BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3203235.2.1
(637 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CK210291.1|CK210291 FGAS022092 Triticum aestivum FGAS: L... 359 2e-097
gb|CA597944.1|CA597944 wyr1c.pk001.n17 wyr1c Triticum aesti... 244 6e-063
gb|BQ752921.1|BQ752921 WHE4120_F12_L24ZS Wheat salt-stresse... 44 0.012
>gb|CK210291.1|CK210291 FGAS022092 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1167
Score = 359 bits (181), Expect = 2e-097
Identities = 406/481 (84%)
Strand = Plus / Plus
Query: 119 gggctgtggcggaggtatgcgccgcacgtccagatggtgctggcgcagctgtgctacacg 178
||||||||| ||||||| ||||||||| | |||| | ||| |||||| ||||||||
Sbjct: 130 gggctgtggaggaggtacgcgccgcacaacatgatgatcatggtgcagctctgctacacc 189
Query: 179 ctcatgtacttcatcaccgaggccgccttcaaccagggtctcaacccctacgtctacatc 238
|||||||||||| ||||||||||||||||||||| || |||||||||||||||||| ||
Sbjct: 190 ctcatgtacttcgtcaccgaggccgccttcaaccgcggcctcaacccctacgtctacgtc 249
Query: 239 acctaccgccatctgctcgtcgccgtcctcatctggcccttcgcatactacctggagaag 298
||||||||||| || ||||||||| ||||| ||||||||||||| ||||||| ||||||
Sbjct: 250 acctaccgccacctcctcgtcgccctcctcctctggcccttcgcctactaccacgagaag 309
Query: 299 gggctgaggcctaaaatgacgctcatgctgttcgtggagatattcgtgctctcccttctc 358
||||||||| || ||||| ||||||||| ||||||| ||||||||||| |||||
Sbjct: 310 aagctgaggcccaagatgacctggatgctgttcctggagatcttcgtgctctcgcttctg 369
Query: 359 ggggtgagcttaactctgaacatgtacttcacgagcctgaagtacacgtccccaacgttc 418
||||||||||| || ||||||||||||||| ||||||| |||||||||||||| || |||
Sbjct: 370 ggggtgagcttgaccctgaacatgtacttcgcgagcctcaagtacacgtccccgaccttc 429
Query: 419 gtcacttccgtggtgaacaccatcgcctcgatgacgttcgtcatcgccatcatcctcagg 478
||||| ||| |||| |||||| ||||||| || || ||||||||||||||| ||| ||
Sbjct: 430 gtcacctccatggtcaacaccgtcgcctccatcaccttcgtcatcgccatcgcgctccgg 489
Query: 479 atggagatcgtggacgtgaagagcctacgcggggtcgccaaggtcgcagggaccgtggtg 538
||||||||||||||| || ||| || ||| |||||||||| || || |||| ||||
Sbjct: 490 atggagatcgtggacctgcgcagcgcgcgggggctcgccaaggtggccggcaccgcggtg 549
Query: 539 tcgttcgccggggtgaccaccatgactctgtacaaaggagcggccatcacgagcctctgg 598
|| ||||| ||||| ||||||||||| || ||||| || ||||||||| |||||| ||||
Sbjct: 550 tccttcgcgggggtcaccaccatgacgctctacaagggcgcggccatcgcgagcccctgg 609
Query: 599 a 599
|
Sbjct: 610 a 610
>gb|CA597944.1|CA597944 wyr1c.pk001.n17 wyr1c Triticum aestivum cDNA clone wyr1c.pk001.n17
5' end, mRNA sequence
Length = 436
Score = 244 bits (123), Expect = 6e-063
Identities = 228/262 (87%), Gaps = 1/262 (0%)
Strand = Plus / Plus
Query: 163 gcagctgtgctacacgctcatgtacttcatcaccgaggccgccttcaaccagggtctcaa 222
||||||||||||||| | ||||||||| ||||||||||||||||||||| ||| |||||
Sbjct: 118 gcagctgtgctacaccttgatgtacttcgtcaccgaggccgccttcaaccgggggctcaa 177
Query: 223 cccctacgtctacatcacctaccgccatctgctcgtcgccgtcctcatctggcccttcgc 282
||||||||||||| ||||||||||||| || ||||||||||||||| |||||||||||||
Sbjct: 178 cccctacgtctacgtcacctaccgccacctcctcgtcgccgtcctcctctggcccttcgc 237
Query: 283 atactacc-tggagaaggggctgaggcctaaaatgacgctcatgctgttcgtggagatat 341
||||||| | ||||| | ||||||| || ||||| ||||||||| ||||||| |
Sbjct: 238 ctactaccacgaagaagaagttgaggcccaagatgacctggatgctgttcctggagatct 297
Query: 342 tcgtgctctcccttctcggggtgagcttaactctgaacatgtacttcacgagcctgaagt 401
|||||||||| ||||| ||||||||||| || ||||||||||||||| ||||||| ||||
Sbjct: 298 tcgtgctctcacttctaggggtgagcttgaccctgaacatgtacttcgcgagcctcaagt 357
Query: 402 acacgtccccaacgttcgtcac 423
||||||||| || ||||||||
Sbjct: 358 ncacgtccccgaccttcgtcac 379
>gb|BQ752921.1|BQ752921 WHE4120_F12_L24ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4120_F12_L24, mRNA sequence
Length = 675
Score = 44.1 bits (22), Expect = 0.012
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 616 cgccggcagcggcagcggcggc 637
||||||||||||||||||||||
Sbjct: 572 cgccggcagcggcagcggcggc 593
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 167,727
Number of Sequences: 636343
Number of extensions: 167727
Number of successful extensions: 49595
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49588
Number of HSP's gapped (non-prelim): 6
length of query: 637
length of database: 367,240,239
effective HSP length: 19
effective length of query: 618
effective length of database: 355,149,722
effective search space: 219482528196
effective search space used: 219482528196
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)