BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3185308.2.2
(697 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BJ254143.1|BJ254143 BJ254143 Y. Ogihara unpublished cDNA... 145 5e-033
gb|BJ248015.1|BJ248015 BJ248015 Y. Ogihara unpublished cDNA... 101 6e-020
gb|BE517456.1|BE517456 WHE0626_A11_A22ZA Wheat ABA-treated ... 50 2e-004
gb|CD894504.1|CD894504 G118.126G10F010823 G118 Triticum aes... 50 2e-004
gb|CD937691.1|CD937691 OV.107N15F010205 OV Triticum aestivu... 50 2e-004
gb|CN009796.1|CN009796 WHE3862_H04_P08ZS Wheat Fusarium gra... 50 2e-004
gb|CV764564.1|CV764564 FGAS058949 Triticum aestivum FGAS: L... 50 2e-004
gb|CV782040.1|CV782040 FGAS076453 Triticum aestivum FGAS: L... 50 2e-004
gb|BJ214280.1|BJ214280 BJ214280 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ221768.1|BJ221768 BJ221768 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ280310.1|BJ280310 BJ280310 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ285296.1|BJ285296 BJ285296 Y. Ogihara unpublished cDNA... 46 0.003
gb|BJ285550.1|BJ285550 BJ285550 Y. Ogihara unpublished cDNA... 46 0.003
gb|BQ839374.1|BQ839374 WHE4165_D06_H11ZS Wheat CS whole pla... 46 0.003
gb|CA714338.1|CA714338 wdk3c.pk018.l12 wdk3c Triticum aesti... 46 0.003
gb|CD454188.1|CD454188 WHE0990_H02_P04ZT CS wheat pre-anthe... 46 0.003
gb|CD862203.1|CD862203 AZO1.102M08F010126 AZO1 Triticum aes... 46 0.003
gb|CK210097.1|CK210097 FGAS021888 Triticum aestivum FGAS: L... 46 0.003
gb|DR737942.1|DR737942 FGAS083159 Triticum aestivum FGAS: L... 46 0.003
gb|DR739882.1|DR739882 FGAS000149 Triticum aestivum FGAS: L... 46 0.003
gb|AY589584.1| Triticum aestivum alpha-expansin EXPA2 mRNA,... 46 0.003
gb|AY543529.1| Triticum aestivum expansin EXPA3 mRNA, compl... 46 0.003
gb|BE427223.1|BE427223 PSR6135 ITEC PSR Wheat Pericarp/Test... 44 0.013
gb|BE427226.1|BE427226 PSR6138 ITEC PSR Wheat Pericarp/Test... 44 0.013
gb|BE499243.1|BE499243 WHE0972_F06_K12ZS Wheat pre-anthesis... 44 0.013
gb|BE515834.1|BE515834 WHE0606_C03_E06ZA Wheat ABA-treated ... 44 0.013
gb|BM136366.1|BM136366 WHE2609_A10_A19ZS Wheat Fusarium gra... 44 0.013
gb|BJ314216.1|BJ314216 BJ314216 Y. Ogihara unpublished cDNA... 44 0.013
gb|AL819700.1|AL819700 AL819700 n:129 Triticum aestivum cDN... 44 0.013
gb|BQ839416.1|BQ839416 WHE4165_H03_P05ZS Wheat CS whole pla... 44 0.013
gb|CA499840.1|CA499840 WHE4012_C08_F16ZT Wheat meiotic anth... 44 0.013
gb|AJ611080.1|AJ611080 AJ611080 Triticum turgidum subsp. du... 44 0.013
gb|BE499740.1|BE499740 WHE0975_G03_M05ZS Wheat pre-anthesis... 42 0.050
gb|BG906964.1|BG906964 TaLr1156A11R TaLr1 Triticum aestivum... 42 0.050
gb|CD863818.1|CD863818 AZO1.108C09F010131 AZO1 Triticum aes... 42 0.050
gb|CD896698.1|CD896698 G174.103K21F010822 G174 Triticum aes... 42 0.050
gb|CK205372.1|CK205372 FGAS016850 Triticum aestivum FGAS: L... 42 0.050
gb|CN009913.1|CN009913 WHE3864_C04_E08ZS Wheat Fusarium gra... 42 0.050
gb|CN011610.1|CN011610 WHE3886_C10_F20ZS Wheat Fusarium gra... 42 0.050
gb|AY910580.1| Triticum aestivum expansin EXPA10 mRNA, comp... 42 0.050
gb|AY910581.1| Triticum aestivum expansin EXPA11 mRNA, comp... 42 0.050
gb|AY910582.1| Triticum aestivum expansin EXPA12 mRNA, comp... 42 0.050
gb|AY485121.3| Triticum aestivum expansin EXPA1 mRNA, compl... 42 0.050
gb|BM135648.1|BM135648 WHE2622_D03_G06ZS Wheat Fusarium gra... 40 0.20
gb|BM135688.1|BM135688 WHE2622_H03_O06ZS Wheat Fusarium gra... 40 0.20
gb|BQ237273.1|BQ237273 TaE05019D09F TaE05 Triticum aestivum... 40 0.20
gb|DR736988.1|DR736988 FGAS082358 Triticum aestivum FGAS: L... 40 0.20
>gb|BJ254143.1|BJ254143 BJ254143 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf4j04 3', mRNA sequence
Length = 679
Score = 145 bits (73), Expect = 5e-033
Identities = 239/293 (81%), Gaps = 6/293 (2%)
Strand = Plus / Plus
Query: 192 tagaagttcttggtggcctggtacgttttgccgaactgccagtcgcggggcgtgacgtgc 251
||||||||||||| |||||||| || || ||||||||||| || || |||||||
Sbjct: 148 tagaagttcttgggtgcctggtaggtgacaccaaactgccagtcccgcgggaggacgtgc 207
Query: 252 caggaggtagccttgcggtggtcggcggtcatgacgcggaacgtcagcgactcgccggtg 311
||||| || |||||| |||||| ||||||||||||||||||| |||||||||||||||
Sbjct: 208 caggacgtgtgcttgcgatggtcgccggtcatgacgcggaacgtgagcgactcgccggtg 267
Query: 312 aggtcgacctccgtggtc---cagagctggccccagctgcgcttcatcggcgtccacttg 368
||||| ||| | |||| || | |||||||||| |||||| || | ||||||||||
Sbjct: 268 aggtc---ctcggaggtctgccacacctggccccagttgcgctgcaacaacgtccacttg 324
Query: 369 acgcgcttgttgcccttcacccacagcgccaccacgtccccggcgccgcccacgttggtc 428
||||||||||| ||||||||| |||||| |||||||||| || ||||||||||| |||
Sbjct: 325 acgcgcttgttccccttcaccttgagcgccgccacgtcccccgctccgcccacgttcgtc 384
Query: 429 accttcacctcgctgtagtgctggttccctgtgatcgtgtaccggatgccgcc 481
||| |||| | || ||| | |||||| ||||||||||||||||| |||||
Sbjct: 385 accgccaccatgttgaagtatttgttccccgtgatcgtgtaccggatcccgcc 437
>gb|BJ248015.1|BJ248015 BJ248015 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf4j04 5', mRNA sequence
Length = 679
Score = 101 bits (51), Expect = 6e-020
Identities = 123/147 (83%)
Strand = Plus / Minus
Query: 335 ctggccccagctgcgcttcatcggcgtccacttgacgcgcttgttgcccttcacccacag 394
|||||||||| |||||| || | ||||||||||||||||||||| ||||||||| ||
Sbjct: 671 ctggccccagttgcgctgcaacaacgtccacttgacgcgcttgttccccttcaccttgag 612
Query: 395 cgccaccacgtccccggcgccgcccacgttggtcaccttcacctcgctgtagtgctggtt 454
|||| |||||||||| || ||||||||||| |||||| |||| | || ||| | |||
Sbjct: 611 cgccgccacgtcccccgctccgcccacgttcgtcaccgccaccatgttgaagtatttgtt 552
Query: 455 ccctgtgatcgtgtaccggatgccgcc 481
||| ||||||||||||||||| |||||
Sbjct: 551 ccccgtgatcgtgtaccggatcccgcc 525
>gb|BE517456.1|BE517456 WHE0626_A11_A22ZA Wheat ABA-treated embryo cDNA library Triticum
aestivum cDNA clone WHE0626_A11_A22, mRNA sequence
Length = 505
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||||||||||||||||||
Sbjct: 488 cgtcgccggcgccgcccacgttggtcacc 460
>gb|CD894504.1|CD894504 G118.126G10F010823 G118 Triticum aestivum cDNA clone G118126G10,
mRNA sequence
Length = 682
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||||||||||||||||||
Sbjct: 531 cgtcgccggcgccgcccacgttggtcacc 503
>gb|CD937691.1|CD937691 OV.107N15F010205 OV Triticum aestivum cDNA clone OV107N15, mRNA
sequence
Length = 716
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||||||||||||||||||
Sbjct: 646 cgtcgccggcgccgcccacgttggtcacc 618
>gb|CN009796.1|CN009796 WHE3862_H04_P08ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3862_H04_P08,
mRNA sequence
Length = 475
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||||||||||||||||||
Sbjct: 447 cgtcgccggcgccgcccacgttggtcacc 419
>gb|CV764564.1|CV764564 FGAS058949 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 798
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||||||||||||||||||
Sbjct: 714 cgtcgccggcgccgcccacgttggtcacc 686
>gb|CV782040.1|CV782040 FGAS076453 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 833
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||||||||||||||||||
Sbjct: 177 cgtcgccggcgccgcccacgttggtcacc 149
>gb|BJ214280.1|BJ214280 BJ214280 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh26k17 5', mRNA sequence
Length = 599
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 77 cacgtcgccggcgccggccacgttggtcacc 47
>gb|BJ221768.1|BJ221768 BJ221768 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh26k17 3', mRNA sequence
Length = 611
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 535 cacgtcgccggcgccggccacgttggtcacc 565
>gb|BJ280310.1|BJ280310 BJ280310 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr7i04 5', mRNA sequence
Length = 516
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 162 cacgtcgccggcgccggccacgttggtcacc 132
>gb|BJ285296.1|BJ285296 BJ285296 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr7i04 3', mRNA sequence
Length = 658
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 583 cacgtcgccggcgccggccacgttggtcacc 613
>gb|BJ285550.1|BJ285550 BJ285550 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr8m22 3', mRNA sequence
Length = 650
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 542 cacgtcgccggcgccggccacgttggtcacc 572
>gb|BQ839374.1|BQ839374 WHE4165_D06_H11ZS Wheat CS whole plant cDNA library Triticum
aestivum cDNA clone WHE4165_D06_H11, mRNA sequence
Length = 631
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 446 cacgtcgccggcgccggccacgttggtcacc 416
>gb|CA714338.1|CA714338 wdk3c.pk018.l12 wdk3c Triticum aestivum cDNA clone wdk3c.pk018.l12
5' end, mRNA sequence
Length = 439
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 58 cacgtcgccggcgccggccacgttggtcacc 28
>gb|CD454188.1|CD454188 WHE0990_H02_P04ZT CS wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0990_H02_P04, mRNA sequence
Length = 738
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 634 cacgtcgccggcgccggccacgttggtcacc 664
>gb|CD862203.1|CD862203 AZO1.102M08F010126 AZO1 Triticum aestivum cDNA clone AZO1102M08,
mRNA sequence
Length = 696
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 634 cacgtcgccggcgccggccacgttggtcacc 604
>gb|CK210097.1|CK210097 FGAS021888 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1051
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 643 cacgtcgccggcgccggccacgttggtcacc 613
>gb|DR737942.1|DR737942 FGAS083159 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1109
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 659 cacgtcgccggcgccggccacgttggtcacc 629
>gb|DR739882.1|DR739882 FGAS000149 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 1124
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 653 cacgtcgccggcgccggccacgttggtcacc 623
>gb|AY589584.1| Triticum aestivum alpha-expansin EXPA2 mRNA, complete cds
Length = 1142
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 602 cacgtcgccggcgccggccacgttggtcacc 572
>gb|AY543529.1| Triticum aestivum expansin EXPA3 mRNA, complete cds
Length = 1106
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||| ||||||||||||||
Sbjct: 605 cacgtcgccggcgccggccacgttggtcacc 575
>gb|BE427223.1|BE427223 PSR6135 ITEC PSR Wheat Pericarp/Testa Library Triticum aestivum
cDNA clone PSR6135, mRNA sequence
Length = 1173
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 521 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 462
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 461 caatgccggcc 451
>gb|BE427226.1|BE427226 PSR6138 ITEC PSR Wheat Pericarp/Testa Library Triticum aestivum
cDNA clone PSR6138, mRNA sequence
Length = 1193
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 530 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 471
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 470 caatgccggcc 460
>gb|BE499243.1|BE499243 WHE0972_F06_K12ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0972_F06_K12, mRNA sequence
Length = 416
Score = 44.1 bits (22), Expect = 0.013
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| | |||||||||| ||||||||| || ||| |
Sbjct: 346 tgatggtgaaccggatgccgcccttcttntggcacgccaccctgcggtaggagacgggga 287
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 286 caatgccggcc 276
>gb|BE515834.1|BE515834 WHE0606_C03_E06ZA Wheat ABA-treated embryo cDNA library Triticum
aestivum cDNA clone WHE0606_C03_E06, mRNA sequence
Length = 292
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 113 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 54
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 53 caatgccggcc 43
>gb|BM136366.1|BM136366 WHE2609_A10_A19ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE2609_A10_A19,
mRNA sequence
Length = 373
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 336 tgatggtgaaccggatgccgcccttcttttggcacgccaccctgcggtaggagacgggga 277
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 276 caatgccggcc 266
>gb|BJ314216.1|BJ314216 BJ314216 Y. Ogihara unpublished cDNA library, Wh_yf Triticum
aestivum cDNA clone whyf9l11 5', mRNA sequence
Length = 207
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 105 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 46
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 45 caatgccggcc 35
>gb|AL819700.1|AL819700 AL819700 n:129 Triticum aestivum cDNA clone F07_n129_plate_3, mRNA
sequence
Length = 611
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 305 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 246
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 245 caatgccggcc 235
>gb|BQ839416.1|BQ839416 WHE4165_H03_P05ZS Wheat CS whole plant cDNA library Triticum
aestivum cDNA clone WHE4165_H03_P05, mRNA sequence
Length = 639
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 510 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 451
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 450 caatgccggcc 440
>gb|CA499840.1|CA499840 WHE4012_C08_F16ZT Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4012_C08_F16, mRNA sequence
Length = 511
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 441 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 382
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 381 caatgccggcc 371
>gb|AJ611080.1|AJ611080 AJ611080 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 04276R, mRNA
sequence
Length = 452
Score = 44.1 bits (22), Expect = 0.013
Identities = 58/71 (81%)
Strand = Plus / Minus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 225 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 166
Query: 520 cgatgccggcc 530
| |||||||||
Sbjct: 165 caatgccggcc 155
>gb|BE499740.1|BE499740 WHE0975_G03_M05ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0975_G03_M05, mRNA sequence
Length = 464
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 156 cgtcgccggcgccggccacgttggtcacc 128
>gb|BG906964.1|BG906964 TaLr1156A11R TaLr1 Triticum aestivum cDNA clone TaLr1156A11 5',
mRNA sequence
Length = 664
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 634 cgtcgccggcgccggccacgttggtcacc 606
>gb|CD863818.1|CD863818 AZO1.108C09F010131 AZO1 Triticum aestivum cDNA clone AZO1108C09,
mRNA sequence
Length = 693
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 65 cgtcgccggcgccggccacgttggtcacc 37
>gb|CD896698.1|CD896698 G174.103K21F010822 G174 Triticum aestivum cDNA clone G174103K21,
mRNA sequence
Length = 601
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 524 cgtcgccggcgccggccacgttggtcacc 496
>gb|CK205372.1|CK205372 FGAS016850 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1042
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 684 cgtcgccggcgccggccacgttggtcacc 712
>gb|CN009913.1|CN009913 WHE3864_C04_E08ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3864_C04_E08,
mRNA sequence
Length = 657
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 646 cgtcgccggcgccggccacgttggtcacc 618
>gb|CN011610.1|CN011610 WHE3886_C10_F20ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3886_C10_F20,
mRNA sequence
Length = 568
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 369 cgtcgccggcgccggccacgttggtcacc 341
>gb|AY910580.1| Triticum aestivum expansin EXPA10 mRNA, complete cds
Length = 1226
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 601 cgtcgccggcgccggccacgttggtcacc 573
>gb|AY910581.1| Triticum aestivum expansin EXPA11 mRNA, complete cds
Length = 1246
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 600 cgtcgccggcgccggccacgttggtcacc 572
>gb|AY910582.1| Triticum aestivum expansin EXPA12 mRNA, complete cds
Length = 1201
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 601 cgtcgccggcgccggccacgttggtcacc 573
>gb|AY485121.3| Triticum aestivum expansin EXPA1 mRNA, complete cds
Length = 1265
Score = 42.1 bits (21), Expect = 0.050
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||| ||||||||| ||||||||||||||
Sbjct: 600 cgtcgccggcgccggccacgttggtcacc 572
>gb|BM135648.1|BM135648 WHE2622_D03_G06ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE2622_D03_G06,
mRNA sequence
Length = 609
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 412 cgccgcccacgttggtcacc 431
||||||||||||||||||||
Sbjct: 320 cgccgcccacgttggtcacc 301
>gb|BM135688.1|BM135688 WHE2622_H03_O06ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE2622_H03_O06,
mRNA sequence
Length = 610
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 412 cgccgcccacgttggtcacc 431
||||||||||||||||||||
Sbjct: 320 cgccgcccacgttggtcacc 301
>gb|BQ237273.1|BQ237273 TaE05019D09F TaE05 Triticum aestivum cDNA clone TaE05019D09F, mRNA
sequence
Length = 534
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 412 cgccgcccacgttggtcacc 431
||||||||||||||||||||
Sbjct: 499 cgccgcccacgttggtcacc 518
>gb|DR736988.1|DR736988 FGAS082358 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1135
Score = 40.1 bits (20), Expect = 0.20
Identities = 56/69 (81%)
Strand = Plus / Plus
Query: 460 tgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggca 519
|||| ||| ||||||||||||| ||| |||||||||| ||||||||| || ||| |
Sbjct: 793 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 852
Query: 520 cgatgccgg 528
| |||||||
Sbjct: 853 ccatgccgg 861
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 131,548
Number of Sequences: 636343
Number of extensions: 131548
Number of successful extensions: 37980
Number of sequences better than 0.5: 47
Number of HSP's better than 0.5 without gapping: 36
Number of HSP's successfully gapped in prelim test: 11
Number of HSP's that attempted gapping in prelim test: 37916
Number of HSP's gapped (non-prelim): 83
length of query: 697
length of database: 367,240,239
effective HSP length: 19
effective length of query: 678
effective length of database: 355,149,722
effective search space: 240791511516
effective search space used: 240791511516
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)