BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8636641.2.1
(1326 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV775074.1|CV775074 FGAS069475 Triticum aestivum FGAS: L... 299 3e-079
gb|CV776662.1|CV776662 FGAS071066 Triticum aestivum FGAS: L... 299 3e-079
emb|AX660622.1| Sequence 979 from Patent WO03000906 289 2e-076
gb|CK205114.1|CK205114 FGAS013651 Triticum aestivum FGAS: L... 278 9e-073
gb|CK204757.1|CK204757 FGAS013293 Triticum aestivum FGAS: L... 178 6e-043
gb|CA620984.1|CA620984 wl1n.pk0070.h4 wl1n Triticum aestivu... 103 3e-020
gb|CA651174.1|CA651174 wre1n.pk180.e8 wre1n Triticum aestiv... 98 2e-018
gb|BE497768.1|BE497768 WHE0956_D11_G22ZS Wheat pre-anthesis... 86 7e-015
gb|BM136154.1|BM136154 WHE2605_F12_K23ZS Wheat Fusarium gra... 86 7e-015
gb|CA608220.1|CA608220 wr1.pk0090.g7 wr1 Triticum aestivum ... 86 7e-015
gb|CK162645.1|CK162645 FGAS015243 Triticum aestivum FGAS: L... 86 7e-015
gb|BE415763.1|BE415763 MWL037.B08000418 ITEC MWL Wheat Root... 82 1e-013
gb|BF483453.1|BF483453 WHE2334_B01_C02ZS Wheat pre-anthesis... 74 3e-011
gb|BQ744329.1|BQ744329 WHE4114_C11_E22ZS Wheat salt-stresse... 74 3e-011
gb|BQ788776.1|BQ788776 WHE4153_F12_L23ZS Wheat CS whole pla... 74 3e-011
gb|BQ789452.1|BQ789452 WHE4161_E09_J17ZS Wheat CS whole pla... 74 3e-011
gb|CA659498.1|CA659498 wlm1.pk0007.e8 wlm1 Triticum aestivu... 74 3e-011
gb|CD867965.1|CD867965 AZO2.107K19F001109 AZO2 Triticum aes... 74 3e-011
gb|CD872600.1|CD872600 AZO2.120P21F010209 AZO2 Triticum aes... 74 3e-011
gb|CD914329.1|CD914329 G550.121P04F010712 G550 Triticum aes... 74 3e-011
gb|CK160644.1|CK160644 FGAS042257 Triticum aestivum FGAS: T... 74 3e-011
gb|CK195465.1|CK195465 FGAS003904 Triticum aestivum FGAS: L... 74 3e-011
gb|CK207072.1|CK207072 FGAS018687 Triticum aestivum FGAS: L... 74 3e-011
gb|BF201958.1|BF201958 WHE1759-1762_N22_N22ZS Wheat pre-ant... 72 1e-010
gb|BQ484105.1|BQ484105 WHE3516_E01_J02ZS Wheat unstressed r... 72 1e-010
gb|CK207865.1|CK207865 FGAS019535 Triticum aestivum FGAS: L... 70 4e-010
gb|CK208944.1|CK208944 FGAS020671 Triticum aestivum FGAS: L... 68 2e-009
gb|DR736866.1|DR736866 FGAS082236 Triticum aestivum FGAS: L... 68 2e-009
gb|BE415179.1|BE415179 MWL024.B10F000107 ITEC MWL Wheat Roo... 66 7e-009
gb|BJ281093.1|BJ281093 BJ281093 Y. Ogihara unpublished cDNA... 66 7e-009
gb|CA626950.1|CA626950 wl1n.pk0145.f10 wl1n Triticum aestiv... 66 7e-009
gb|CD869853.1|CD869853 AZO2.112N03F001117 AZO2 Triticum aes... 66 7e-009
gb|CD879599.1|CD879599 AZO4.105M10F011011 AZO4 Triticum aes... 66 7e-009
gb|AJ717146.1|AJ717146 AJ717146 Triticum turgidum subsp. du... 66 7e-009
gb|CA613361.1|CA613361 wr1.pk0144.c9 wr1 Triticum aestivum ... 64 3e-008
gb|BE404565.1|BE404565 WHE0443_G09_N17ZS Wheat etiolated se... 62 1e-007
gb|BJ286157.1|BJ286157 BJ286157 Y. Ogihara unpublished cDNA... 62 1e-007
gb|BJ277560.1|BJ277560 BJ277560 Y. Ogihara unpublished cDNA... 62 1e-007
gb|BJ279346.1|BJ279346 BJ279346 Y. Ogihara unpublished cDNA... 62 1e-007
gb|CA619392.1|CA619392 wl1n.pk0051.e10 wl1n Triticum aestiv... 62 1e-007
gb|CA623946.1|CA623946 wl1n.pk0111.d2 wl1n Triticum aestivu... 62 1e-007
gb|CA626858.1|CA626858 wl1n.pk0147.b1 wl1n Triticum aestivu... 62 1e-007
gb|CA700583.1|CA700583 wkm1c.pk005.l2 wkm1c Triticum aestiv... 62 1e-007
gb|BF484285.1|BF484285 WHE2321_E01_I01ZS Wheat pre-anthesis... 60 4e-007
gb|BJ282415.1|BJ282415 BJ282415 Y. Ogihara unpublished cDNA... 60 4e-007
gb|BQ804333.1|BQ804333 WHE3553_C07_F13ZS Wheat developing g... 60 4e-007
gb|BQ804547.1|BQ804547 WHE3555_H10_O19ZS Wheat developing g... 60 4e-007
gb|BJ257363.1|BJ257363 BJ257363 Y. Ogihara unpublished cDNA... 60 4e-007
gb|BJ257494.1|BJ257494 BJ257494 Y. Ogihara unpublished cDNA... 60 4e-007
gb|CA625073.1|CA625073 wl1n.pk0127.g8 wl1n Triticum aestivu... 60 4e-007
gb|CA625581.1|CA625581 wl1n.pk0143.d11 wl1n Triticum aestiv... 60 4e-007
gb|CD878556.1|CD878556 AZO4.103A20F010929 AZO4 Triticum aes... 60 4e-007
gb|CD895237.1|CD895237 G174.001F12F010514 G174 Triticum aes... 60 4e-007
gb|CK164142.1|CK164142 FGAS048039 Triticum aestivum FGAS: T... 60 4e-007
gb|CN011943.1|CN011943 WHE3890_G04_N08ZS Wheat Fusarium gra... 60 4e-007
gb|CV774757.1|CV774757 FGAS069157 Triticum aestivum FGAS: L... 60 4e-007
gb|BE425880.1|BE425880 WHE0325_E12_I23ZS Wheat unstressed s... 58 2e-006
gb|BE431037.1|BE431037 SUN010.F04F991222 ITEC SUN Wheat cDN... 58 2e-006
gb|BJ256761.1|BJ256761 BJ256761 Y. Ogihara unpublished cDNA... 58 2e-006
gb|AL825687.1|AL825687 AL825687 p:234 Triticum aestivum cDN... 58 2e-006
gb|BU099346.1|BU099346 WHE3306_D06_G12ZS Chinese Spring whe... 58 2e-006
gb|CA647005.1|CA647005 wre1n.pk0110.c4 wre1n Triticum aesti... 58 2e-006
gb|CD920041.1|CD920041 G608.115J23R011026 G608 Triticum aes... 58 2e-006
gb|CK194799.1|CK194799 FGAS003231 Triticum aestivum FGAS: L... 58 2e-006
gb|CV782497.1|CV782497 FGAS076910 Triticum aestivum FGAS: L... 58 2e-006
gb|BE500072.1|BE500072 WHE0978_H12_P24ZS Wheat pre-anthesis... 56 6e-006
gb|BG313155.1|BG313155 WHE2054_D08_H16ZS Wheat salt-stresse... 56 6e-006
gb|BQ619972.1|BQ619972 TaLr1141D03F TaLr1 Triticum aestivum... 56 6e-006
gb|BQ752747.1|BQ752747 WHE4118_F10_K20ZS Wheat salt-stresse... 56 6e-006
gb|BJ278053.1|BJ278053 BJ278053 Y. Ogihara unpublished cDNA... 56 6e-006
gb|CA625775.1|CA625775 wl1n.pk0134.c2 wl1n Triticum aestivu... 56 6e-006
gb|CA638499.1|CA638499 wre1n.pk0011.c10 wre1n Triticum aest... 56 6e-006
gb|CD454572.1|CD454572 WHE2327_G01_N01ZT CS wheat pre-anthe... 56 6e-006
gb|CB307753.1|CB307753 HFIG738 Hessian fly infested cDNA li... 56 6e-006
gb|CK197295.1|CK197295 FGAS005766 Triticum aestivum FGAS: L... 56 6e-006
gb|BF200968.1|BF200968 WHE0825-0828_G11_G11ZS Wheat vernali... 54 3e-005
gb|BJ247486.1|BJ247486 BJ247486 Y. Ogihara unpublished cDNA... 54 3e-005
gb|BJ280789.1|BJ280789 BJ280789 Y. Ogihara unpublished cDNA... 54 3e-005
gb|AL829492.1|AL829492 AL829492 p:840 Triticum aestivum cDN... 54 3e-005
gb|BJ223405.1|BJ223405 BJ223405 Y. Ogihara unpublished cDNA... 54 3e-005
gb|BJ277809.1|BJ277809 BJ277809 Y. Ogihara unpublished cDNA... 54 3e-005
gb|CA596144.1|CA596144 wpa1c.pk012.d7 wpa1c Triticum aestiv... 54 3e-005
gb|CA611135.1|CA611135 wr1.pk0094.f5 wr1 Triticum aestivum ... 54 3e-005
gb|CA612868.1|CA612868 wr1.pk0160.f9 wr1 Triticum aestivum ... 54 3e-005
gb|CA638062.1|CA638062 wre1n.pk0004.g10 wre1n Triticum aest... 54 3e-005
gb|CD868898.1|CD868898 AZO2.110B24F001124 AZO2 Triticum aes... 54 3e-005
gb|CD869237.1|CD869237 AZO2.111B18F001120 AZO2 Triticum aes... 54 3e-005
gb|CD869238.1|CD869238 AZO2.111B18R010402 AZO2 Triticum aes... 54 3e-005
gb|CD869393.1|CD869393 AZO2.111I17F001115 AZO2 Triticum aes... 54 3e-005
gb|CD869394.1|CD869394 AZO2.111I17R010402 AZO2 Triticum aes... 54 3e-005
gb|CK196118.1|CK196118 FGAS004565 Triticum aestivum FGAS: L... 54 3e-005
gb|CV766338.1|CV766338 FGAS060725 Triticum aestivum FGAS: L... 54 3e-005
gb|CV777202.1|CV777202 FGAS071607 Triticum aestivum FGAS: L... 54 3e-005
gb|BJ277484.1|BJ277484 BJ277484 Y. Ogihara unpublished cDNA... 52 1e-004
gb|BJ280657.1|BJ280657 BJ280657 Y. Ogihara unpublished cDNA... 52 1e-004
gb|CA605680.1|CA605680 wr1.pk0056.a12 wr1 Triticum aestivum... 52 1e-004
gb|CA606090.1|CA606090 wr1.pk0058.e8 wr1 Triticum aestivum ... 52 1e-004
gb|CA733642.1|CA733642 wlp1c.pk005.h21 wlp1c Triticum aesti... 52 1e-004
gb|CD871736.1|CD871736 AZO2.118P02R010403 AZO2 Triticum aes... 52 1e-004
gb|CD887392.1|CD887392 G118.105A21F010605 G118 Triticum aes... 52 1e-004
gb|CK204013.1|CK204013 FGAS012548 Triticum aestivum FGAS: L... 52 1e-004
gb|BE403526.1|BE403526 WHE0427_E09_J17ZS Wheat etiolated se... 50 4e-004
gb|BE404023.1|BE404023 WHE0410_E11_E11ZS Wheat etiolated se... 50 4e-004
gb|BE406480.1|BE406480 WHE0416_g10_n20zB Wheat etiolated se... 50 4e-004
gb|BE406659.1|BE406659 WHE0428_a09_b18zB Wheat etiolated se... 50 4e-004
gb|BE414973.1|BE414973 MWL009.E06F990623 ITEC MWL Wheat Roo... 50 4e-004
gb|BE425342.1|BE425342 WHE313_C11_C11ZS Wheat unstressed se... 50 4e-004
gb|BE429895.1|BE429895 TAS004.H08R990615 ITEC TAS Wheat cDN... 50 4e-004
gb|BE489949.1|BE489949 WHE0363_F10_K19ZS Wheat cold-stresse... 50 4e-004
gb|BE490556.1|BE490556 WHE0367_B07_C13ZS Wheat cold-stresse... 50 4e-004
gb|BJ281099.1|BJ281099 BJ281099 Y. Ogihara unpublished cDNA... 50 4e-004
gb|BQ295138.1|BQ295138 WHE2858_F07_L14ZS Wheat unstressed r... 50 4e-004
gb|BQ295510.1|BQ295510 WHE2870_G11_N22ZS Wheat unstressed r... 50 4e-004
gb|BQ620304.1|BQ620304 TaLr1172D09R TaLr1 Triticum aestivum... 50 4e-004
gb|BQ620583.1|BQ620583 TaLr1141D03R TaLr1 Triticum aestivum... 50 4e-004
gb|AL825016.1|AL825016 AL825016 p:234 Triticum aestivum cDN... 50 4e-004
gb|AL825481.1|AL825481 AL825481 p:335 Triticum aestivum cDN... 50 4e-004
gb|AL825588.1|AL825588 AL825588 p:335 Triticum aestivum cDN... 50 4e-004
gb|AL826692.1|AL826692 AL826692 p:537 Triticum aestivum cDN... 50 4e-004
gb|AL826994.1|AL826994 AL826994 p:638 Triticum aestivum cDN... 50 4e-004
gb|AL829743.1|AL829743 AL829743 p:840 Triticum aestivum cDN... 50 4e-004
gb|BQ743722.1|BQ743722 WHE4107_D05_H09ZS Wheat salt-stresse... 50 4e-004
gb|BQ743794.1|BQ743794 WHE4108_C02_F04ZS Wheat salt-stresse... 50 4e-004
gb|BQ838438.1|BQ838438 WHE2910_D10_G20ZS Wheat aluminum-str... 50 4e-004
gb|CA602304.1|CA602304 wr1.pk0017.a12 wr1 Triticum aestivum... 50 4e-004
gb|CA606042.1|CA606042 wr1.pk0058.f2 wr1 Triticum aestivum ... 50 4e-004
gb|CA611568.1|CA611568 wr1.pk0131.a3 wr1 Triticum aestivum ... 50 4e-004
gb|CA617124.1|CA617124 wl1n.pk0002.h5 wl1n Triticum aestivu... 50 4e-004
gb|CA629952.1|CA629952 wle1n.pk0010.h10 wle1n Triticum aest... 50 4e-004
gb|CA641707.1|CA641707 wre1n.pk0049.a4 wre1n Triticum aesti... 50 4e-004
gb|CA643867.1|CA643867 wre1n.pk0077.b6 wre1n Triticum aesti... 50 4e-004
gb|CA701366.1|CA701366 wkm2c.pk005.c16 wkm2c Triticum aesti... 50 4e-004
gb|CA716348.1|CA716348 wdk3c.pk024.p2 wdk3c Triticum aestiv... 50 4e-004
gb|CD869431.1|CD869431 AZO2.111K07F001115 AZO2 Triticum aes... 50 4e-004
gb|CD869432.1|CD869432 AZO2.111K07R010402 AZO2 Triticum aes... 50 4e-004
gb|CD873364.1|CD873364 AZO2.122P23R010405 AZO2 Triticum aes... 50 4e-004
gb|CK162170.1|CK162170 FGAS014756 Triticum aestivum FGAS: L... 50 4e-004
gb|CK162342.1|CK162342 FGAS014934 Triticum aestivum FGAS: L... 50 4e-004
gb|CK162629.1|CK162629 FGAS015227 Triticum aestivum FGAS: L... 50 4e-004
gb|CK195411.1|CK195411 FGAS003850 Triticum aestivum FGAS: L... 50 4e-004
gb|CK195608.1|CK195608 FGAS004048 Triticum aestivum FGAS: L... 50 4e-004
gb|CK195922.1|CK195922 FGAS004368 Triticum aestivum FGAS: L... 50 4e-004
gb|CK198514.1|CK198514 FGAS007000 Triticum aestivum FGAS: L... 50 4e-004
gb|CK202173.1|CK202173 FGAS010695 Triticum aestivum FGAS: L... 50 4e-004
gb|CK217190.1|CK217190 FGAS029191 Triticum aestivum FGAS: L... 50 4e-004
gb|CK217759.1|CK217759 FGAS029761 Triticum aestivum FGAS: L... 50 4e-004
gb|AJ609806.1|AJ609806 AJ609806 Triticum turgidum subsp. du... 50 4e-004
gb|AJ611999.1|AJ611999 AJ611999 Triticum turgidum subsp. du... 50 4e-004
gb|CV762835.1|CV762835 FGAS057224 Triticum aestivum FGAS: L... 50 4e-004
gb|CV765902.1|CV765902 FGAS060289 Triticum aestivum FGAS: L... 50 4e-004
gb|CV768188.1|CV768188 FGAS062579 Triticum aestivum FGAS: L... 50 4e-004
gb|CV768314.1|CV768314 FGAS062705 Triticum aestivum FGAS: L... 50 4e-004
gb|CV770799.1|CV770799 FGAS065192 Triticum aestivum FGAS: L... 50 4e-004
gb|CV771830.1|CV771830 FGAS066223 Triticum aestivum FGAS: L... 50 4e-004
gb|CV774959.1|CV774959 FGAS069359 Triticum aestivum FGAS: L... 50 4e-004
gb|CV775548.1|CV775548 FGAS069952 Triticum aestivum FGAS: L... 50 4e-004
gb|CV779003.1|CV779003 FGAS073412 Triticum aestivum FGAS: L... 50 4e-004
gb|CV780123.1|CV780123 FGAS074532 Triticum aestivum FGAS: L... 50 4e-004
gb|CV781650.1|CV781650 FGAS076062 Triticum aestivum FGAS: L... 50 4e-004
gb|CV781742.1|CV781742 FGAS076155 Triticum aestivum FGAS: L... 50 4e-004
gb|DR737665.1|DR737665 FGAS082883 Triticum aestivum FGAS: L... 50 4e-004
gb|DR741241.1|DR741241 FGAS001172 Triticum aestivum FGAS: L... 50 4e-004
gb|BE406804.1|BE406804 WHE0432_c02_f04zS Wheat etiolated se... 48 0.002
gb|BF473486.1|BF473486 WHE0929_A01_A01ZS Wheat 5-15 DAP spi... 48 0.002
gb|BG607837.1|BG607837 WHE2473_A10_B19ZS Triticum monococcu... 48 0.002
gb|BI480526.1|BI480526 WHE2904_D01_H02ZS Wheat aluminum-str... 48 0.002
gb|BM134805.1|BM134805 WHE0453_H06_H06ZS Wheat Fusarium gra... 48 0.002
gb|BM136085.1|BM136085 WHE2602_E02_I04ZS Wheat Fusarium gra... 48 0.002
gb|BJ247443.1|BJ247443 BJ247443 Y. Ogihara unpublished cDNA... 48 0.002
gb|BJ247926.1|BJ247926 BJ247926 Y. Ogihara unpublished cDNA... 48 0.002
gb|BQ294854.1|BQ294854 WHE2855_B09_C17ZS Wheat unstressed r... 48 0.002
gb|AL825826.1|AL825826 AL825826 p:234 Triticum aestivum cDN... 48 0.002
gb|BQ743961.1|BQ743961 WHE4110_B10_C20ZS Wheat salt-stresse... 48 0.002
gb|BQ744526.1|BQ744526 WHE4116_F04_L08ZS Wheat salt-stresse... 48 0.002
gb|BQ838203.1|BQ838203 WHE2907_G03_N05ZS Wheat aluminum-str... 48 0.002
gb|CA608996.1|CA608996 wr1.pk0100.b12 wr1 Triticum aestivum... 48 0.002
gb|CA613283.1|CA613283 wr1.pk0155.f10 wr1 Triticum aestivum... 48 0.002
gb|CA620985.1|CA620985 wl1n.pk0070.h12 wl1n Triticum aestiv... 48 0.002
gb|CA625960.1|CA625960 wl1n.pk0144.c8 wl1n Triticum aestivu... 48 0.002
gb|CA650152.1|CA650152 wre1n.pk0143.e4 wre1n Triticum aesti... 48 0.002
gb|CA659431.1|CA659431 wlm1.pk0004.f7 wlm1 Triticum aestivu... 48 0.002
gb|CA683745.1|CA683745 wlm96.pk0022.b4 wlm96 Triticum aesti... 48 0.002
gb|CA700106.1|CA700106 wkm1c.pk0003.a9 wkm1c Triticum aesti... 48 0.002
gb|CK202234.1|CK202234 FGAS010757 Triticum aestivum FGAS: L... 48 0.002
gb|CK204357.1|CK204357 FGAS012893 Triticum aestivum FGAS: L... 48 0.002
gb|CK204712.1|CK204712 FGAS013248 Triticum aestivum FGAS: L... 48 0.002
gb|CN009343.1|CN009343 WHE3857_F05_L09ZS Wheat Fusarium gra... 48 0.002
gb|CN011783.1|CN011783 WHE3888_G03_M06ZS Wheat Fusarium gra... 48 0.002
gb|CV763493.1|CV763493 FGAS057882 Triticum aestivum FGAS: L... 48 0.002
gb|CV779530.1|CV779530 FGAS073939 Triticum aestivum FGAS: L... 48 0.002
gb|DR432327.1|DR432327 441E-1102 Line 441 epidermal library... 48 0.002
gb|DR741288.1|DR741288 FGAS001218 Triticum aestivum FGAS: L... 48 0.002
emb|CS077191.1| Sequence 4 from Patent WO2005035766 48 0.002
emb|CS077192.1| Sequence 5 from Patent WO2005035766 48 0.002
emb|X56011.1|TAPERO Wheat mRNA for peroxidase 48 0.002
gb|AY857756.1| Triticum monococcum peroxidase 2 (POX2) mRNA... 48 0.002
gb|BH759093.1|BH759093 307 107 Sp6 Mlu1 Targeted Wheat BAC ... 46 0.006
gb|BE403672.1|BE403672 WHE0435_D02_H03ZS Wheat etiolated se... 46 0.006
gb|BE404615.1|BE404615 WHE0445_D03_G05ZS Wheat etiolated se... 46 0.006
gb|BE404885.1|BE404885 WHE1206_D09_G18ZS Wheat etiolated se... 46 0.006
gb|BE419110.1|BE419110 WWR020.B2R000101 ITEC WWR Wheat Root... 46 0.006
gb|BE419113.1|BE419113 WWR020.B6R000101 ITEC WWR Wheat Root... 46 0.006
gb|BG313215.1|BG313215 WHE2051_B11_C21ZS Wheat salt-stresse... 46 0.006
gb|BI480503.1|BI480503 WHE2904_B01_D02ZS Wheat aluminum-str... 46 0.006
gb|BI480561.1|BI480561 WHE2904_G05_N10ZS Wheat aluminum-str... 46 0.006
gb|BI480528.1|BI480528 WHE2904_D04_H08ZS Wheat aluminum-str... 46 0.006
gb|BM138651.1|BM138651 WHE0496_C03_E06ZS Wheat Fusarium gra... 46 0.006
gb|BJ282662.1|BJ282662 BJ282662 Y. Ogihara unpublished cDNA... 46 0.006
gb|BQ483288.1|BQ483288 WHE3506_G06_M12ZS Wheat unstressed r... 46 0.006
gb|BQ483588.1|BQ483588 WHE3510_C11_E22ZS Wheat unstressed r... 46 0.006
gb|BQ619809.1|BQ619809 TaLr1162F11F TaLr1 Triticum aestivum... 46 0.006
gb|BQ620650.1|BQ620650 TaLr1136F08R TaLr1 Triticum aestivum... 46 0.006
gb|AL822214.1|AL822214 AL822214 p:234 Triticum aestivum cDN... 46 0.006
gb|AL827352.1|AL827352 AL827352 p:638 Triticum aestivum cDN... 46 0.006
gb|AL827362.1|AL827362 AL827362 p:638 Triticum aestivum cDN... 46 0.006
gb|AL827487.1|AL827487 AL827487 p:638 Triticum aestivum cDN... 46 0.006
gb|BJ277478.1|BJ277478 BJ277478 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ278265.1|BJ278265 BJ278265 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ278377.1|BJ278377 BJ278377 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ279278.1|BJ279278 BJ279278 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ279520.1|BJ279520 BJ279520 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ280654.1|BJ280654 BJ280654 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ280982.1|BJ280982 BJ280982 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ281595.1|BJ281595 BJ281595 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ282121.1|BJ282121 BJ282121 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ282868.1|BJ282868 BJ282868 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ283317.1|BJ283317 BJ283317 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ283428.1|BJ283428 BJ283428 Y. Ogihara unpublished cDNA... 46 0.006
gb|BJ285676.1|BJ285676 BJ285676 Y. Ogihara unpublished cDNA... 46 0.006
gb|CA602162.1|CA602162 wr1.pk0018.h9 wr1 Triticum aestivum ... 46 0.006
gb|CA604113.1|CA604113 wr1.pk0036.f1 wr1 Triticum aestivum ... 46 0.006
gb|CA606373.1|CA606373 wr1.pk0066.a11 wr1 Triticum aestivum... 46 0.006
gb|CA606425.1|CA606425 wr1.pk0065.e12 wr1 Triticum aestivum... 46 0.006
gb|CA608053.1|CA608053 wr1.pk0086.c12 wr1 Triticum aestivum... 46 0.006
gb|CA608284.1|CA608284 wr1.pk0089.g9 wr1 Triticum aestivum ... 46 0.006
gb|CA610960.1|CA610960 wr1.pk0125.c5 wr1 Triticum aestivum ... 46 0.006
gb|CA611389.1|CA611389 wr1.pk0126.e11 wr1 Triticum aestivum... 46 0.006
gb|CA611519.1|CA611519 wr1.pk0127.g8 wr1 Triticum aestivum ... 46 0.006
gb|CA611926.1|CA611926 wr1.pk0133.b7 wr1 Triticum aestivum ... 46 0.006
gb|CA614307.1|CA614307 wr1.pk0159.f11 wr1 Triticum aestivum... 46 0.006
gb|CA624428.1|CA624428 wl1n.pk0119.c8 wl1n Triticum aestivu... 46 0.006
gb|CA639365.1|CA639365 wre1n.pk0021.a5 wre1n Triticum aesti... 46 0.006
gb|CA639452.1|CA639452 wre1n.pk0014.h1 wre1n Triticum aesti... 46 0.006
gb|CA643455.1|CA643455 wre1n.pk0065.g8 wre1n Triticum aesti... 46 0.006
gb|CA644634.1|CA644634 wre1n.pk0084.c5 wre1n Triticum aesti... 46 0.006
gb|CA644962.1|CA644962 wre1n.pk0085.e8 wre1n Triticum aesti... 46 0.006
gb|CA647971.1|CA647971 wre1n.pk0126.d12 wre1n Triticum aest... 46 0.006
gb|CA648241.1|CA648241 wre1n.pk0132.f4 wre1n Triticum aesti... 46 0.006
gb|CA652416.1|CA652416 wre1n.pk157.g7 wre1n Triticum aestiv... 46 0.006
gb|CA686105.1|CA686105 wlm96.pk032.p18 wlm96 Triticum aesti... 46 0.006
gb|CD869779.1|CD869779 AZO2.112J10F001117 AZO2 Triticum aes... 46 0.006
gb|CD870291.1|CD870291 AZO2.113P11R010522 AZO2 Triticum aes... 46 0.006
gb|CD871735.1|CD871735 AZO2.118P02F010207 AZO2 Triticum aes... 46 0.006
gb|CD871923.1|CD871923 AZO2.119G09R010403 AZO2 Triticum aes... 46 0.006
gb|CD878786.1|CD878786 AZO4.103K01R011126 AZO4 Triticum aes... 46 0.006
gb|CD920040.1|CD920040 G608.115J23F010912 G608 Triticum aes... 46 0.006
gb|AJ601643.1|AJ601643 AJ601643 T05 Triticum aestivum cDNA ... 46 0.006
gb|CK163544.1|CK163544 FGAS016173 Triticum aestivum FGAS: L... 46 0.006
gb|CK193899.1|CK193899 FGAS002318 Triticum aestivum FGAS: L... 46 0.006
gb|CK194076.1|CK194076 FGAS002495 Triticum aestivum FGAS: L... 46 0.006
gb|CK197913.1|CK197913 FGAS006393 Triticum aestivum FGAS: L... 46 0.006
gb|CK198503.1|CK198503 FGAS006989 Triticum aestivum FGAS: L... 46 0.006
gb|CK199165.1|CK199165 FGAS007659 Triticum aestivum FGAS: L... 46 0.006
gb|CK200252.1|CK200252 FGAS008761 Triticum aestivum FGAS: L... 46 0.006
gb|CK200702.1|CK200702 FGAS009218 Triticum aestivum FGAS: L... 46 0.006
gb|CK203294.1|CK203294 FGAS011821 Triticum aestivum FGAS: L... 46 0.006
gb|CK203642.1|CK203642 FGAS012174 Triticum aestivum FGAS: L... 46 0.006
gb|CK208921.1|CK208921 FGAS020646 Triticum aestivum FGAS: L... 46 0.006
gb|AJ611827.1|AJ611827 AJ611827 Triticum turgidum subsp. du... 46 0.006
gb|CN008239.1|CN008239 WHE2638_H10_O20ZE Wheat Fusarium gra... 46 0.006
gb|CN008667.1|CN008667 WHE2643_G05_N09ZE Wheat Fusarium gra... 46 0.006
gb|CN011989.1|CN011989 WHE3891_C08_E15ZS Wheat Fusarium gra... 46 0.006
gb|CN012125.1|CN012125 WHE3892_G10_M20ZS Wheat Fusarium gra... 46 0.006
gb|CN012356.1|CN012356 WHE3895_G04_M07ZS Wheat Fusarium gra... 46 0.006
gb|CN012399.1|CN012399 WHE3896_B12_C24ZS Wheat Fusarium gra... 46 0.006
gb|CV764309.1|CV764309 FGAS058694 Triticum aestivum FGAS: L... 46 0.006
gb|CV772027.1|CV772027 FGAS066420 Triticum aestivum FGAS: L... 46 0.006
gb|CV776855.1|CV776855 FGAS071259 Triticum aestivum FGAS: L... 46 0.006
gb|CV777896.1|CV777896 FGAS072303 Triticum aestivum FGAS: L... 46 0.006
gb|CV779349.1|CV779349 FGAS073758 Triticum aestivum FGAS: L... 46 0.006
gb|DN829264.1|DN829264 KUCD01_03_F05_T3 WSWR cDNA library T... 46 0.006
gb|DR432277.1|DR432277 441E-399 Line 441 epidermal library ... 46 0.006
gb|DR432306.1|DR432306 441E-962 Line 441 epidermal library ... 46 0.006
gb|DR733281.1|DR733281 FGAS079041 Triticum aestivum FGAS: L... 46 0.006
gb|DR733406.1|DR733406 FGAS079164 Triticum aestivum FGAS: L... 46 0.006
gb|DR738418.1|DR738418 FGAS083635 Triticum aestivum FGAS: L... 46 0.006
gb|AF387866.1| Triticum aestivum peroxidase (pxc1A) gene, p... 46 0.006
gb|AY506484.1| Triticum aestivum PXCW2-like gene, complete ... 46 0.006
gb|AY506485.1| Triticum aestivum PXCW3-like gene, complete ... 46 0.006
gb|AY506486.1| Triticum aestivum PXCW4-like gene, complete ... 46 0.006
gb|AY506487.1| Triticum aestivum PXA1-like gene, complete s... 46 0.006
gb|AY506488.1| Triticum aestivum PXA2-like gene, complete s... 46 0.006
gb|AY506489.1| Triticum aestivum PXB1-like gene, complete s... 46 0.006
gb|AY506490.1| Triticum aestivum PXB2-like gene, partial se... 46 0.006
gb|AY506491.1| Triticum aestivum PXB3-like gene, complete s... 46 0.006
gb|AY506492.1| Triticum aestivum PXB4-like gene, complete s... 46 0.006
gb|AY506493.1| Triticum aestivum PXB5-like gene, complete s... 46 0.006
gb|AY506494.1| Triticum aestivum PXC1-like gene, complete s... 46 0.006
emb|X85228.1|TAPOX2 T.aestivum pox2 gene 46 0.006
emb|X53675.1|TAPEROXIG Wheat (T. aesitvum) mRNA for peroxid... 46 0.006
gb|AY857757.1| Triticum monococcum peroxidase 3 (POX3) mRNA... 46 0.006
gb|AY857761.1| Triticum monococcum peroxidase 7 (POX7) mRNA... 46 0.006
gb|BE444717.1|BE444717 WHE1137_F03_K05ZS Wheat etiolated se... 44 0.024
gb|BF482263.1|BF482263 WHE1798_F09_L18ZS Wheat pre-anthesis... 44 0.024
gb|BJ278715.1|BJ278715 BJ278715 Y. Ogihara unpublished cDNA... 44 0.024
gb|BQ744185.1|BQ744185 WHE4112_F07_L14ZS Wheat salt-stresse... 44 0.024
gb|BQ838524.1|BQ838524 WHE2911_E04_J07ZS Wheat aluminum-str... 44 0.024
gb|BU100613.1|BU100613 WHE3355_E02_I03ZS Chinese Spring alu... 44 0.024
gb|CA483833.1|CA483833 WHE3205_H03_O05ZS Wheat meiotic anth... 44 0.024
gb|CA497360.1|CA497360 WHE3226_E06_I12ZT Wheat meiotic anth... 44 0.024
gb|CA500752.1|CA500752 WHE4024_B12_D24ZT Wheat meiotic anth... 44 0.024
gb|CA501647.1|CA501647 WHE4037_A02_A03ZT Wheat meiotic anth... 44 0.024
gb|CA502398.1|CA502398 WHE4047_A06_B11ZT Wheat meiotic anth... 44 0.024
gb|CA602113.1|CA602113 wr1.pk0015.h12 wr1 Triticum aestivum... 44 0.024
gb|CA609753.1|CA609753 wr1.pk0110.c6 wr1 Triticum aestivum ... 44 0.024
gb|CD870861.1|CD870861 AZO2.115M08F010117 AZO2 Triticum aes... 44 0.024
gb|CD879600.1|CD879600 AZO4.105M10R011123 AZO4 Triticum aes... 44 0.024
gb|CD925934.1|CD925934 G750.119F08F010711 G750 Triticum aes... 44 0.024
gb|CK199840.1|CK199840 FGAS008347 Triticum aestivum FGAS: L... 44 0.024
gb|CK201676.1|CK201676 FGAS010196 Triticum aestivum FGAS: L... 44 0.024
gb|CK202027.1|CK202027 FGAS010548 Triticum aestivum FGAS: L... 44 0.024
gb|CK202562.1|CK202562 FGAS011087 Triticum aestivum FGAS: L... 44 0.024
gb|CK202833.1|CK202833 FGAS011359 Triticum aestivum FGAS: L... 44 0.024
gb|CK203339.1|CK203339 FGAS011867 Triticum aestivum FGAS: L... 44 0.024
gb|CK203844.1|CK203844 FGAS012377 Triticum aestivum FGAS: L... 44 0.024
gb|CK204718.1|CK204718 FGAS013254 Triticum aestivum FGAS: L... 44 0.024
gb|CK205061.1|CK205061 FGAS013598 Triticum aestivum FGAS: L... 44 0.024
gb|CK205068.1|CK205068 FGAS013605 Triticum aestivum FGAS: L... 44 0.024
gb|CK207483.1|CK207483 FGAS019107 Triticum aestivum FGAS: L... 44 0.024
gb|DR739681.1|DR739681 FGAS084898 Triticum aestivum FGAS: L... 44 0.024
gb|BE401990.1|BE401990 CSB003C08F990908 ITEC CSB Wheat Endo... 42 0.097
gb|BE402692.1|BE402692 CSB010F02F990908 ITEC CSB Wheat Endo... 42 0.097
gb|BE419362.1|BE419362 WWS01.B5R000101 ITEC WWS Wheat Scute... 42 0.097
gb|BE422705.1|BE422705 WHE0058_G07_N14ZS Wheat endosperm cD... 42 0.097
gb|BE422820.1|BE422820 WHE0014_D11_D11ZS Wheat endosperm cD... 42 0.097
gb|BE428812.1|BE428812 MTD011.B03F990617 ITEC MTD Durum Whe... 42 0.097
gb|BE442535.1|BE442535 WHE1103_F11_L20ZS Wheat etiolated se... 42 0.097
gb|BE443293.1|BE443293 WHE1112_H06_P12ZS Wheat etiolated se... 42 0.097
gb|BE446565.1|BE446565 WHE1458_H02_P04ZS Wheat etiolated se... 42 0.097
gb|BE499324.1|BE499324 WHE0973_G03_N05ZS Wheat pre-anthesis... 42 0.097
gb|BE585838.1|BE585838 Est#3T7_A08_a8_053 KSU wheat Fusariu... 42 0.097
gb|BF482471.1|BF482471 WHE1795_A05_A09ZS Wheat pre-anthesis... 42 0.097
gb|BF484664.1|BF484664 WHE2318_C04_E08ZS Wheat pre-anthesis... 42 0.097
gb|BI480394.1|BI480394 WHE2902_F02_K04ZS Wheat aluminum-str... 42 0.097
gb|BM134665.1|BM134665 WHE0451_F10_F10ZS Wheat Fusarium gra... 42 0.097
gb|BM134673.1|BM134673 WHE0451_G06_G06ZS Wheat Fusarium gra... 42 0.097
gb|BM135078.1|BM135078 WHE0459_F06_F06ZS Wheat Fusarium gra... 42 0.097
gb|BJ279004.1|BJ279004 BJ279004 Y. Ogihara unpublished cDNA... 42 0.097
gb|BJ280134.1|BJ280134 BJ280134 Y. Ogihara unpublished cDNA... 42 0.097
gb|BJ280346.1|BJ280346 BJ280346 Y. Ogihara unpublished cDNA... 42 0.097
gb|BJ280651.1|BJ280651 BJ280651 Y. Ogihara unpublished cDNA... 42 0.097
gb|BJ283578.1|BJ283578 BJ283578 Y. Ogihara unpublished cDNA... 42 0.097
gb|BJ284058.1|BJ284058 BJ284058 Y. Ogihara unpublished cDNA... 42 0.097
gb|BJ285679.1|BJ285679 BJ285679 Y. Ogihara unpublished cDNA... 42 0.097
gb|BQ245725.1|BQ245725 TaE15020H10R TaE15 Triticum aestivum... 42 0.097
gb|BQ245750.1|BQ245750 TaE15020F09R TaE15 Triticum aestivum... 42 0.097
gb|BQ483094.1|BQ483094 WHE0492_G06_M12ZY Wheat Fusarium gra... 42 0.097
gb|BQ483524.1|BQ483524 WHE3509_F07_K13ZS Wheat unstressed r... 42 0.097
gb|BQ607407.1|BQ607407 BRY_3301 wheat EST endosperm library... 42 0.097
gb|BQ608266.1|BQ608266 BRY_4170 wheat EST endosperm library... 42 0.097
gb|AL821356.1|AL821356 AL821356 p:133 Triticum aestivum cDN... 42 0.097
gb|AL821357.1|AL821357 AL821357 p:133 Triticum aestivum cDN... 42 0.097
gb|AL826411.1|AL826411 AL826411 p:537 Triticum aestivum cDN... 42 0.097
gb|BQ744035.1|BQ744035 WHE4111_A06_B11ZS Wheat salt-stresse... 42 0.097
gb|BQ789447.1|BQ789447 WHE4161_E02_J03ZS Wheat CS whole pla... 42 0.097
gb|BQ805735.1|BQ805735 WHE3570_D09_H18ZS Wheat developing g... 42 0.097
gb|BQ838630.1|BQ838630 WHE2912_H03_P06ZS Wheat aluminum-str... 42 0.097
gb|BQ839379.1|BQ839379 WHE4165_D11_H21ZS Wheat CS whole pla... 42 0.097
gb|BJ285730.1|BJ285730 BJ285730 Y. Ogihara unpublished cDNA... 42 0.097
gb|BJ286680.1|BJ286680 BJ286680 Y. Ogihara unpublished cDNA... 42 0.097
gb|CA497579.1|CA497579 WHE3229_G03_M05ZT Wheat meiotic anth... 42 0.097
gb|CA499768.1|CA499768 WHE4011_D02_H03ZT Wheat meiotic anth... 42 0.097
gb|CA501677.1|CA501677 WHE4037_D03_G05ZT Wheat meiotic anth... 42 0.097
gb|CA502451.1|CA502451 WHE4047_F07_L13ZT Wheat meiotic anth... 42 0.097
gb|CA502454.1|CA502454 WHE4047_F11_L20ZT Wheat meiotic anth... 42 0.097
gb|CA593883.1|CA593883 wpa1c.pk002.k8 wpa1c Triticum aestiv... 42 0.097
gb|CA595547.1|CA595547 wpa1c.pk010.b15 wpa1c Triticum aesti... 42 0.097
gb|CA599437.1|CA599437 waw1c.pk002.c22 waw1c Triticum aesti... 42 0.097
gb|CA599849.1|CA599849 waw1c.pk004.d21 waw1c Triticum aesti... 42 0.097
gb|CA599977.1|CA599977 waw1c.pk004.g12 waw1c Triticum aesti... 42 0.097
gb|CA600140.1|CA600140 waw1c.pk006.i23 waw1c Triticum aesti... 42 0.097
gb|CA600356.1|CA600356 waw1c.pk006.h6 waw1c Triticum aestiv... 42 0.097
gb|CA602163.1|CA602163 wr1.pk0018.h10 wr1 Triticum aestivum... 42 0.097
gb|CA602181.1|CA602181 wr1.pk0018.d5 wr1 Triticum aestivum ... 42 0.097
gb|CA603243.1|CA603243 wr1.pk0026.b3 wr1 Triticum aestivum ... 42 0.097
gb|CA607294.1|CA607294 wr1.pk0076.e4 wr1 Triticum aestivum ... 42 0.097
gb|CA609033.1|CA609033 wr1.pk0101.d1 wr1 Triticum aestivum ... 42 0.097
gb|CA617065.1|CA617065 wl1n.pk0011.e5 wl1n Triticum aestivu... 42 0.097
gb|CA617242.1|CA617242 wl1n.pk0014.f7 wl1n Triticum aestivu... 42 0.097
gb|CA627049.1|CA627049 wl1n.pk151.a4 wl1n Triticum aestivum... 42 0.097
gb|CA644406.1|CA644406 wre1n.pk0069.e4 wre1n Triticum aesti... 42 0.097
gb|CA644569.1|CA644569 wre1n.pk0084.d7 wre1n Triticum aesti... 42 0.097
gb|CA648176.1|CA648176 wre1n.pk0124.c9 wre1n Triticum aesti... 42 0.097
gb|CA648995.1|CA648995 wre1n.pk0136.a4 wre1n Triticum aesti... 42 0.097
gb|CA649340.1|CA649340 wre1n.pk0141.d1 wre1n Triticum aesti... 42 0.097
gb|CA659232.1|CA659232 wlm1.pk0001.g10 wlm1 Triticum aestiv... 42 0.097
gb|CA662139.1|CA662139 wlmk1.pk0015.c3 wlmk1 Triticum aesti... 42 0.097
gb|CA662401.1|CA662401 wlmk1.pk0019.c1 wlmk1 Triticum aesti... 42 0.097
gb|CA678411.1|CA678411 wlm12.pk0025.b10 wlm12 Triticum aest... 42 0.097
gb|CA685752.1|CA685752 wlm96.pk030.i16 wlm96 Triticum aesti... 42 0.097
gb|CA691383.1|CA691383 wlm96.pk050.b12 wlm96 Triticum aesti... 42 0.097
gb|CA697416.1|CA697416 wlk4.pk0018.g9 wlk4 Triticum aestivu... 42 0.097
gb|CA703181.1|CA703181 wdk1c.pk009.j17 wdk1c Triticum aesti... 42 0.097
gb|CA703810.1|CA703810 wdk1c.pk009.g18 wdk1c Triticum aesti... 42 0.097
gb|CA738576.1|CA738576 wpi2s.pk008.k6 wpi2s Triticum aestiv... 42 0.097
gb|CA743279.1|CA743279 wri1s.pk002.o18 wri1s Triticum aesti... 42 0.097
gb|CA743346.1|CA743346 wri1s.pk005.c13 wri1s Triticum aesti... 42 0.097
gb|CA743535.1|CA743535 wri1s.pk003.h5 wri1s Triticum aestiv... 42 0.097
gb|CA745655.1|CA745655 wri2s.pk002.k5 wri2s Triticum aestiv... 42 0.097
gb|CA745749.1|CA745749 wri2s.pk002.j14 wri2s Triticum aesti... 42 0.097
gb|CA746070.1|CA746070 wri2s.pk003.m4 wri2s Triticum aestiv... 42 0.097
gb|CA746762.1|CA746762 wri2s.pk004.p6 wri2s Triticum aestiv... 42 0.097
gb|CD490639.1|CD490639 WHE3001_F01_K01ZT Wheat etiolated se... 42 0.097
gb|CD865557.1|CD865557 AZO2.101D08F001107 AZO2 Triticum aes... 42 0.097
gb|CD873278.1|CD873278 AZO2.122M13F010208 AZO2 Triticum aes... 42 0.097
gb|CD873363.1|CD873363 AZO2.122P23F010213 AZO2 Triticum aes... 42 0.097
gb|CD878153.1|CD878153 AZO4.102A17F010930 AZO4 Triticum aes... 42 0.097
gb|CD879876.1|CD879876 AZO4.106J23F011012 AZO4 Triticum aes... 42 0.097
gb|CD879970.1|CD879970 AZO4.106O17F011012 AZO4 Triticum aes... 42 0.097
gb|CD881245.1|CD881245 F1.102G23F010328 F1 Triticum aestivu... 42 0.097
gb|CD884602.1|CD884602 F1.117C15R010702 F1 Triticum aestivu... 42 0.097
gb|CD890713.1|CD890713 G118.115E08F010718 G118 Triticum aes... 42 0.097
gb|CD931834.1|CD931834 GR45.115L15F010420 GR45 Triticum aes... 42 0.097
gb|CF132887.1|CF132887 WHE4351_E03_I05ZT Wheat meiotic flor... 42 0.097
gb|CF133028.1|CF133028 WHE4353_B11_D21ZT Wheat meiotic flor... 42 0.097
gb|CK162886.1|CK162886 FGAS015490 Triticum aestivum FGAS: L... 42 0.097
gb|CK163929.1|CK163929 FGAS016568 Triticum aestivum FGAS: L... 42 0.097
gb|CK193565.1|CK193565 FGAS001979 Triticum aestivum FGAS: L... 42 0.097
gb|CK194083.1|CK194083 FGAS002502 Triticum aestivum FGAS: L... 42 0.097
gb|CK195249.1|CK195249 FGAS003688 Triticum aestivum FGAS: L... 42 0.097
gb|CK196721.1|CK196721 FGAS005181 Triticum aestivum FGAS: L... 42 0.097
gb|CK197705.1|CK197705 FGAS006185 Triticum aestivum FGAS: L... 42 0.097
gb|CK198051.1|CK198051 FGAS006532 Triticum aestivum FGAS: L... 42 0.097
gb|CK200457.1|CK200457 FGAS008971 Triticum aestivum FGAS: L... 42 0.097
gb|CK201134.1|CK201134 FGAS009653 Triticum aestivum FGAS: L... 42 0.097
gb|CK202715.1|CK202715 FGAS011240 Triticum aestivum FGAS: L... 42 0.097
gb|CK202748.1|CK202748 FGAS011273 Triticum aestivum FGAS: L... 42 0.097
gb|CK203030.1|CK203030 FGAS011556 Triticum aestivum FGAS: L... 42 0.097
gb|CK203066.1|CK203066 FGAS011592 Triticum aestivum FGAS: L... 42 0.097
gb|CK209678.1|CK209678 FGAS021454 Triticum aestivum FGAS: L... 42 0.097
gb|CK209779.1|CK209779 FGAS021562 Triticum aestivum FGAS: L... 42 0.097
gb|CK209783.1|CK209783 FGAS021566 Triticum aestivum FGAS: L... 42 0.097
gb|AL812936.1|AL812936 AL812936 e:411 Triticum aestivum cDN... 42 0.097
gb|CV763406.1|CV763406 FGAS057795 Triticum aestivum FGAS: L... 42 0.097
gb|CV765705.1|CV765705 FGAS060092 Triticum aestivum FGAS: L... 42 0.097
gb|CV765753.1|CV765753 FGAS060140 Triticum aestivum FGAS: L... 42 0.097
gb|CV778806.1|CV778806 FGAS073215 Triticum aestivum FGAS: L... 42 0.097
gb|DN829695.1|DN829695 KUCD01_11_A12_T3 WSWR cDNA library T... 42 0.097
gb|DR432298.1|DR432298 441E-620 Line 441 epidermal library ... 42 0.097
gb|DR432337.1|DR432337 441E-S15 Line 441 epidermal library ... 42 0.097
gb|DR735385.1|DR735385 FGAS081055 Triticum aestivum FGAS: L... 42 0.097
gb|DR738814.1|DR738814 FGAS084031 Triticum aestivum FGAS: L... 42 0.097
gb|DR739388.1|DR739388 FGAS084605 Triticum aestivum FGAS: L... 42 0.097
emb|AX756291.1| Sequence 1030 from Patent WO03000905 42 0.097
emb|X85230.1|TAPOX4 T.aestivum pox4 gene 42 0.097
gb|AY857760.1| Triticum monococcum peroxidase 6 (POX6) mRNA... 42 0.097
gb|AY857764.1| Triticum monococcum peroxidase 10 (POX10) mR... 42 0.097
gb|BE404079.1|BE404079 WHE1201_B03_C05ZS Wheat etiolated se... 40 0.38
gb|BE405890.1|BE405890 WHE0401_d08_d08zB Wheat etiolated se... 40 0.38
gb|BE425404.1|BE425404 WHE315_A08_A08ZS Wheat unstressed se... 40 0.38
gb|BE426315.1|BE426315 WHE0330_C04_E08ZS Wheat unstressed s... 40 0.38
gb|BE426819.1|BE426819 WHE0332_A11_B22ZS Wheat unstressed s... 40 0.38
gb|BE490405.1|BE490405 WHE0367_G09_M17ZS Wheat cold-stresse... 40 0.38
gb|BE490669.1|BE490669 WHE0369_G12_N23ZS Wheat cold-stresse... 40 0.38
gb|BE585499.1|BE585499 EST#6PT7_C04_c4_022 KSU wheat Fusari... 40 0.38
gb|BE585558.1|BE585558 EST-426samp_F08_6F12t7_062 KSU wheat... 40 0.38
gb|BE586060.1|BE586060 Est#8pT7_D03_d3_026 KSU wheat Fusari... 40 0.38
gb|BF201816.1|BF201816 WHE1759-1762_B05_B05ZS Wheat pre-ant... 40 0.38
gb|BF483926.1|BF483926 WHE2306_D04_G08ZS Wheat pre-anthesis... 40 0.38
gb|BG313616.1|BG313616 WHE2056_D06_G12ZS Wheat salt-stresse... 40 0.38
gb|BM137448.1|BM137448 WHE0475_C01_E01ZS Wheat Fusarium gra... 40 0.38
gb|BM138612.1|BM138612 WHE0494_G05_N10ZS Wheat Fusarium gra... 40 0.38
gb|BJ236593.1|BJ236593 BJ236593 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ278876.1|BJ278876 BJ278876 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ278880.1|BJ278880 BJ278880 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ280598.1|BJ280598 BJ280598 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ281292.1|BJ281292 BJ281292 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ282097.1|BJ282097 BJ282097 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ284818.1|BJ284818 BJ284818 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ285673.1|BJ285673 BJ285673 Y. Ogihara unpublished cDNA... 40 0.38
gb|BJ321306.1|BJ321306 BJ321306 Y. Ogihara unpublished cDNA... 40 0.38
gb|BQ295279.1|BQ295279 WHE2868_B11_C22ZS Wheat unstressed r... 40 0.38
gb|BQ483191.1|BQ483191 WHE3505_F07_K13ZS Wheat unstressed r... 40 0.38
gb|BQ578644.1|BQ578644 WHE0308_A08_B16ZS Wheat unstressed s... 40 0.38
gb|AL819313.1|AL819313 AL819313 n:129 Triticum aestivum cDN... 40 0.38
gb|AL819950.1|AL819950 AL819950 N:130 Triticum aestivum cDN... 40 0.38
gb|AL822731.1|AL822731 AL822731 p:335 Triticum aestivum cDN... 40 0.38
gb|AL822883.1|AL822883 AL822883 p:335 Triticum aestivum cDN... 40 0.38
gb|AL816999.1|AL816999 AL816999 j:324 Triticum aestivum cDN... 40 0.38
gb|AL825171.1|AL825171 AL825171 p:335 Triticum aestivum cDN... 40 0.38
gb|AL825724.1|AL825724 AL825724 p:234 Triticum aestivum cDN... 40 0.38
gb|AL826597.1|AL826597 AL826597 p:537 Triticum aestivum cDN... 40 0.38
gb|AL827190.1|AL827190 AL827190 p:638 Triticum aestivum cDN... 40 0.38
gb|AL828192.1|AL828192 AL828192 p:436 Triticum aestivum cDN... 40 0.38
gb|AL828347.1|AL828347 AL828347 p:436 Triticum aestivum cDN... 40 0.38
gb|AL828374.1|AL828374 AL828374 p:436 Triticum aestivum cDN... 40 0.38
gb|AL829539.1|AL829539 AL829539 p:840 Triticum aestivum cDN... 40 0.38
gb|BQ743210.1|BQ743210 WHE4101_D08_G15ZS Wheat salt-stresse... 40 0.38
gb|BQ752696.1|BQ752696 WHE4118_B01_C02ZS Wheat salt-stresse... 40 0.38
gb|BQ752865.1|BQ752865 WHE4120_A07_B14ZS Wheat salt-stresse... 40 0.38
>gb|CV775074.1|CV775074 FGAS069475 Triticum aestivum FGAS: Library 2 Gate 3 Triticum aestivum
cDNA, mRNA sequence
Length = 816
Score = 299 bits (151), Expect = 3e-079
Identities = 226/251 (90%)
Strand = Plus / Plus
Query: 759 tcatggacctcatcacgccggaaaggtttgacaacaagtaatacgtcggcctgaccaaca 818
||||||||||||||||||||| ||||| ||||||||||| ||||| || ||| ||||||
Sbjct: 123 tcatggacctcatcacgccggcgaggttcgacaacaagtactacgtggggctggccaaca 182
Query: 819 acctgggcctcttcaagtcagacgtggcgctgctgaccaacgcgacgatgaaggccctgg 878
|||||||||||||| |||| |||| |||||||||||||||||| || |||||| | ||||
Sbjct: 183 acctgggcctcttccagtcggacgcggcgctgctgaccaacgccaccatgaagtcgctgg 242
Query: 879 tcgactccttcgtgcgcagcgaggcgactttcaggaccaagtttgccaggtccatgatca 938
| |||||||||||||||||||||||| | ||| |||||| ||| |||||||||||| |||
Sbjct: 243 tggactccttcgtgcgcagcgaggcggcgttccggaccaggttcgccaggtccatgctca 302
Query: 939 agatggggcagatcgaggtgctgacggggacgcagggcgagatcaggcgcaactgcaggg 998
|||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 303 agatggggcagatcgaggtgctctccggggcgcagggcgagatcaggcgcaactgcaggg 362
Query: 999 tcatcaacccc 1009
|||||||||||
Sbjct: 363 tcatcaacccc 373
>gb|CV776662.1|CV776662 FGAS071066 Triticum aestivum FGAS: Library 2 Gate 3 Triticum aestivum
cDNA, mRNA sequence
Length = 881
Score = 299 bits (151), Expect = 3e-079
Identities = 226/251 (90%)
Strand = Plus / Plus
Query: 759 tcatggacctcatcacgccggaaaggtttgacaacaagtaatacgtcggcctgaccaaca 818
||||||||||||||||||||| ||||| ||||||||||| ||||| || ||| ||||||
Sbjct: 124 tcatggacctcatcacgccggcgaggttcgacaacaagtactacgtggggctggccaaca 183
Query: 819 acctgggcctcttcaagtcagacgtggcgctgctgaccaacgcgacgatgaaggccctgg 878
|||||||||||||| |||| |||| |||||||||||||||||| || |||||| | ||||
Sbjct: 184 acctgggcctcttccagtcggacgcggcgctgctgaccaacgccaccatgaagtcgctgg 243
Query: 879 tcgactccttcgtgcgcagcgaggcgactttcaggaccaagtttgccaggtccatgatca 938
| |||||||||||||||||||||||| | ||| |||||| ||| |||||||||||| |||
Sbjct: 244 tggactccttcgtgcgcagcgaggcggcgttccggaccaggttcgccaggtccatgctca 303
Query: 939 agatggggcagatcgaggtgctgacggggacgcagggcgagatcaggcgcaactgcaggg 998
|||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 304 agatggggcagatcgaggtgctctccggggcgcagggcgagatcaggcgcaactgcaggg 363
Query: 999 tcatcaacccc 1009
|||||||||||
Sbjct: 364 tcatcaacccc 374
>emb|AX660622.1| Sequence 979 from Patent WO03000906
Length = 569
Score = 289 bits (146), Expect = 2e-076
Identities = 224/250 (89%)
Strand = Plus / Plus
Query: 759 tcatggacctcatcacgccggaaaggtttgacaacaagtaatacgtcggcctgaccaaca 818
||||||||||| ||||||||| ||||| ||||||||||| ||||| || ||||||||||
Sbjct: 42 tcatggacctcgtcacgccggcgaggttcgacaacaagtactacgtggggctgaccaaca 101
Query: 819 acctgggcctcttcaagtcagacgtggcgctgctgaccaacgcgacgatgaaggccctgg 878
|||||||||||||| |||| |||| |||||||||||| ||||| || |||||| | ||||
Sbjct: 102 acctgggcctcttccagtcggacgcggcgctgctgacaaacgccaccatgaagtcgctgg 161
Query: 879 tcgactccttcgtgcgcagcgaggcgactttcaggaccaagtttgccaggtccatgatca 938
|||||||||||||||||||||||||| | ||| |||||| ||| |||||||||||| |||
Sbjct: 162 tcgactccttcgtgcgcagcgaggcggcgttccggaccaggttcgccaggtccatgctca 221
Query: 939 agatggggcagatcgaggtgctgacggggacgcagggcgagatcaggcgcaactgcaggg 998
|||||||||||||||||||||| | ||| | ||||||||||||||||||||||||||||
Sbjct: 222 agatggggcagatcgaggtgctctccggggcacagggcgagatcaggcgcaactgcaggg 281
Query: 999 tcatcaaccc 1008
||||||||||
Sbjct: 282 tcatcaaccc 291
>gb|CK205114.1|CK205114 FGAS013651 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 837
Score = 278 bits (140), Expect = 9e-073
Identities = 318/376 (84%), Gaps = 6/376 (1%)
Strand = Plus / Plus
Query: 72 tcgacgtcggcttctacgacaggacatgccccactgccgagaccatcgtgcagcagaccg 131
||||||| ||||||||||||||||| |||| | ||||||||| | |||||||||||||
Sbjct: 230 tcgacgtgggcttctacgacaggaccagcccgtccgccgagaccctggtgcagcagaccg 289
Query: 132 tggcggccgcgttcaggaacaactccggcgtcgctccggcgctgatccgcatgcacttcc 191
|||| ||||| ||| | ||| ||||||||||| ||||||| | |||||| | |||||||
Sbjct: 290 tggccgccgccttcggcaacgactccggcgtccctccggccatcatccgcctccacttcc 349
Query: 192 atgactgctttgtcaggggctgcgatggctcggtgctgatcgac---acggtaggcaacc 248
|||||||||| |||| ||||||||| ||||| |||||||||||| ||| ||||||
Sbjct: 350 atgactgcttcgtcaagggctgcgacggctccgtgctgatcgactcgacgcctggcaac- 408
Query: 249 tgacggcggagaaggacgcgccacccaacaaccccagcctccggttcttcgacgtggtcg 308
| ||||||||||||| || | |||||| |||||||||||| |||||||||||||| |
Sbjct: 409 --aaggcggagaaggactcggcgcccaacttccccagcctccgcttcttcgacgtggtgg 466
Query: 309 accgtgccaaggcgtcactggaggctcagtgccccggcgtggtctcctgcgccgacgtgc 368
|||| ||||||||| | || ||||| |||||||||||||| ||||||||||||||||| |
Sbjct: 467 accgcgccaaggcggccctcgaggcgcagtgccccggcgtcgtctcctgcgccgacgtcc 526
Query: 369 tcgccttcgcggccagggacagcgtcgtgctctccggtggcctcggctaccaggtgccgg 428
||||||||||||| |||||||| ||||||| || || |||||||| ||||||||||| |
Sbjct: 527 tcgccttcgcggcgcgggacagcatcgtgctgtcgggcggcctcgggtaccaggtgcccg 586
Query: 429 gcggacgccgtgacgg 444
||| ||||| |||||
Sbjct: 587 ccgggcgccgggacgg 602
Score = 56.0 bits (28), Expect = 6e-006
Identities = 64/75 (85%), Gaps = 1/75 (1%)
Strand = Plus / Plus
Query: 531 agaacctcactatcgaggacctggtcgtgctctcgggcgcgcacaccatcgg-cgtctcg 589
|||||||||| |||||||| | ||||| ||||||||||| ||| |||||| ||||||
Sbjct: 689 agaacctcaccgtcgaggacatcgtcgtcctctcgggcgcccacnacatcggccgtctcc 748
Query: 590 cactgcagcggcttc 604
||||||||| |||||
Sbjct: 749 cactgcagcagcttc 763
Score = 42.1 bits (21), Expect = 0.097
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 662 gacgggattgacccgacgctgagca 686
|||||||||||||||| ||||||||
Sbjct: 797 gacgggattgacccgaagctgagca 821
>gb|CK204757.1|CK204757 FGAS013293 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 858
Score = 178 bits (90), Expect = 6e-043
Identities = 229/274 (83%), Gaps = 6/274 (2%)
Strand = Plus / Plus
Query: 72 tcgacgtcggcttctacgacaggacatgccccactgccgagaccatcgtgcagcagaccg 131
||||||| ||||||||||||||||| |||| | ||||||||| | |||||||||||||
Sbjct: 228 tcgacgtgggcttctacgacaggaccagcccgtccgccgagaccctggtgcagcagaccg 287
Query: 132 tggcggccgcgttcaggaacaactccggcgtcgctccggcgctgatccgcatgcacttcc 191
|||| ||||| ||| | ||| ||||||||||| ||||||| | |||||| | |||||||
Sbjct: 288 tggccgccgccttcggcaacgactccggcgtccctccggccatcatccgcctccacttcc 347
Query: 192 atgactgctttgtcaggggctgcgatggctcggtgctgatcgac---acggtaggcaacc 248
|||||||||| |||| ||||||||| ||||| |||||||||||| ||| ||||||
Sbjct: 348 atgactgcttcgtcaagggctgcgacggctccgtgctgatcgactcgacgcctggcaac- 406
Query: 249 tgacggcggagaaggacgcgccacccaacaaccccagcctccggttcttcgacgtggtcg 308
| ||||||||||||| || | |||||| |||||||||||| |||||||||||||| |
Sbjct: 407 --aaggcggagaaggactcggcgcccaacttccccagcctccgcttcttcgacgtggtgg 464
Query: 309 accgtgccaaggcgtcactggaggctcagtgccc 342
|||| ||||||||| | || ||||| ||||||||
Sbjct: 465 accgcgccaaggcggccctcgaggcgcagtgccc 498
>gb|CA620984.1|CA620984 wl1n.pk0070.h4 wl1n Triticum aestivum cDNA clone wl1n.pk0070.h4 5'
end, mRNA sequence
Length = 500
Score = 103 bits (52), Expect = 3e-020
Identities = 135/160 (84%), Gaps = 2/160 (1%)
Strand = Plus / Plus
Query: 77 gtcggcttctacgacaggacatgccccactgccgagaccatcgtgcagcagaccgtggcg 136
|||||||||||| || ||||||||| | || ||| || | ||||||||| | |||||
Sbjct: 127 gtcggcttctacagcaagacatgcccgtcggcggagtccctggtgcagcaggcggtggct 186
Query: 137 gccgcgttcaggaacaactccggcgtcgct-ccggcgctgatccgcatgcacttccatga 195
||||| |||| ||||||| |||| |||| ||||| || |||||| |||||||||||||
Sbjct: 187 gccgccttcaagaacaacagcggcatcgccgccggc-ctcatccgcctgcacttccatga 245
Query: 196 ctgctttgtcaggggctgcgatggctcggtgctgatcgac 235
|||||| |||||||||||||| ||||||||||||||||||
Sbjct: 246 ctgcttcgtcaggggctgcgacggctcggtgctgatcgac 285
>gb|CA651174.1|CA651174 wre1n.pk180.e8 wre1n Triticum aestivum cDNA clone wre1n.pk180.e8 5'
end, mRNA sequence
Length = 381
Score = 97.6 bits (49), Expect = 2e-018
Identities = 74/81 (91%), Gaps = 1/81 (1%)
Strand = Plus / Minus
Query: 925 caggtccatgatcaagatggggcagatcgaggtgctgacggggacgcagggcgagatcag 984
|||||||||| |||||||||||||||||||| |||| | ||| | ||||||||||||||
Sbjct: 381 caggtccatgttcaagatggggcagatcgag-tgctctccggggcacagggcgagatcag 323
Query: 985 gcgcaactgcagggtcatcaa 1005
|||||||||||||||||||||
Sbjct: 322 gcgcaactgcagggtcatcaa 302
>gb|BE497768.1|BE497768 WHE0956_D11_G22ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0956_D11_G22, mRNA sequence
Length = 481
Score = 85.7 bits (43), Expect = 7e-015
Identities = 55/59 (93%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcgt 396
||||| ||||| |||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 399 tgcccgggcgtcgtctcctgcgccgacgtgctcgccatcgccgccagggacagcgtcgt 457
>gb|BM136154.1|BM136154 WHE2605_F12_K23ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE2605_F12_K23,
mRNA sequence
Length = 485
Score = 85.7 bits (43), Expect = 7e-015
Identities = 55/59 (93%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcgt 396
||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||||||
Sbjct: 65 tgccccggcgtcgtctcctgcgccgacgtcctcgccatcgccgccagggacagcgtcgt 123
>gb|CA608220.1|CA608220 wr1.pk0090.g7 wr1 Triticum aestivum cDNA clone wr1.pk0090.g7 5'
end, mRNA sequence
Length = 627
Score = 85.7 bits (43), Expect = 7e-015
Identities = 55/59 (93%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcgt 396
||||| ||||| |||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 13 tgcccgggcgtcgtctcctgcgccgacgtgctcgccatcgccgccagggacagcgtcgt 71
>gb|CK162645.1|CK162645 FGAS015243 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1040
Score = 85.7 bits (43), Expect = 7e-015
Identities = 55/59 (93%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcgt 396
||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||||||
Sbjct: 430 tgccccggcgtcgtctcctgcgccgacgtcctcgccatcgccgccagggacagcgtcgt 488
>gb|BE415763.1|BE415763 MWL037.B08000418 ITEC MWL Wheat Root Library Triticum aestivum cDNA
clone MWL037.B08, mRNA sequence
Length = 353
Score = 81.8 bits (41), Expect = 1e-013
Identities = 53/57 (92%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtc 394
||||| ||||| |||||||||||||||||||||||| |||| |||||||||||||||
Sbjct: 142 tgcccgggcgtcgtctcctgcgccgacgtgctcgccatcgccgccagggacagcgtc 198
>gb|BF483453.1|BF483453 WHE2334_B01_C02ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2334_B01_C02, mRNA sequence
Length = 452
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 343 cggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcg 395
|||||| ||||||||||||||| | ||||||||||| ||||||||||||||||
Sbjct: 353 cggcgtcgtctcctgcgccgacatcctcgccttcgctgccagggacagcgtcg 405
>gb|BQ744329.1|BQ744329 WHE4114_C11_E22ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4114_C11_E22, mRNA sequence
Length = 772
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgct 228
||||||||||||||||| |||||||| |||||||||||||||| ||||||||
Sbjct: 329 atccgcatgcacttccacgactgcttcgtcaggggctgcgatgcatcggtgct 381
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 559 gctctcgggcgcgcacaccatcggcgtctcgcactgc 595
|||||| |||||||||||||||||| ||||||||||
Sbjct: 715 gctctcaggcgcgcacaccatcggccactcgcactgc 751
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 350 gtctcctgcgccgacgtgctcgccttcgc 378
||||||||||||||||||||||| |||||
Sbjct: 503 gtctcctgcgccgacgtgctcgctttcgc 531
>gb|BQ788776.1|BQ788776 WHE4153_F12_L23ZS Wheat CS whole plant cDNA library Triticum
aestivum cDNA clone WHE4153_F12_L23, mRNA sequence
Length = 580
Score = 73.8 bits (37), Expect = 3e-011
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatc 232
||||| ||||||||||| |||||||| ||||||||||| |||| |||||||||||||
Sbjct: 350 atccggatgcacttccacgactgcttcgtcaggggctgtgatgcctcggtgctgatc 406
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 350 gtctcctgcgccgacgtgctcgccttcgc 378
||||||||||||||||||||||| |||||
Sbjct: 524 gtctcctgcgccgacgtgctcgctttcgc 552
>gb|BQ789452.1|BQ789452 WHE4161_E09_J17ZS Wheat CS whole plant cDNA library Triticum
aestivum cDNA clone WHE4161_E09_J17, mRNA sequence
Length = 572
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgct 228
||||||||||||||||| |||||||| |||||||||||||||| ||||||||
Sbjct: 344 atccgcatgcacttccacgactgcttcgtcaggggctgcgatgcatcggtgct 396
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 350 gtctcctgcgccgacgtgctcgccttcgc 378
||||||||||||||||||||||| |||||
Sbjct: 518 gtctcctgcgccgacgtgctcgctttcgc 546
>gb|CA659498.1|CA659498 wlm1.pk0007.e8 wlm1 Triticum aestivum cDNA clone wlm1.pk0007.e8 5'
end, mRNA sequence
Length = 655
Score = 73.8 bits (37), Expect = 3e-011
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatc 232
||||| |||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 321 atccggatgcacttccatgactgcttcgtcaagggctgcgatgcttcggtgctgatc 377
>gb|CD867965.1|CD867965 AZO2.107K19F001109 AZO2 Triticum aestivum cDNA clone AZO2107K19,
mRNA sequence
Length = 610
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgct 228
||||||||||||||||| |||||||| |||||||||||||||| ||||||||
Sbjct: 337 atccgcatgcacttccacgactgcttcgtcaggggctgcgatgcatcggtgct 389
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 350 gtctcctgcgccgacgtgctcgccttcgc 378
||||||||||||||||||||||| |||||
Sbjct: 511 gtctcctgcgccgacgtgctcgctttcgc 539
>gb|CD872600.1|CD872600 AZO2.120P21F010209 AZO2 Triticum aestivum cDNA clone AZO2120P21,
mRNA sequence
Length = 687
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgct 228
||||||||||||||||| |||||||| |||||||||||||||| ||||||||
Sbjct: 337 atccgcatgcacttccacgactgcttcgtcaggggctgcgatgcatcggtgct 389
Score = 50.1 bits (25), Expect = 4e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 350 gtctcctgcgccgacgtgctcgccttcgc 378
||||||||||||||||||||||| |||||
Sbjct: 511 gtctcctgcgccgacgtgctcgctttcgc 539
>gb|CD914329.1|CD914329 G550.121P04F010712 G550 Triticum aestivum cDNA clone G550121P04,
mRNA sequence
Length = 540
Score = 73.8 bits (37), Expect = 3e-011
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatc 232
||||| ||||||||||| |||||||| ||||||||||| |||| |||||||||||||
Sbjct: 365 atccggatgcacttccacgactgcttcgtcaggggctgtgatgcctcggtgctgatc 421
>gb|CK160644.1|CK160644 FGAS042257 Triticum aestivum FGAS: TaLt5 Triticum aestivum cDNA,
mRNA sequence
Length = 896
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 344 ggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcgt 396
||||| |||||||||||||||||||||||| |||| |||||||||||| ||||
Sbjct: 150 ggcgtcgtctcctgcgccgacgtgctcgccatcgccgccagggacagcatcgt 202
>gb|CK195465.1|CK195465 FGAS003904 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 820
Score = 73.8 bits (37), Expect = 3e-011
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatc 232
||||||||||| |||||||| ||||| |||||||| |||||||||||| ||||||||
Sbjct: 392 atccgcatgcatttccatgattgcttcgtcaggggttgcgatggctcgctgctgatc 448
Score = 63.9 bits (32), Expect = 3e-008
Identities = 32/32 (100%)
Strand = Plus / Plus
Query: 350 gtctcctgcgccgacgtgctcgccttcgcggc 381
||||||||||||||||||||||||||||||||
Sbjct: 566 gtctcctgcgccgacgtgctcgccttcgcggc 597
>gb|CK207072.1|CK207072 FGAS018687 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 994
Score = 73.8 bits (37), Expect = 3e-011
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatc 232
||||| ||||| |||||||| ||||| ||||||||||||||||||||| ||||||||
Sbjct: 323 atccgtatgcatttccatgattgcttcgtcaggggctgcgatggctcgctgctgatc 379
Score = 58.0 bits (29), Expect = 2e-006
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 353 tcctgcgccgacgtgctcgccttcgcggc 381
|||||||||||||||||||||||||||||
Sbjct: 500 tcctgcgccgacgtgctcgccttcgcggc 528
>gb|BF201958.1|BF201958 WHE1759-1762_N22_N22ZS Wheat pre-anthesis spike cDNA library
Triticum aestivum cDNA clone WHE1759-1762_N22_N22, mRNA
sequence
Length = 429
Score = 71.9 bits (36), Expect = 1e-010
Identities = 51/56 (91%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgt 393
||||| ||||| |||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 374 tgcccgggcgtcgtctgctgcgccgacgtgctcgccatcgccgccagggacagcgt 429
>gb|BQ484105.1|BQ484105 WHE3516_E01_J02ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3516_E01_J02, mRNA sequence
Length = 667
Score = 71.9 bits (36), Expect = 1e-010
Identities = 45/48 (93%)
Strand = Plus / Plus
Query: 349 ggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcgt 396
||||||||||| ||||||||||||| |||| |||||||||||||||||
Sbjct: 4 ggtctcctgcgtcgacgtgctcgccatcgccgccagggacagcgtcgt 51
>gb|CK207865.1|CK207865 FGAS019535 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1111
Score = 69.9 bits (35), Expect = 4e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 343 cggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgt 393
|||||| ||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 378 cggcgtcgtctcctgcgccgacatcctcgccttcgctgccagggacagcgt 428
Score = 58.0 bits (29), Expect = 2e-006
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 546 aggacctggtcgtgctctcgggcgcgcacaccatcggcgtctcgcactgcagc 598
||||||||||| || || ||||||||||||||||||| |||||||||||||
Sbjct: 581 aggacctggtcaccctgtccggcgcgcacaccatcggcggctcgcactgcagc 633
>gb|CK208944.1|CK208944 FGAS020671 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1081
Score = 67.9 bits (34), Expect = 2e-009
Identities = 40/42 (95%)
Strand = Plus / Plus
Query: 343 cggcgtggtctcctgcgccgacgtgctcgccttcgcggccag 384
|||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 576 cggcgtcgtctcctgcgccgacgtgctcgccttcgccgccag 617
>gb|DR736866.1|DR736866 FGAS082236 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1142
Score = 67.9 bits (34), Expect = 2e-009
Identities = 40/42 (95%)
Strand = Plus / Plus
Query: 343 cggcgtggtctcctgcgccgacgtgctcgccttcgcggccag 384
|||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 587 cggcgtcgtctcctgcgccgacgtgctcgccttcgccgccag 628
Score = 58.0 bits (29), Expect = 2e-006
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtgctg 229
|||||||| |||||||| |||||||||||||| || |||||||||
Sbjct: 432 cacttccacgactgcttcgtcaggggctgcgacgggtcggtgctg 476
>gb|BE415179.1|BE415179 MWL024.B10F000107 ITEC MWL Wheat Root Library Triticum aestivum
cDNA clone MWL024.B10, mRNA sequence
Length = 343
Score = 65.9 bits (33), Expect = 7e-009
Identities = 51/57 (89%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatc 232
||||||||||| ||||| ||||| || |||||||| |||||||||||| ||||||||
Sbjct: 282 atccgcatgcatttccacgactgtttcgtcaggggttgcgatggctcgctgctgatc 338
>gb|BJ281093.1|BJ281093 BJ281093 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr20i04 5', mRNA sequence
Length = 509
Score = 65.9 bits (33), Expect = 7e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgc 378
||||||||||| |||||||||||||||||||||||| ||||
Sbjct: 331 tgccccggcgtcgtctcctgcgccgacgtgctcgccctcgc 371
>gb|CA626950.1|CA626950 wl1n.pk0145.f10 wl1n Triticum aestivum cDNA clone wl1n.pk0145.f10
5' end, mRNA sequence
Length = 468
Score = 65.9 bits (33), Expect = 7e-009
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 149 aacaactccggcgtcgctccggcgctgatccgcatgcacttccatgactgctttgtcagg 208
||||||||||||||| | || | ||| |||||| | || |||||||||||||| ||||||
Sbjct: 289 aacaactccggcgtcncacccgggctcatccgcctccatttccatgactgcttcgtcagg 348
Query: 209 ggctgcgatggctcggtgct 228
|| ||||||| ||| |||||
Sbjct: 349 ggttgcgatgcctccgtgct 368
>gb|CD869853.1|CD869853 AZO2.112N03F001117 AZO2 Triticum aestivum cDNA clone AZO2112N03,
mRNA sequence
Length = 695
Score = 65.9 bits (33), Expect = 7e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgc 378
||||||||||| |||||||||||||||||||||||| ||||
Sbjct: 343 tgccccggcgtcgtctcctgcgccgacgtgctcgccctcgc 383
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 546 aggacctggtcgtgctctcgggcgcgcacaccatcggc 583
||||||| | ||||||||| ||||||||||||||||||
Sbjct: 551 aggacctcgccgtgctctccggcgcgcacaccatcggc 588
>gb|CD879599.1|CD879599 AZO4.105M10F011011 AZO4 Triticum aestivum cDNA clone AZO4105M10,
mRNA sequence
Length = 637
Score = 65.9 bits (33), Expect = 7e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 338 tgccccggcgtggtctcctgcgccgacgtgctcgccttcgc 378
||||||||||| |||||||||||||||||||||||| ||||
Sbjct: 356 tgccccggcgtcgtctcctgcgccgacgtgctcgccctcgc 396
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 556 cgtgctctcgggcgcgcacaccatcggc 583
||||||||| ||||||||||||||||||
Sbjct: 575 cgtgctctccggcgcgcacaccatcggc 602
>gb|AJ717146.1|AJ717146 AJ717146 Triticum turgidum subsp. durum etiolated seedling 20 days
Triticum turgidum subsp. durum cDNA clone 10832R, mRNA
sequence
Length = 757
Score = 65.9 bits (33), Expect = 7e-009
Identities = 117/145 (80%)
Strand = Plus / Plus
Query: 689 gcctacgcatttcttctcaagagcatctgcccggccaacaccagccagttcttcccgaac 748
|||||||| || || || || ||||| ||||| ||||||| ||||||||||||||| | |
Sbjct: 429 gcctacgccttcctgctgaaaagcatatgccctgccaacagcagccagttcttcccaacc 488
Query: 749 acgacggtgttcatggacctcatcacgccggaaaggtttgacaacaagtaatacgtcggc 808
|||||| | |||||| ||||||| ||| | | ||||||||||| ||||| ||
Sbjct: 489 acgacgacggatatggacatcatcaccccgacgctgctggacaacaagtattacgtgggt 548
Query: 809 ctgaccaacaacctgggcctcttca 833
|||||||||||||||||||| ||||
Sbjct: 549 ctgaccaacaacctgggcctgttca 573
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 916 caagtttgccaggtccatgatcaagatggggcagatcgaggtgctgacggggacgcaggg 975
|||||||| || ||||||| | ||||||||| | |||||||||||||| || ||||||||
Sbjct: 657 caagtttgtcaagtccatggtgaagatgggggacatcgaggtgctgacaggaacgcaggg 716
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 529 caagaacctcactatcgaggacctggtcgtgctctcgggcgcgcacaccatcggcgtctc 588
|||||||||||| ||||||| ||||||| ||||| || ||||||||||| ||||||||
Sbjct: 177 caagaacctcacggccgaggacatggtcgtcctctccggtgcgcacaccataggcgtctc 236
>gb|CA613361.1|CA613361 wr1.pk0144.c9 wr1 Triticum aestivum cDNA clone wr1.pk0144.c9 5'
end, mRNA sequence
Length = 594
Score = 63.9 bits (32), Expect = 3e-008
Identities = 47/52 (90%)
Strand = Plus / Plus
Query: 544 cgaggacctggtcgtgctctcgggcgcgcacaccatcggcgtctcgcactgc 595
||||||| ||||||||||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 169 cgaggacatggtcgtgctctccggcgcccacaccatcggggtctcccactgc 220
>gb|BE404565.1|BE404565 WHE0443_G09_N17ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0443_G09_N17, mRNA
sequence
Length = 531
Score = 61.9 bits (31), Expect = 1e-007
Identities = 78/93 (83%), Gaps = 3/93 (3%)
Strand = Plus / Plus
Query: 177 tccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatcgaca 236
|||| ||||||||||| |||||||| |||||||| ||||| |||||||| ||| | |||
Sbjct: 199 tccggatgcacttccacgactgcttcgtcagggggtgcgacggctcggttctgctagact 258
Query: 237 cggtaggcaacctgacggcggagaaggacgcgc 269
|| | |||| ||||||||||||||||||||
Sbjct: 259 cg---gccaacaagacggcggagaaggacgcgc 288
>gb|BJ286157.1|BJ286157 BJ286157 Y. Ogihara unpublished cDNA library, Wh_r Triticum aestivum
cDNA clone whr19i12 3', mRNA sequence
Length = 654
Score = 61.9 bits (31), Expect = 1e-007
Identities = 73/87 (83%)
Strand = Plus / Minus
Query: 916 caagtttgccaggtccatgatcaagatggggcagatcgaggtgctgacggggacgcaggg 975
|||||||| || ||||||| | ||||||||| | || ||||||||||| || ||||| ||
Sbjct: 443 caagtttgtcaagtccatggtgaagatgggggacattgaggtgctgacaggaacgcaagg 384
Query: 976 cgagatcaggcgcaactgcagggtcat 1002
||||| |||| || ||||||||||||
Sbjct: 383 agagataaggctcagctgcagggtcat 357
Score = 50.1 bits (25), Expect = 4e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 710 agcatctgcccggccaacaccagccagttcttcccgaacacgacg 754
||||| ||||| ||||||| ||||||||||||||| | |||||||
Sbjct: 649 agcatatgccctgccaacagcagccagttcttcccaaccacgacg 605
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 788 gacaacaagtaatacgtcggcctgaccaacaacctgggc 826
||||||||||| ||||| || ||||| ||||||||||||
Sbjct: 571 gacaacaagtattacgtgggtctgacgaacaacctgggc 533
>gb|BJ277560.1|BJ277560 BJ277560 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr12a20 5', mRNA sequence
Length = 419
Score = 61.9 bits (31), Expect = 1e-007
Identities = 78/93 (83%), Gaps = 3/93 (3%)
Strand = Plus / Plus
Query: 177 tccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatcgaca 236
|||| ||||||||||| |||||||| |||||||| ||||| |||||||| ||| | |||
Sbjct: 224 tccggatgcacttccacgactgcttcgtcagggggtgcgacggctcggttctgctagact 283
Query: 237 cggtaggcaacctgacggcggagaaggacgcgc 269
|| | |||| ||||||||||||||||||||
Sbjct: 284 cg---gccaacaagacggcggagaaggacgcgc 313
>gb|BJ279346.1|BJ279346 BJ279346 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr2i09 5', mRNA sequence
Length = 489
Score = 61.9 bits (31), Expect = 1e-007
Identities = 78/93 (83%), Gaps = 3/93 (3%)
Strand = Plus / Plus
Query: 177 tccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatcgaca 236
|||| ||||||||||| |||||||| |||||||| ||||| |||||||| ||| | |||
Sbjct: 195 tccggatgcacttccacgactgcttcgtcagggggtgcgacggctcggttctgctggact 254
Query: 237 cggtaggcaacctgacggcggagaaggacgcgc 269
|| | |||| ||||||||||||||||||||
Sbjct: 255 cg---gccaacaagacggcggagaaggacgcgc 284
Score = 40.1 bits (20), Expect = 0.38
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 350 gtctcctgcgccgacgtgctcgcc 373
||||||||||||||||| ||||||
Sbjct: 362 gtctcctgcgccgacgtcctcgcc 385
>gb|CA619392.1|CA619392 wl1n.pk0051.e10 wl1n Triticum aestivum cDNA clone wl1n.pk0051.e10
5' end, mRNA sequence
Length = 632
Score = 61.9 bits (31), Expect = 1e-007
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 183 tgcacttccatgactgctttgtcaggggctgcgatggctcggtgctg 229
|||| ||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 244 tgcatttccatgactgctttgtcaagggctgcgatgcttcggtgctg 290
>gb|CA623946.1|CA623946 wl1n.pk0111.d2 wl1n Triticum aestivum cDNA clone wl1n.pk0111.d2 5'
end, mRNA sequence
Length = 629
Score = 61.9 bits (31), Expect = 1e-007
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 176 atccgcatgcacttccatgactgctttgtcaggggctgcgatggctc 222
||||||||||||||||| |||||||| ||| |||||||||| |||||
Sbjct: 256 atccgcatgcacttccacgactgcttcgtccggggctgcgacggctc 302
>gb|CA626858.1|CA626858 wl1n.pk0147.b1 wl1n Triticum aestivum cDNA clone wl1n.pk0147.b1 5'
end, mRNA sequence
Length = 588
Score = 61.9 bits (31), Expect = 1e-007
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 183 tgcacttccatgactgctttgtcaggggctgcgatggctcggtgctg 229
|||| ||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 253 tgcatttccatgactgctttgtcaagggctgcgatgcttcggtgctg 299
>gb|CA700583.1|CA700583 wkm1c.pk005.l2 wkm1c Triticum aestivum cDNA clone wkm1c.pk005.l2 5'
end, mRNA sequence
Length = 551
Score = 61.9 bits (31), Expect = 1e-007
Identities = 78/93 (83%), Gaps = 3/93 (3%)
Strand = Plus / Plus
Query: 177 tccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatcgaca 236
|||| ||||||||||| |||||||||||||| || ||||| |||||||| ||| | |||
Sbjct: 234 tccggatgcacttccacgactgctttgtcagagggtgcgacggctcggttctgctggact 293
Query: 237 cggtaggcaacctgacggcggagaaggacgcgc 269
|| | |||| ||||||||||||||||||||
Sbjct: 294 cg---gccaacaagacggcggagaaggacgcgc 323
>gb|BF484285.1|BF484285 WHE2321_E01_I01ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2321_E01_I01, mRNA sequence
Length = 514
Score = 60.0 bits (30), Expect = 4e-007
Identities = 77/92 (83%), Gaps = 3/92 (3%)
Strand = Plus / Plus
Query: 177 tccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatcgaca 236
|||| ||||||||||| |||||||| |||||||| ||||| |||||||| ||| | |||
Sbjct: 264 tccggatgcacttccacgactgcttcgtcagggggtgcgacggctcggttctgctggact 323
Query: 237 cggtaggcaacctgacggcggagaaggacgcg 268
|| | |||| |||||||||||||||||||
Sbjct: 324 cg---gccaacaagacggcggagaaggacgcg 352
>gb|BJ282415.1|BJ282415 BJ282415 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr10i15 3', mRNA sequence
Length = 681
Score = 60.0 bits (30), Expect = 4e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 545 gaggacctggtcgtgctctcgggcgcgcacaccatcgg 582
|||||||||||||| ||||| |||||||||||||||||
Sbjct: 522 gaggacctggtcgtcctctccggcgcgcacaccatcgg 485
>gb|BQ804333.1|BQ804333 WHE3553_C07_F13ZS Wheat developing grains cDNA library Triticum
aestivum cDNA clone WHE3553_C07_F13, mRNA sequence
Length = 717
Score = 60.0 bits (30), Expect = 4e-007
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 299 gacgtggtcgaccgtgccaaggcgtcactggaggctcagtgccccggcgtggtctcctgc 358
|||||||| ||||| ||||||||| || |||| |||||||||||||| |||||||||
Sbjct: 380 gacgtggttgaccgcgccaaggcggagctcgaggagcagtgccccggcgtcgtctcctgc 439
Query: 359 gccgac 364
||||||
Sbjct: 440 gccgac 445
>gb|BQ804547.1|BQ804547 WHE3555_H10_O19ZS Wheat developing grains cDNA library Triticum
aestivum cDNA clone WHE3555_H10_O19, mRNA sequence
Length = 398
Score = 60.0 bits (30), Expect = 4e-007
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 337 gtgccccggcgtggtctcctgcgccgacgtgctcgccttcgcggccagggacagcgtcgt 396
|||||| ||||| ||||||||||||||| | ||||| |||| ||||||||| |||||
Sbjct: 30 gtgcccgggcgtcgtctcctgcgccgacatcctcgcgctcgccgccagggacgccgtcgc 89
Query: 397 gctctccggtggcc 410
||||||||| ||||
Sbjct: 90 gctctccggcggcc 103
>gb|BJ257363.1|BJ257363 BJ257363 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh10c18 5', mRNA sequence
Length = 558
Score = 60.0 bits (30), Expect = 4e-007
Identities = 77/92 (83%), Gaps = 3/92 (3%)
Strand = Plus / Plus
Query: 177 tccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatcgaca 236
|||| ||||||||||| |||||||| |||||||| ||||| |||||||| ||| | |||
Sbjct: 286 tccggatgcacttccacgactgcttcgtcagggggtgcgacggctcggttctgctggact 345
Query: 237 cggtaggcaacctgacggcggagaaggacgcg 268
|| | |||| |||||||||||||||||||
Sbjct: 346 cg---gccaacaagacggcggagaaggacgcg 374
>gb|BJ257494.1|BJ257494 BJ257494 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh10n17 5', mRNA sequence
Length = 673
Score = 60.0 bits (30), Expect = 4e-007
Identities = 77/92 (83%), Gaps = 3/92 (3%)
Strand = Plus / Plus
Query: 177 tccgcatgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgatcgaca 236
|||| ||||||||||| |||||||| |||||||| ||||| |||||||| ||| | |||
Sbjct: 207 tccggatgcacttccacgactgcttcgtcagggggtgcgacggctcggttctgctggact 266
Query: 237 cggtaggcaacctgacggcggagaaggacgcg 268
|| | |||| |||||||||||||||||||
Sbjct: 267 cg---gccaacaagacggcggagaaggacgcg 295
>gb|CA625073.1|CA625073 wl1n.pk0127.g8 wl1n Triticum aestivum cDNA clone wl1n.pk0127.g8 5'
end, mRNA sequence
Length = 546
Score = 60.0 bits (30), Expect = 4e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 149 aacaactccggcgtcgctccggcgctgatccgcatgcacttccatgactgctttgtcagg 208
||||||||||||||||| || | ||| |||||| | || ||| |||||||||| ||||||
Sbjct: 269 aacaactccggcgtcgcacccgggctcatccgcctccatttcaatgactgcttcgtcagg 328
Query: 209 ggctgcgatg 218
|| |||||||
Sbjct: 329 ggttgcgatg 338
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 318,553
Number of Sequences: 636343
Number of extensions: 318553
Number of successful extensions: 90818
Number of sequences better than 0.5: 606
Number of HSP's better than 0.5 without gapping: 585
Number of HSP's successfully gapped in prelim test: 21
Number of HSP's that attempted gapping in prelim test: 89409
Number of HSP's gapped (non-prelim): 1397
length of query: 1326
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1306
effective length of database: 354,513,379
effective search space: 462994472974
effective search space used: 462994472974
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)