BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115190.2.1
(656 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BJ245701.1|BJ245701 BJ245701 Y. Ogihara unpublished cDNA... 52 5e-005
gb|BJ247566.1|BJ247566 BJ247566 Y. Ogihara unpublished cDNA... 52 5e-005
gb|BJ253655.1|BJ253655 BJ253655 Y. Ogihara unpublished cDNA... 50 2e-004
gb|BJ265360.1|BJ265360 BJ265360 Y. Ogihara unpublished cDNA... 50 2e-004
gb|CA596211.1|CA596211 wpa1c.pk012.b17 wpa1c Triticum aesti... 50 2e-004
gb|AL810355.1|AL810355 AL810355 e:29 Triticum aestivum cDNA... 42 0.047
>gb|BJ245701.1|BJ245701 BJ245701 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf1m10 5', mRNA sequence
Length = 614
Score = 52.0 bits (26), Expect = 5e-005
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 531 cctccgtgtgccacacccagttcttccacacgccttcttccgcgta 576
|||||| |||||||||||||||||||||| || | || ||||||||
Sbjct: 311 cctccgagtgccacacccagttcttccactcggcctcctccgcgta 266
Score = 42.1 bits (21), Expect = 0.047
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 621 agcggttgccctggctgatgatggt 645
||||||| |||||||||||||||||
Sbjct: 218 agcggttcccctggctgatgatggt 194
>gb|BJ247566.1|BJ247566 BJ247566 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf2m10 5', mRNA sequence
Length = 453
Score = 52.0 bits (26), Expect = 5e-005
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 531 cctccgtgtgccacacccagttcttccacacgccttcttccgcgta 576
|||||| |||||||||||||||||||||| || | || ||||||||
Sbjct: 287 cctccgagtgccacacccagttcttccactcggcctcctccgcgta 242
>gb|BJ253655.1|BJ253655 BJ253655 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf2m10 3', mRNA sequence
Length = 481
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 531 cctccgtgtgccacacccagttcttccac 559
|||||| ||||||||||||||||||||||
Sbjct: 446 cctccgagtgccacacccagttcttccac 474
>gb|BJ265360.1|BJ265360 BJ265360 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh21k15 3', mRNA sequence
Length = 313
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 531 cctccgtgtgccacacccagttcttccac 559
|||||| ||||||||||||||||||||||
Sbjct: 273 cctccgagtgccacacccagttcttccac 301
>gb|CA596211.1|CA596211 wpa1c.pk012.b17 wpa1c Triticum aestivum cDNA clone wpa1c.pk012.b17
5' end, mRNA sequence
Length = 541
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 531 cctccgtgtgccacacccagttcttccac 559
|||||| ||||||||||||||||||||||
Sbjct: 86 cctccgagtgccacacccagttcttccac 58
>gb|AL810355.1|AL810355 AL810355 e:29 Triticum aestivum cDNA clone D07_e29_plate_1, mRNA
sequence
Length = 688
Score = 42.1 bits (21), Expect = 0.047
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 617 atgaagcggttgccctggctgatgatggt 645
||||| ||||| |||||||||||||||||
Sbjct: 681 atgaaccggttcccctggctgatgatggt 653
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 134,842
Number of Sequences: 636343
Number of extensions: 134842
Number of successful extensions: 36926
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36919
Number of HSP's gapped (non-prelim): 7
length of query: 656
length of database: 367,240,239
effective HSP length: 19
effective length of query: 637
effective length of database: 355,149,722
effective search space: 226230372914
effective search space used: 226230372914
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)