1|CK163258 FGAS015880 Triticum aestivum FGAS: L... 92 2e-016
gb|CK163262.1|CK163262 FGAS015884 Triticum aestivum FGAS: L... 92 2e-016
gb|CK195342.1|CK195342 FGAS003781 Triticum aestivum FGAS: L... 92 2e-016
gb|CK200545.1|CK200545 FGAS009060 Triticum aestivum FGAS: L... 92 2e-016
gb|CK202783.1|CK202783 FGAS011308 Triticum aestivum FGAS: L... 92 2e-016
gb|CK203101.1|CK203101 FGAS011627 Triticum aestivum FGAS: L... 92 2e-016
gb|CK207892.1|CK207892 FGAS019564 Triticum aestivum FGAS: L... 92 2e-016
gb|CK210350.1|CK210350 FGAS022155 Triticum aestivum FGAS: L... 92 2e-016
gb|CV762386.1|CV762386 FGAS056775 Triticum aestivum FGAS: L... 92 2e-016
gb|DR739722.1|DR739722 FGAS084939 Triticum aestivum FGAS: L... 92 2e-016
gb|BE443047.1|BE443047 WHE1114_C01_E02ZS Wheat etiolated se... 88 2e-015
gb|BE488907.1|BE488907 WHE1077_G09_N17ZS Wheat unstressed s... 88 2e-015
gb|BQ484074.1|BQ484074 WHE3516_B03_D06ZS Wheat unstressed r... 84 4e-014
gb|CK210294.1|CK210294 FGAS022095 Triticum aestivum FGAS: L... 84 4e-014
gb|BE405624.1|BE405624 WHE1209_E04_I07ZS Wheat etiolated se... 82 1e-013
gb|CV770658.1|CV770658 FGAS065051 Triticum aestivum FGAS: L... 80 6e-013
gb|CV775690.1|CV775690 FGAS070094 Triticum aestivum FGAS: L... 80 6e-013
gb|DR736913.1|DR736913 FGAS082283 Triticum aestivum FGAS: L... 80 6e-013
gb|BE489912.1|BE489912 WHE0363_C06_E11ZS Wheat cold-stresse... 72 1e-010
gb|CD867958.1|CD867958 AZO2.107K10F001110 AZO2 Triticum aes... 72 1e-010
gb|AJ612933.1|AJ612933 AJ612933 Triticum turgidum subsp. du... 72 1e-010
gb|CV762174.1|CV762174 FGAS056563 Triticum aestivum FGAS: L... 72 1e-010
gb|BE217029.1|BE217029 EST0424 Triticum aestivum Lambda Zap... 68 2e-009
gb|BE489407.1|BE489407 WHE1071-1074_G04_G04ZS Wheat unstres... 68 2e-009
gb|CV775175.1|CV775175 FGAS069576 Triticum aestivum FGAS: L... 68 2e-009
gb|CV775195.1|CV775195 FGAS069597 Triticum aestivum FGAS: L... 68 2e-009
gb|CV778722.1|CV778722 FGAS073131 Triticum aestivum FGAS: L... 68 2e-009
gb|DR736469.1|DR736469 FGAS081839 Triticum aestivum FGAS: L... 68 2e-009
gb|BE411998.1|BE411998 JJL001.D12R990511 ITEC JJL Wheat Lea... 66 9e-009
gb|BU101173.1|BU101173 WHE3363_F12_K23ZS Chinese Spring alu... 66 9e-009
gb|CD878756.1|CD878756 AZO4.103J02F010929 AZO4 Triticum aes... 66 9e-009
gb|CV762078.1|CV762078 FGAS056467 Triticum aestivum FGAS: L... 66 9e-009
gb|CV762871.1|CV762871 FGAS057260 Triticum aestivum FGAS: L... 66 9e-009
gb|CV765837.1|CV765837 FGAS060224 Triticum aestivum FGAS: L... 66 9e-009
gb|CK201216.1|CK201216 FGAS009735 Triticum aestivum FGAS: L... 64 4e-008
gb|CK217114.1|CK217114 FGAS029115 Triticum aestivum FGAS: L... 64 4e-008
gb|CV761378.1|CV761378 FGAS055766 Triticum aestivum FGAS: L... 64 4e-008
gb|CV767616.1|CV767616 FGAS062007 Triticum aestivum FGAS: L... 64 4e-008
gb|DR741363.1|DR741363 FGAS030419 Triticum aestivum FGAS: L... 64 4e-008
gb|AY244510.1| Triticum monococcum cultivar G1777 cysteine ... 64 4e-008
gb|AY244511.1| Triticum monococcum cultivar G2528 cysteine ... 64 4e-008
gb|CA485017.1|CA485017 WHE4313_D09_G17ZS Wheat meiotic anth... 62 1e-007
gb|CA487130.1|CA487130 WHE4340_H10_P20ZS Wheat meiotic anth... 62 1e-007
gb|DR733360.1|DR733360 FGAS079119 Triticum aestivum FGAS: L... 62 1e-007
gb|BJ250154.1|BJ250154 BJ250154 Y. Ogihara unpublished cDNA... 60 5e-007
gb|CD890763.1|CD890763 G118.115G05R010926 G118 Triticum aes... 60 5e-007
gb|CK168322.1|CK168322 FGAS052842 Triticum aestivum FGAS: T... 60 5e-007
gb|CN011144.1|CN011144 WHE3880_E03_I06ZS Wheat Fusarium gra... 60 5e-007
gb|CV763039.1|CV763039 FGAS057428 Triticum aestivum FGAS: L... 60 5e-007
gb|CV774007.1|CV774007 FGAS068404 Triticum aestivum FGAS: L... 60 5e-007
gb|BJ270297.1|BJ270297 BJ270297 Y. Ogihara unpublished cDNA... 58 2e-006
gb|AJ612538.1|AJ612538 AJ612538 Triticum turgidum subsp. du... 58 2e-006
gb|AL815132.1|AL815132 AL815132 h:116 Triticum aestivum cDN... 58 2e-006
gb|CV782020.1|CV782020 FGAS076433 Triticum aestivum FGAS: L... 58 2e-006
gb|BQ244544.1|BQ244544 TaE15036A09F TaE15 Triticum aestivum... 56 9e-006
gb|AL821984.1|AL821984 AL821984 N:130 Triticum aestivum cDN... 56 9e-006
gb|BQ743784.1|BQ743784 WHE4108_B03_D06ZS Wheat salt-stresse... 56 9e-006
gb|CA637709.1|CA637709 wre1n.pk0002.f7 wre1n Triticum aesti... 56 9e-006
gb|CA701268.1|CA701268 wkm2c.pk0003.c10 wkm2c Triticum aest... 56 9e-006
gb|CD867959.1|CD867959 AZO2.107K10R010328 AZO2 Triticum aes... 56 9e-006
gb|DR735998.1|DR735998 FGAS081506 Triticum aestivum FGAS: L... 56 9e-006
gb|AL827885.1|AL827885 AL827885 p:739 Triticum aestivum cDN... 54 3e-005
gb|BQ801851.1|BQ801851 WHE2819_C08_F15ZS Triticum monococcu... 54 3e-005
gb|CA689263.1|CA689263 wlm96.pk045.k14 wlm96 Triticum aesti... 54 3e-005
gb|BE500637.1|BE500637 WHE0987-0990_H17_H17ZS Wheat pre-ant... 52 1e-004
gb|BF293987.1|BF293987 WHE2162_E03_J06ZS Triticum turgidum ... 52 1e-004
gb|BJ242559.1|BJ242559 BJ242559 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ243659.1|BJ243659 BJ243659 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ275299.1|BJ275299 BJ275299 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ283747.1|BJ283747 BJ283747 Y. Ogihara unpublished cDNA... 52 1e-004
gb|CD899550.1|CD899550 G174.112M11F010824 G174 Triticum aes... 52 1e-004
gb|CD935047.1|CD935047 OV.002M22F010109 OV Triticum aestivu... 52 1e-004
gb|CD935166.1|CD935166 OV.003M22F010118 OV Triticum aestivu... 52 1e-004
gb|CK202713.1|CK202713 FGAS011238 Triticum aestivum FGAS: L... 52 1e-004
gb|BJ250425.1|BJ250425 BJ250425 Y. Ogihara unpublished cDNA... 50 5e-004
gb|BQ169109.1|BQ169109 WHE2152_B07_C14ZT Triticum turgidum ... 50 5e-004
gb|CA652926.1|CA652926 wre1n.pk194.h5 wre1n Triticum aestiv... 50 5e-004
gb|CD452589.1|CD452589 WHE1114_C01_E02ZT CS wheat etiolated... 50 5e-004
gb|CK202762.1|CK202762 FGAS011287 Triticum aestivum FGAS: L... 50 5e-004
gb|CK203080.1|CK203080 FGAS011606 Triticum aestivum FGAS: L... 50 5e-004
gb|CK209027.1|CK209027 FGAS020761 Triticum aestivum FGAS: L... 50 5e-004
gb|CK211583.1|CK211583 FGAS023434 Triticum aestivum FGAS: L... 50 5e-004
gb|BE498680.1|BE498680 WHE0964_B01_C02ZS Wheat pre-anthesis... 48 0.002
gb|BE498906.1|BE498906 WHE0968_D12_G24ZS Wheat pre-anthesis... 48 0.002
gb|BE500262.1|BE500262 WHE0981_G02_N03ZS Wheat pre-anthesis... 48 0.002
gb|BG909378.1|BG909378 TaLr1102C10R TaLr1 Triticum aestivum... 48 0.002
gb|BJ247525.1|BJ247525 BJ247525 Y. Ogihara unpublished cDNA... 48 0.002
gb|AL822105.1|AL822105 AL822105 N:130 Triticum aestivum cDN... 48 0.002
gb|CA600619.1|CA600619 waw1c.pk005.k18 waw1c Triticum aesti... 48 0.002
gb|CA609655.1|CA609655 wr1.pk0108.a9 wr1 Triticum aestivum ... 48 0.002
gb|CA646135.1|CA646135 wre1n.pk0107.c3 wre1n Triticum aesti... 48 0.002
gb|CA656979.1|CA656979 wlm0.pk0033.g10 wlm0 Triticum aestiv... 48 0.002
gb|CA686538.1|CA686538 wlm96.pk033.a14 wlm96 Triticum aesti... 48 0.002
gb|CD901227.1|CD901227 G356.103C18F010917 G356 Triticum aes... 48 0.002
gb|CK207804.1|CK207804 FGAS019471 Triticum aestivum FGAS: L... 48 0.002
gb|CA633327.1|CA633327 wle1n.pk0067.c7 wle1n Triticum aesti... 46 0.008
gb|CA661150.1|CA661150 wlm1.pk0018.c6 wlm1 Triticum aestivu... 46 0.008
gb|CA676846.1|CA676846 wlm12.pk0007.f1 wlm12 Triticum aesti... 46 0.008
gb|CA685227.1|CA685227 wlm96.pk029.p24 wlm96 Triticum aesti... 46 0.008
gb|CA687403.1|CA687403 wlm96.pk036.l1 wlm96 Triticum aestiv... 46 0.008
gb|CA693144.1|CA693144 wlm96.pk061.i7 wlm96 Triticum aestiv... 46 0.008
gb|CA697810.1|CA697810 wlk4.pk0024.b11 wlk4 Triticum aestiv... 46 0.008
gb|CA699512.1|CA699512 wlk8.pk0019.c6 wlk8 Triticum aestivu... 46 0.008
gb|CK193915.1|CK193915 FGAS002334 Triticum aestivum FGAS: L... 46 0.008
gb|CK205689.1|CK205689 FGAS017215 Triticum aestivum FGAS: L... 46 0.008
gb|AJ611573.1|AJ611573 AJ611573 Triticum turgidum subsp. du... 46 0.008
gb|CV782235.1|CV782235 FGAS076648 Triticum aestivum FGAS: L... 46 0.008
gb|DR735403.1|DR735403 FGAS081073 Triticum aestivum FGAS: L... 46 0.008
gb|DR736620.1|DR736620 FGAS081990 Triticum aestivum FGAS: L... 46 0.008
gb|DR740389.1|DR740389 FGAS000336 Triticum aestivum FGAS: L... 46 0.008
gb|DR741331.1|DR741331 FGAS001259 Triticum aestivum FGAS: L... 46 0.008
gb|BE403542.1|BE403542 WHE0427_G05_N09ZS Wheat etiolated se... 44 0.033
gb|BE420040.1|BE420040 WWS02.E11R000101 ITEC WWS Wheat Scut... 44 0.033
gb|BE471170.1|BE471170 WHE0285_H05_P09ZS Wheat drought-stre... 44 0.033
gb|BE490132.1|BE490132 WHE0365_B05_D09ZS Wheat cold-stresse... 44 0.033
gb|BE498288.1|BE498288 WHE0963_D02_G03ZS Wheat pre-anthesis... 44 0.033
gb|BE498850.1|BE498850 WHE0966_B11_D22ZS Wheat pre-anthesis... 44 0.033
gb|BF293405.1|BF293405 WHE2152_B02_C04ZS Triticum turgidum ... 44 0.033
gb|BF473301.1|BF473301 WHE0926_H09_O18ZS Wheat 5-15 DAP spi... 44 0.033
gb|BI479768.1|BI479768 WHE3451_H02_O03ZS Wheat pre-anthesis... 44 0.033
gb|BM134285.1|BM134285 WHE0488_B07_C14ZS Wheat Fusarium gra... 44 0.033
gb|BJ213886.1|BJ213886 BJ213886 Y. Ogihara unpublished cDNA... 44 0.033
gb|BJ290105.1|BJ290105 BJ290105 Y. Ogihara unpublished cDNA... 44 0.033
gb|BJ296435.1|BJ296435 BJ296435 Y. Ogihara unpublished cDNA... 44 0.033
gb|BQ169107.1|BQ169107 WHE2152_B02_C04ZT Triticum turgidum ... 44 0.033
gb|BQ483894.1|BQ483894 WHE3513_G11_M21ZS Wheat unstressed r... 44 0.033
gb|AL820916.1|AL820916 AL820916 O:232 Triticum aestivum cDN... 44 0.033
gb|AL822284.1|AL822284 AL822284 p:234 Triticum aestivum cDN... 44 0.033
gb|BQ905079.1|BQ905079 Ta04_13m16_R Ta04_AAFC_ECORC_Fusariu... 44 0.033
gb|CA593034.1|CA593034 wpa1c.pk001.p2 wpa1c Triticum aestiv... 44 0.033
gb|CA597415.1|CA597415 wpa1c.pk016.b18 wpa1c Triticum aesti... 44 0.033
gb|CA663879.1|CA663879 wlmk1.pk0031.a12 wlmk1 Triticum aest... 44 0.033
gb|CA685460.1|CA685460 wlm96.pk029.k6 wlm96 Triticum aestiv... 44 0.033
gb|CA689950.1|CA689950 wlm96.pk047.n2 wlm96 Triticum aestiv... 44 0.033
gb|CA693088.1|CA693088 wlm96.pk061.e6 wlm96 Triticum aestiv... 44 0.033
gb|CA712238.1|CA712238 wdk3c.pk005.p15 wdk3c Triticum aesti... 44 0.033
gb|CA712387.1|CA712387 wdk3c.pk005.g16 wdk3c Triticum aesti... 44 0.033
gb|CA717810.1|CA717810 wdk4c.pk006.n9 wdk4c Triticum aestiv... 44 0.033
gb|CA718338.1|CA718338 wdk5c.pk005.n2 wdk5c Triticum aestiv... 44 0.033
gb|CA721837.1|CA721837 wds1c.pk001.e7.f wds1c Triticum mono... 44 0.033
gb|CA725388.1|CA725388 wds3f.pk002.i3 wds3f Triticum aestiv... 44 0.033
gb|CA731446.1|CA731446 wip1c.pk006.o4 wip1c Triticum aestiv... 44 0.033
gb|CD877578.1|CD877578 AZO4.100K01F010925 AZO4 Triticum aes... 44 0.033
gb|CD885356.1|CD885356 G118.001D20F010306 G118 Triticum aes... 44 0.033
gb|CD893128.1|CD893128 G118.122O17F010725 G118 Triticum aes... 44 0.033
gb|CD929571.1|CD929571 GR45.108I21F010413 GR45 Triticum aes... 44 0.033
gb|CD932911.1|CD932911 GR45.119F21F010719 GR45 Triticum aes... 44 0.033
gb|CK195444.1|CK195444 FGAS003883 Triticum aestivum FGAS: L... 44 0.033
gb|CK197230.1|CK197230 FGAS005701 Triticum aestivum FGAS: L... 44 0.033
gb|CK198528.1|CK198528 FGAS007014 Triticum aestivum FGAS: L... 44 0.033
gb|CK202110.1|CK202110 FGAS010632 Triticum aestivum FGAS: L... 44 0.033
gb|CK202363.1|CK202363 FGAS010887 Triticum aestivum FGAS: L... 44 0.033
gb|CK206739.1|CK206739 FGAS018345 Triticum aestivum FGAS: L... 44 0.033
gb|CK207903.1|CK207903 FGAS019576 Triticum aestivum FGAS: L... 44 0.033
gb|AJ612695.1|AJ612695 AJ612695 Triticum turgidum subsp. du... 44 0.033
gb|AJ612920.1|AJ612920 AJ612920 Triticum turgidum subsp. du... 44 0.033
gb|CV065972.1|CV065972 WNEL29a3 Wheat EST endosperm library... 44 0.033
gb|CV761754.1|CV761754 FGAS056142 Triticum aestivum FGAS: L... 44 0.033
gb|CV764208.1|CV764208 FGAS058592 Triticum aestivum FGAS: L... 44 0.033
gb|CV775414.1|CV775414 FGAS069818 Triticum aestivum FGAS: L... 44 0.033
gb|CV777861.1|CV777861 FGAS072268 Triticum aestivum FGAS: L... 44 0.033
gb|CV782143.1|CV782143 FGAS076556 Triticum aestivum FGAS: L... 44 0.033
gb|DR735346.1|DR735346 FGAS081016 Triticum aestivum FGAS: L... 44 0.033
gb|DR736659.1|DR736659 FGAS082029 Triticum aestivum FGAS: L... 44 0.033
gb|DR739391.1|DR739391 FGAS084608 Triticum aestivum FGAS: L... 44 0.033
gb|BE412283.1|BE412283 JJL004.F12R990524 ITEC JJL Wheat Lea... 42 0.13
gb|BE419445.1|BE419445 WWS012.B5R000101 ITEC WWS Wheat Scut... 42 0.13
gb|BE420230.1|BE420230 WWS04.C12R000101 ITEC WWS Wheat Scut... 42 0.13
gb|BE425663.1|BE425663 WHE0303_G12_G12ZS Wheat unstressed s... 42 0.13
gb|BE426678.1|BE426678 WHE0331_F08_L15ZS Wheat unstressed s... 42 0.13
gb|BE471177.1|BE471177 WHE0285_G08_N15ZS Wheat drought-stre... 42 0.13
gb|BE585979.1|BE585979 Est#7pT7_A12_a12_085 KSU wheat Fusar... 42 0.13
gb|BE606535.1|BE606535 WHE0903_H05_P09ZS Wheat 5-15 DAP spi... 42 0.13
gb|BF485193.1|BF485193 WHE1789_E04_J07ZS Wheat pre-anthesis... 42 0.13
gb|BG607656.1|BG607656 WHE2481_F08_L15ZS Triticum monococcu... 42 0.13
gb|BI479085.1|BI479085 WHE2952_C01_E02ZS Wheat dormant embr... 42 0.13
gb|BJ226371.1|BJ226371 BJ226371 Y. Ogihara unpublished cDNA... 42 0.13
gb|BJ231282.1|BJ231282 BJ231282 Y. Ogihara unpublished cDNA... 42 0.13
gb|BJ279139.1|BJ279139 BJ279139 Y. Ogihara unpublished cDNA... 42 0.13
gb|BJ282308.1|BJ282308 BJ282308 Y. Ogihara unpublished cDNA... 42 0.13
gb|BJ313073.1|BJ313073 BJ313073 Y. Ogihara unpublished cDNA... 42 0.13
gb|BJ318810.1|BJ318810 BJ318810 Y. Ogihara unpublished cDNA... 42 0.13
gb|BQ484081.1|BQ484081 WHE3516_B11_D22ZS Wheat unstressed r... 42 0.13
gb|AL819208.1|AL819208 AL819208 n:129 Triticum aestivum cDN... 42 0.13
gb|AL819798.1|AL819798 AL819798 n:129 Triticum aestivum cDN... 42 0.13
gb|AL820992.1|AL820992 AL820992 O:232 Triticum aestivum cDN... 42 0.13
gb|BQ744030.1|BQ744030 WHE4110_H11_O22ZS Wheat salt-stresse... 42 0.13
gb|BQ788924.1|BQ788924 WHE4155_D04_G07ZS Wheat CS whole pla... 42 0.13
gb|BQ801090.1|BQ801090 WHE2810_B12_C24ZS Triticum monococcu... 42 0.13
gb|BQ802900.1|BQ802900 WHE2831_C09_F17ZS Triticum monococcu... 42 0.13
gb|BQ837983.1|BQ837983 WHE2905_C01_E01ZS Wheat aluminum-str... 42 0.13
gb|BJ247300.1|BJ247300 BJ247300 Y. Ogihara unpublished cDNA... 42 0.13
gb|CA484083.1|CA484083 WHE4301_A06_A11ZS Wheat meiotic anth... 42 0.13
gb|CA484811.1|CA484811 WHE4311_A02_B03ZS Wheat meiotic anth... 42 0.13
gb|CA502287.1|CA502287 WHE4045_D09_G17ZT Wheat meiotic anth... 42 0.13
gb|CA593077.1|CA593077 wpa1c.pk001.l3 wpa1c Triticum aestiv... 42 0.13
gb|CA596163.1|CA596163 wpa1c.pk012.p18 wpa1c Triticum aesti... 42 0.13
gb|CA603090.1|CA603090 wr1.pk0023.a6 wr1 Triticum aestivum ... 42 0.13
gb|CA630642.1|CA630642 wle1n.pk0035.c11 wle1n Triticum aest... 42 0.13
gb|CA681479.1|CA681479 wlm24.pk0015.g10 wlm24 Triticum aest... 42 0.13
gb|CA683438.1|CA683438 wlm96.pk0019.c1 wlm96 Triticum aesti... 42 0.13
gb|CA695821.1|CA695821 wlmk8.pk0016.b9 wlmk8 Triticum aesti... 42 0.13
gb|CA701130.1|CA701130 wkm2c.pk0002.g8 wkm2c Triticum aesti... 42 0.13
gb|CA721142.1|CA721142 wkm2n.pk009.d7 wkm2n Triticum aestiv... 42 0.13
gb|CA726766.1|CA726766 wde1f.pk001.n3 wde1f Triticum aestiv... 42 0.13
gb|CA727574.1|CA727574 wdi1c.pk001.j22 wdi1c Triticum aesti... 42 0.13
gb|CA732759.1|CA732759 wlp1c.pk004.h14 wlp1c Triticum aesti... 42 0.13
gb|CD862366.1|CD862366 AZO1.103E23F010126 AZO1 Triticum aes... 42 0.13
gb|CD862544.1|CD862544 AZO1.103N04F010129 AZO1 Triticum aes... 42 0.13
gb|CD871066.1|CD871066 AZO2.117E23F010207 AZO2 Triticum aes... 42 0.13
gb|CD873111.1|CD873111 AZO2.122G07F010208 AZO2 Triticum aes... 42 0.13
gb|CD874457.1|CD874457 AZO3.102D07F011001 AZO3 Triticum aes... 42 0.13
gb|CD874549.1|CD874549 AZO3.102H03R011123 AZO3 Triticum aes... 42 0.13
gb|CD875334.1|CD875334 AZO3.104N06F010930 AZO3 Triticum aes... 42 0.13
gb|CD876958.1|CD876958 AZO3.111H01F011011 AZO3 Triticum aes... 42 0.13
gb|CD882009.1|CD882009 F1.104P23F010329 F1 Triticum aestivu... 42 0.13
gb|CD902119.1|CD902119 G356.105P22F010918 G356 Triticum aes... 42 0.13
gb|CD905977.1|CD905977 G468.103I20R010929 G468 Triticum aes... 42 0.13
gb|CD918886.1|CD918886 G608.111E04F010910 G608 Triticum aes... 42 0.13
gb|CD920674.1|CD920674 G608.118A14F010910 G608 Triticum aes... 42 0.13
gb|CD923530.1|CD923530 G750.108O10F010530 G750 Triticum aes... 42 0.13
gb|CD924633.1|CD924633 G750.113N10F010706 G750 Triticum aes... 42 0.13
gb|CD925779.1|CD925779 G750.118K09F010710 G750 Triticum aes... 42 0.13
gb|CD931524.1|CD931524 GR45.114M14F010419 GR45 Triticum aes... 42 0.13
gb|CK195208.1|CK195208 FGAS003647 Triticum aestivum FGAS: L... 42 0.13
gb|CK198018.1|CK198018 FGAS006499 Triticum aestivum FGAS: L... 42 0.13
gb|CK198124.1|CK198124 FGAS006605 Triticum aestivum FGAS: L... 42 0.13
gb|CK198435.1|CK198435 FGAS006921 Triticum aestivum FGAS: L... 42 0.13
gb|CK200862.1|CK200862 FGAS009379 Triticum aestivum FGAS: L... 42 0.13
gb|CK201200.1|CK201200 FGAS009719 Triticum aestivum FGAS: L... 42 0.13
gb|CK202168.1|CK202168 FGAS010690 Triticum aestivum FGAS: L... 42 0.13
gb|CK202422.1|CK202422 FGAS010946 Triticum aestivum FGAS: L... 42 0.13
gb|CK202730.1|CK202730 FGAS011255 Triticum aestivum FGAS: L... 42 0.13
gb|CK203046.1|CK203046 FGAS011572 Triticum aestivum FGAS: L... 42 0.13
gb|CK206245.1|CK206245 FGAS017828 Triticum aestivum FGAS: L... 42 0.13
gb|CK209757.1|CK209757 FGAS021538 Triticum aestivum FGAS: L... 42 0.13
gb|CK209972.1|CK209972 FGAS021762 Triticum aestivum FGAS: L... 42 0.13
gb|AJ614537.1|AJ614537 AJ614537 Triticum turgidum subsp. du... 42 0.13
gb|CN012577.1|CN012577 WHE3898_C10_F20ZS Wheat Fusarium gra... 42 0.13
gb|AL813193.1|AL813193 AL813193 e:411 Triticum aestivum cDN... 42 0.13
gb|AL815139.1|AL815139 AL815139 h:116 Triticum aestivum cDN... 42 0.13
gb|CV760970.1|CV760970 FGAS055357 Triticum aestivum FGAS: L... 42 0.13
gb|CV763910.1|CV763910 FGAS058293 Triticum aestivum FGAS: L... 42 0.13
gb|CV764469.1|CV764469 FGAS058854 Triticum aestivum FGAS: L... 42 0.13
gb|CV774205.1|CV774205 FGAS068602 Triticum aestivum FGAS: L... 42 0.13
gb|CV778360.1|CV778360 FGAS072768 Triticum aestivum FGAS: L... 42 0.13
gb|CV779460.1|CV779460 FGAS073869 Triticum aestivum FGAS: L... 42 0.13
gb|CV780028.1|CV780028 FGAS074437 Triticum aestivum FGAS: L... 42 0.13
gb|DR737804.1|DR737804 FGAS083021 Triticum aestivum FGAS: L... 42 0.13
gb|DR741800.1|DR741800 FGAS030841 Triticum aestivum FGAS: L... 42 0.13
>gb|CA624339.1|CA624339 wl1n.pk0116.h3 wl1n Triticum aestivum cDNA clone wl1n.pk0116.h3 5'
end, mRNA sequence
Length = 517
Score = 412 bits (208), Expect = e-113
Identities = 246/256 (96%), Gaps = 7/256 (2%)
Strand = Plus / Plus
Query: 1512 agcaaagcgggaggagcagctggtgaggagattgagactg--gtggtgcgtggcgtgtac 1569
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 104 agcaaagcgggaggagcagctggtgaggagattgagactgtggtggtgcgtggcgtgtac 163
Query: 1570 tgttcatcgttcagacagatgacttgctggccgtgctgtgggctcaggaactgcttcttc 1629
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 164 tgttcatcgttcagacagatgacttgctggccatgctgtgggctcaggaactgcttcttc 223
Query: 1630 acagtggcgatgttctgatctgtaatgcgcgaagcacgatactatttgttgta----tat 1685
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||
Sbjct: 224 acagtggcgatgttctgatctgtaatgcacgaagcacgatactatttgttgtatatgtat 283
Query: 1686 gtatgtgtaactacagataagattagggaacggtgtgaaagaataaagaaaccgatggaa 1745
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 284 gtatgtgtaactacagataagatta-ggaacggtgtgaaagaataaagaaaccgatggaa 342
Query: 1746 taagtaatttgggaac 1761
||||| ||||||||||
Sbjct: 343 taagtgatttgggaac 358
Score = 159 bits (80), Expect = 8e-037
Identities = 83/84 (98%)
Strand = Plus / Plus
Query: 1409 agcgtccgggacgggacctgtcgtaagagcgccaacagcccgatgatggtgaaggctctg 1468
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1 agcgtccgggacgggacctgccgtaagagcgccaacagcccgatgatggtgaaggctctg 60
Query: 1469 cagcgcaagccggcgatgtatact 1492
||||||||||||||||||||||||
Sbjct: 61 cagcgcaagccggcgatgtatact 84
>gb|BG907904.1|BG907904 TaLr1163F10R TaLr1 Triticum aestivum cDNA clone TaLr1163F10 5',
mRNA sequence
Length = 679
Score = 119 bits (60), Expect = 7e-025
Identities = 105/120 (87%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 331 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 390
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
|||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 391 ctccactccttccgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 450
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 247 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 288
>gb|BJ246149.1|BJ246149 BJ246149 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf21l02 5', mRNA sequence
Length = 604
Score = 119 bits (60), Expect = 7e-025
Identities = 105/120 (87%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 134 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 193
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
|||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 194 ctccactccttccgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 253
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 50 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 91
>gb|BJ281046.1|BJ281046 BJ281046 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr20e21 5', mRNA sequence
Length = 485
Score = 119 bits (60), Expect = 7e-025
Identities = 105/120 (87%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 240 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 299
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
|||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 300 ctccactccttccgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 359
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 156 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 197
>gb|CK162728.1|CK162728 FGAS015327 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1041
Score = 119 bits (60), Expect = 7e-025
Identities = 105/120 (87%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 120 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 179
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
|||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 180 ctccactccttccgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 239
Score = 44.1 bits (22), Expect = 0.033
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacg 215
||||||||||||||||||||||
Sbjct: 36 gaggaggtgcggcggctgtacg 57
>gb|CK196115.1|CK196115 FGAS004562 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 875
Score = 119 bits (60), Expect = 7e-025
Identities = 105/120 (87%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 382 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 441
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
|||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 442 ctccactccttccgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 501
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 298 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 339
>gb|CK198665.1|CK198665 FGAS007152 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 817
Score = 119 bits (60), Expect = 7e-025
Identities = 105/120 (87%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 369 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 428
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
|||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 429 ctccactccttccgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 488
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 285 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 326
>gb|DR736403.1|DR736403 FGAS081773 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1074
Score = 119 bits (60), Expect = 7e-025
Identities = 105/120 (87%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 270 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 329
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
|||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 330 ctccactccttccgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 389
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 186 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 227
>gb|BG604924.1|BG604924 WHE2325_A07_A13ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2325_A07_A13, mRNA sequence
Length = 365
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 190 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 249
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 250 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 297
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 94 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 135
>gb|BJ256066.1|BJ256066 BJ256066 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh3k24 5', mRNA sequence
Length = 558
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 254 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 313
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 314 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 361
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 158 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 199
>gb|BJ279435.1|BJ279435 BJ279435 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr2p01 5', mRNA sequence
Length = 692
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 251 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 310
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 311 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 358
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 155 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 196
>gb|BJ280379.1|BJ280379 BJ280379 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr7n12 5', mRNA sequence
Length = 578
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 275 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 334
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 335 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 382
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 179 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 220
>gb|BJ302114.1|BJ302114 BJ302114 Y. Ogihara unpublished cDNA library, Wh_yd Triticum
aestivum cDNA clone whyd13k19 5', mRNA sequence
Length = 640
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 74 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 133
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 134 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 181
>gb|CA655008.1|CA655008 wlm0.pk0007.h3 wlm0 Triticum aestivum cDNA clone wlm0.pk0007.h3 5'
end, mRNA sequence
Length = 575
Score = 103 bits (52), Expect = 4e-020
Identities = 82/92 (89%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 254 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 313
Query: 407 cgcctcggcctcacccgcttcgccgacctcac 438
||||||||||||| ||||||||||||||||||
Sbjct: 314 cgcctcggcctcaaccgcttcgccgacctcac 345
>gb|CA656075.1|CA656075 wlm0.pk0020.e10 wlm0 Triticum aestivum cDNA clone wlm0.pk0020.e10
5' end, mRNA sequence
Length = 342
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 135 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 194
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 195 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 242
>gb|CA665072.1|CA665072 wlk1.pk0011.h9 wlk1 Triticum aestivum cDNA clone wlk1.pk0011.h9 5'
end, mRNA sequence
Length = 554
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 39 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 98
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 99 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 146
>gb|CA678674.1|CA678674 wlm4.pk0009.f4 wlm4 Triticum aestivum cDNA clone wlm4.pk0009.f4 5'
end, mRNA sequence
Length = 629
Score = 103 bits (52), Expect = 4e-020
Identities = 82/92 (89%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 263 gacaacctccgctacatcgacaagcacaacgccgccgccgacgccgggctccactccttc 322
Query: 407 cgcctcggcctcacccgcttcgccgacctcac 438
||||||||||||| ||||||||||||||||||
Sbjct: 323 cgcctcggcctcaaccgcttcgccgacctcac 354
>gb|CA693700.1|CA693700 wlmk4.pk0006.g2 wlmk4 Triticum aestivum cDNA clone wlmk4.pk0006.g2
5' end, mRNA sequence
Length = 208
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 21 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 80
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 81 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 128
>gb|CA700982.1|CA700982 wkm1c.pk006.f24 wkm1c Triticum aestivum cDNA clone wkm1c.pk006.f24
5' end, mRNA sequence
Length = 509
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 59 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 118
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 119 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 166
>gb|CD863088.1|CD863088 AZO1.105K12F010130 AZO1 Triticum aestivum cDNA clone AZO1105K12,
mRNA sequence
Length = 701
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 212 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 271
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 272 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 319
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 116 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 157
>gb|CD864936.1|CD864936 AZO2.001P06F000629 AZO2 Triticum aestivum cDNA clone AZO2001P06,
mRNA sequence
Length = 717
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 273 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 332
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 333 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 380
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 177 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 218
>gb|CD877779.1|CD877779 AZO4.101B18F010930 AZO4 Triticum aestivum cDNA clone AZO4101B18,
mRNA sequence
Length = 455
Score = 103 bits (52), Expect = 4e-020
Identities = 82/92 (89%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 262 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 321
Query: 407 cgcctcggcctcacccgcttcgccgacctcac 438
||||||||||||| ||||||||||||||||||
Sbjct: 322 cgcctcggcctcaaccgcttcgccgacctcac 353
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 166 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 207
>gb|CK162446.1|CK162446 FGAS015040 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1139
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 270 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 329
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 330 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 377
>gb|CK162470.1|CK162470 FGAS015065 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1022
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 293 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 352
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 353 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 400
>gb|CK193338.1|CK193338 FGAS001752 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 808
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 359 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 418
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 419 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 466
>gb|CK198623.1|CK198623 FGAS007110 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 835
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 348 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 407
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 408 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 455
>gb|CK198655.1|CK198655 FGAS007142 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 828
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 357 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 416
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 417 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 464
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 261 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 302
>gb|CK203028.1|CK203028 FGAS011554 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 832
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 377 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 436
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 437 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 484
>gb|CK209946.1|CK209946 FGAS021736 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1067
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 296 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 355
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 356 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 403
>gb|CV768379.1|CV768379 FGAS062770 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 834
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 378 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 437
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 438 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 485
>gb|CV773132.1|CV773132 FGAS067528 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 824
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 377 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 436
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 437 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 484
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 281 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 322
>gb|CV774019.1|CV774019 FGAS068416 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 845
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 380 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 439
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 440 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 487
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 284 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 325
>gb|CV776852.1|CV776852 FGAS071256 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 841
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 381 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 440
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 441 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 488
>gb|CV779499.1|CV779499 FGAS073908 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 834
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 363 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 422
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 423 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 470
>gb|CV780500.1|CV780500 FGAS074911 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 828
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 351 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 410
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 411 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 458
>gb|CV780777.1|CV780777 FGAS075188 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 969
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 430 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 489
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 490 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 537
>gb|CV781105.1|CV781105 FGAS075516 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 804
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 349 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 408
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 409 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 456
>gb|DR735498.1|DR735498 FGAS081168 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 1145
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 289 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 348
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 349 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 396
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 193 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 234
>gb|DR735764.1|DR735764 FGAS081398 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1108
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 294 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 353
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 354 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 401
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 198 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 239
>gb|DR739783.1|DR739783 FGAS000050 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 1160
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 304 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 363
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 364 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 411
Score = 44.1 bits (22), Expect = 0.033
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 194 gaggaggtgcggcggctgtacgaggagtggaggtcggagcac 235
||||||||||||||| |||||| ||||||| ||| ||||||
Sbjct: 208 gaggaggtgcggcggatgtacgccgagtggatgtccgagcac 249
>gb|DR740002.1|DR740002 FGAS000268 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 1128
Score = 103 bits (52), Expect = 4e-020
Identities = 94/108 (87%)
Strand = Plus / Plus
Query: 347 gacaacctccgctacatcgacgcgcacaacgcggaggcggacgcggggctccacggcttc 406
||||||||||||||||||||| ||||||||| | || ||||| ||||||||| ||||
Sbjct: 307 gacaacctccgctacatcgaccagcacaacgccgccgccgacgccgggctccactccttc 366
Query: 407 cgcctcggcctcacccgcttcgccgacctcacgctggaggagtaccgc 454
||||||||||||| |||||||||||||||||| ||||||||||||
Sbjct: 367 cgcctcggcctcaaccgcttcgccgacctcaccaacgaggagtaccgc 414
>gb|BJ211118.1|BJ211118 BJ211118 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh37o16 5', mRNA sequence
Length = 613
Score = 99.6 bits (50), Expect = 6e-019
Identities = 107/126 (84%)
Strand = Plus / Plus
Query: 587 gaggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtg 646
||||| ||| ||||||| || ||||| | |||||||| |||||| |||| || ||||||
Sbjct: 444 gaggtgaagaaccaggggcagtgcggcagctgctgggccttctcgacggtcgcggcggtg 503
Query: 647 gaagggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatc 706
|||||||||||| ||||||||||||| ||| | | ||||||||||||||||||| |||
Sbjct: 504 gaagggatcaacgccatcgtgacaggcaacctgaccgcgctgtcggagcaggagctgatc 563
Query: 707 gactgc 712
||||||
Sbjct: 564 gactgc 569
>gb|BJ212113.1|BJ212113 BJ212113 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh34n19 5', mRNA sequence
Length = 641
Score = 99.6 bits (50), Expect = 6e-019
Identities = 107/126 (84%)
Strand = Plus / Plus
Query: 587 gaggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtg 646
||||| ||| ||||||| || ||||| | |||||||| |||||| |||| || ||||||
Sbjct: 451 gaggtgaagaaccaggggcagtgcggcagctgctgggccttctcgacggtcgcggcggtg 510
Query: 647 gaagggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatc 706
|||||||||||| ||||||||||||| ||| | | ||||||||||||||||||| |||
Sbjct: 511 gaagggatcaacgccatcgtgacaggcaacctgaccgcgctgtcggagcaggagctgatc 570
Query: 707 gactgc 712
||||||
Sbjct: 571 gactgc 576
>gb|CA677854.1|CA677854 wlm12.pk0013.e5 wlm12 Triticum aestivum cDNA clone wlm12.pk0013.e5
5' end, mRNA sequence
Length = 507
Score = 99.6 bits (50), Expect = 6e-019
Identities = 90/104 (86%)
Strand = Plus / Plus
Query: 335 gaggtgttccgcgacaacctccgctacatcgacgcgcacaacgcggaggcggacgcgggg 394
||||||||||| ||||||||||||||||||||| ||||||||| | || ||||| |||
Sbjct: 280 gaggtgttccgggacaacctccgctacatcgaccagcacaacgccgccgccgacgccggg 339
Query: 395 ctccacggcttccgcctcggcctcacccgcttcgccgacctcac 438
|||||| ||||||||||| |||| ||||||| ||||||||||
Sbjct: 340 ctccactcnttccgcctcggactcaaccgcttcnccgacctcac 383
>gb|BE428351.1|BE428351 MTD006.A08F990616 ITEC MTD Durum Wheat Root Library Triticum
turgidum subsp. durum cDNA clone MTD006.A08, mRNA
sequence
Length = 386
Score = 91.7 bits (46), Expect = 2e-016
Identities = 106/126 (84%)
Strand = Plus / Plus
Query: 587 gaggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtg 646
||||| ||| ||||||| || ||||| | |||||||| |||||| ||||||| || |||
Sbjct: 20 gaggtgaagaaccaggggcagtgcggcagctgctgggccttctcgacggtggcggcagtg 79
Query: 647 gaagggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatc 706
|||||||||||| ||||||||||||| ||| | ||||||||||||||||||| |||
Sbjct: 80 gaagggatcaacgccatcgtgacaggcaacctgactgcgctgtcggagcaggagctcatc 139
Query: 707 gactgc 712
||||||
Sbjct: 140 gactgc 145
>gb|BJ281453.1|BJ281453 BJ281453 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr22c02 5', mRNA sequence
Length = 646
Score = 91.7 bits (46), Expect = 2e-016
Identities = 106/126 (84%)
Strand = Plus / Plus
Query: 589 ggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtgga 648
||||||| ||||||| ||||||| | |||||||| |||||| ||||||| ||||||||
Sbjct: 426 ggtcaagaaccaggggaaatgcggaagctgctgggccttctcgacggtggcggcggtgga 485
Query: 649 agggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatcga 708
|||||| ||| |||||||||| |||| || |||||||||||||||||||| || ||
Sbjct: 486 agggataaaccagatcgtgacgggcaagctggagtcgctgtcggagcaggagctgatgga 545
Query: 709 ctgcga 714
||||||
Sbjct: 546 ctgcga 551
>gb|BQ295179.1|BQ295179 WHE2867_A12_A23ZS Wheat unstressed root tip cDNA library Triticum
aestivum cDNA clone WHE2867_A12_A23, mRNA sequence
Length = 715
Score = 91.7 bits (46), Expect = 2e-016
Identities = 106/126 (84%)
Strand = Plus / Plus
Query: 587 gaggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtg 646
||||| ||| ||||||| || ||||| | |||||||| |||||| ||||||| || |||
Sbjct: 481 gaggtgaagaaccaggggcagtgcggcagctgctgggccttctcgacggtggcggcagtg 540
Query: 647 gaagggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatc 706
|||||||||||| ||||||||||||| ||| | ||||||||||||||||||| |||
Sbjct: 541 gaagggatcaacgccatcgtgacaggcaacctgactgcgctgtcggagcaggagctcatc 600
Query: 707 gactgc 712
||||||
Sbjct: 601 gactgc 606
>gb|BQ483540.1|BQ483540 WHE3509_G11_M21ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3509_G11_M21, mRNA sequence
Length = 694
Score = 91.7 bits (46), Expect = 2e-016
Identities = 106/126 (84%)
Strand = Plus / Plus
Query: 587 gaggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtg 646
||||| ||| ||||||| || ||||| | |||||||| |||||| ||||||| || |||
Sbjct: 483 gaggtgaagaaccaggggcagtgcggcagctgctgggccttctcgacggtggcggcagtg 542
Query: 647 gaagggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatc 706
|||||||||||| ||||||||||||| ||| | ||||||||||||||||||| |||
Sbjct: 543 gaagggatcaacgccatcgtgacaggcaacctgactgcgctgtcggagcaggagctcatc 602
Query: 707 gactgc 712
||||||
Sbjct: 603 gactgc 608
>gb|CA608618.1|CA608618 wr1.pk0092.e9 wr1 Triticum aestivum cDNA clone wr1.pk0092.e9 5'
end, mRNA sequence
Length = 587
Score = 91.7 bits (46), Expect = 2e-016
Identities = 106/126 (84%)
Strand = Plus / Plus
Query: 587 gaggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtg 646
||||| ||| ||||||| || ||||| | |||||||| |||||| ||||||| || |||
Sbjct: 85 gaggtgaagaaccaggggcagtgcggcagctgctgggccttctcgacggtggcggcagtg 144
Query: 647 gaagggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatc 706
|||||||||||| ||||||||||||| ||| | ||||||||||||||||||| |||
Sbjct: 145 gaagggatcaacgccatcgtgacaggcaacctgactgcgctgtcggagcaggagctcatc 204
Query: 707 gactgc 712
||||||
Sbjct: 205 gactgc 210
>gb|CK155031.1|CK155031 FGAS033751 Triticum aestivum FGAS: TaLt2 Triticum aestivum cDNA,
mRNA sequence
Length = 889
Score = 91.7 bits (46), Expect = 2e-016
Identities = 106/126 (84%)
Strand = Plus / Plus
Query: 587 gaggtcaaggaccagggccaatgcggtgggtgctgggcgttctcggcggtggcagcggtg 646
||||| ||| ||||||| || ||||| | |||||||| |||||| ||||||| || |||
Sbjct: 602 gaggtgaagaaccaggggcagtgcggcagctgctgggccttctcgacggtggcggcagtg 661
Query: 647 gaagggatcaacaagatcgtgacaggcagcctcatctcgctgtcggagcaggagcttatc 706
|||||||||||| || |||||||||| ||| | | ||||||||||||||||||| |||
Sbjct: 662 gaagggatcaacgccattgtgacaggcaacctgaccgcgctgtcggagcaggagctcatc 721
Query: 707 gactgc 712
||||||
Sbjct: 722 gactgc 727
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 688,895
Number of Sequences: 636343
Number of extensions: 688895
Number of successful extensions: 228344
Number of sequences better than 0.5: 305
Number of HSP's better than 0.5 without gapping: 305
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 227073
Number of HSP's gapped (non-prelim): 1101
length of query: 1761
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1741
effective length of database: 354,513,379
effective search space: 617207792839
effective search space used: 617207792839
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)