BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115097.2.1
(987 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BJ254143.1|BJ254143 BJ254143 Y. Ogihara unpublished cDNA... 212 3e-053
gb|BJ248015.1|BJ248015 BJ248015 Y. Ogihara unpublished cDNA... 125 6e-027
gb|CA741622.1|CA741622 wia1c.pk003.e8 wia1c Triticum aestiv... 107 1e-021
gb|BQ839416.1|BQ839416 WHE4165_H03_P05ZS Wheat CS whole pla... 86 5e-015
gb|BE427223.1|BE427223 PSR6135 ITEC PSR Wheat Pericarp/Test... 78 1e-012
gb|BE427226.1|BE427226 PSR6138 ITEC PSR Wheat Pericarp/Test... 78 1e-012
gb|BE515834.1|BE515834 WHE0606_C03_E06ZA Wheat ABA-treated ... 78 1e-012
gb|BJ314216.1|BJ314216 BJ314216 Y. Ogihara unpublished cDNA... 78 1e-012
gb|AL819700.1|AL819700 AL819700 n:129 Triticum aestivum cDN... 78 1e-012
gb|CA499840.1|CA499840 WHE4012_C08_F16ZT Wheat meiotic anth... 78 1e-012
gb|AJ611080.1|AJ611080 AJ611080 Triticum turgidum subsp. du... 78 1e-012
gb|CD894504.1|CD894504 G118.126G10F010823 G118 Triticum aes... 76 5e-012
gb|CD937691.1|CD937691 OV.107N15F010205 OV Triticum aestivu... 76 5e-012
gb|CN009796.1|CN009796 WHE3862_H04_P08ZS Wheat Fusarium gra... 76 5e-012
gb|CV764564.1|CV764564 FGAS058949 Triticum aestivum FGAS: L... 76 5e-012
gb|DR736988.1|DR736988 FGAS082358 Triticum aestivum FGAS: L... 76 5e-012
gb|BE499243.1|BE499243 WHE0972_F06_K12ZS Wheat pre-anthesis... 72 8e-011
gb|BM136366.1|BM136366 WHE2609_A10_A19ZS Wheat Fusarium gra... 70 3e-010
gb|CV767775.1|CV767775 FGAS062166 Triticum aestivum FGAS: L... 70 3e-010
gb|BE499740.1|BE499740 WHE0975_G03_M05ZS Wheat pre-anthesis... 68 1e-009
gb|BG906964.1|BG906964 TaLr1156A11R TaLr1 Triticum aestivum... 68 1e-009
gb|CD891977.1|CD891977 G118.119D17F010724 G118 Triticum aes... 68 1e-009
gb|CD896698.1|CD896698 G174.103K21F010822 G174 Triticum aes... 68 1e-009
gb|CD931182.1|CD931182 GR45.113L20F010511 GR45 Triticum aes... 68 1e-009
gb|CD934160.1|CD934160 GR45.123D11F010723 GR45 Triticum aes... 68 1e-009
gb|CN009913.1|CN009913 WHE3864_C04_E08ZS Wheat Fusarium gra... 68 1e-009
gb|CN011610.1|CN011610 WHE3886_C10_F20ZS Wheat Fusarium gra... 68 1e-009
gb|AY910580.1| Triticum aestivum expansin EXPA10 mRNA, comp... 68 1e-009
gb|AY910581.1| Triticum aestivum expansin EXPA11 mRNA, comp... 68 1e-009
gb|AY910582.1| Triticum aestivum expansin EXPA12 mRNA, comp... 68 1e-009
gb|CD913624.1|CD913624 G550.118I10F010713 G550 Triticum aes... 64 2e-008
gb|CV765677.1|CV765677 FGAS060064 Triticum aestivum FGAS: L... 64 2e-008
gb|CK209163.1|CK209163 FGAS020911 Triticum aestivum FGAS: L... 62 8e-008
gb|AL822120.1|AL822120 AL822120 p:234 Triticum aestivum cDN... 60 3e-007
gb|AL825640.1|AL825640 AL825640 p:234 Triticum aestivum cDN... 60 3e-007
gb|CD872661.1|CD872661 AZO2.121C17F010209 AZO2 Triticum aes... 60 3e-007
gb|CK194738.1|CK194738 FGAS003170 Triticum aestivum FGAS: L... 60 3e-007
gb|AY543531.1| Triticum aestivum expansin EXPA5 mRNA, compl... 60 3e-007
gb|AY485121.3| Triticum aestivum expansin EXPA1 mRNA, compl... 60 3e-007
gb|BE517456.1|BE517456 WHE0626_A11_A22ZA Wheat ABA-treated ... 58 1e-006
gb|CD892359.1|CD892359 G118.120L11F010725 G118 Triticum aes... 58 1e-006
gb|CV774820.1|CV774820 FGAS069220 Triticum aestivum FGAS: L... 54 2e-005
gb|CD934021.1|CD934021 GR45.122L24F010720 GR45 Triticum aes... 52 7e-005
gb|BE400943.1|BE400943 AWB009.F03F000328 ITEC AWB Wheat Mei... 48 0.001
gb|BE417174.1|BE417174 MUG017.E03R990204 ITEC MUG Wheat Spi... 48 0.001
gb|BE498867.1|BE498867 WHE0966_A06_B12ZS Wheat pre-anthesis... 48 0.001
gb|BF201351.1|BF201351 WHE0990_E12_J24ZS Wheat pre-anthesis... 48 0.001
gb|BF201531.1|BF201531 WHE1771_F09_K17ZS Wheat pre-anthesis... 48 0.001
gb|BF203005.1|BF203005 WHE1768_C04_E08ZS Wheat pre-anthesis... 48 0.001
gb|BF484994.1|BF484994 WHE1792_A11_A22ZS Wheat pre-anthesis... 48 0.001
gb|BJ270964.1|BJ270964 BJ270964 Y. Ogihara unpublished cDNA... 48 0.001
gb|CA599102.1|CA599102 wyr1c.pk004.b3 wyr1c Triticum aestiv... 48 0.001
gb|CA599229.1|CA599229 wyr1c.pk004.k11 wyr1c Triticum aesti... 48 0.001
gb|CA730445.1|CA730445 wip1c.pk004.b18 wip1c Triticum aesti... 48 0.001
gb|BQ167237.1|BQ167237 WHE0060_A11_A22ZK Cheyenne wheat end... 48 0.001
gb|CD886737.1|CD886737 G118.103C04F010605 G118 Triticum aes... 48 0.001
gb|CD913511.1|CD913511 G550.118B15F010713 G550 Triticum aes... 48 0.001
gb|CD915904.1|CD915904 G550.128H17F010717 G550 Triticum aes... 48 0.001
gb|CK210097.1|CK210097 FGAS021888 Triticum aestivum FGAS: L... 48 0.001
gb|AY543535.1| Triticum aestivum expansin EXPA9 mRNA, compl... 48 0.001
gb|BG262826.1|BG262826 WHE0945_G01_M01ZS Wheat 5-15 DAP spi... 46 0.005
gb|AY692477.1| Triticum aestivum alpha-expansin EXPA3 mRNA,... 46 0.005
gb|CD862203.1|CD862203 AZO1.102M08F010126 AZO1 Triticum aes... 44 0.018
gb|CD865261.1|CD865261 AZO2.073J15F000912 AZO2 Triticum aes... 44 0.018
gb|DR737942.1|DR737942 FGAS083159 Triticum aestivum FGAS: L... 44 0.018
gb|DR739882.1|DR739882 FGAS000149 Triticum aestivum FGAS: L... 44 0.018
gb|AY589584.1| Triticum aestivum alpha-expansin EXPA2 mRNA,... 44 0.018
gb|AY543529.1| Triticum aestivum expansin EXPA3 mRNA, compl... 44 0.018
gb|BG605102.1|BG605102 WHE2327_D04_H07ZS Wheat pre-anthesis... 42 0.072
gb|CV782040.1|CV782040 FGAS076453 Triticum aestivum FGAS: L... 42 0.072
gb|BE400448.1|BE400448 AWB003.F12F000328 ITEC AWB Wheat Mei... 40 0.28
gb|BE404074.1|BE404074 WHE1201_A09_A17ZS Wheat etiolated se... 40 0.28
gb|BE500587.1|BE500587 WHE0987-0990_A10_A10ZS Wheat pre-ant... 40 0.28
gb|BF201369.1|BF201369 WHE0990_H02_P04ZS Wheat pre-anthesis... 40 0.28
gb|BI479650.1|BI479650 WHE3456_D06_G12ZS Wheat pre-anthesis... 40 0.28
gb|BJ211119.1|BJ211119 BJ211119 Y. Ogihara unpublished cDNA... 40 0.28
gb|BJ232561.1|BJ232561 BJ232561 Y. Ogihara unpublished cDNA... 40 0.28
gb|AL822637.1|AL822637 AL822637 p:335 Triticum aestivum cDN... 40 0.28
gb|CA498350.1|CA498350 WHE3242_C12_E24ZT Wheat meiotic anth... 40 0.28
gb|CA723675.1|CA723675 wdr1f.pk003.h2 wdr1f Triticum aestiv... 40 0.28
gb|CA727878.1|CA727878 wdi1c.pk003.h14 wdi1c Triticum aesti... 40 0.28
gb|CA728402.1|CA728402 wdi1c.pk002.j9 wdi1c Triticum aestiv... 40 0.28
gb|CA733626.1|CA733626 wlp1c.pk005.p17 wlp1c Triticum aesti... 40 0.28
gb|CD915790.1|CD915790 G550.127O22F010716 G550 Triticum aes... 40 0.28
gb|CD930666.1|CD930666 GR45.112A07F010418 GR45 Triticum aes... 40 0.28
gb|CK163885.1|CK163885 FGAS016522 Triticum aestivum FGAS: L... 40 0.28
gb|CK214305.1|CK214305 FGAS026228 Triticum aestivum FGAS: L... 40 0.28
gb|AL815146.1|AL815146 AL815146 h:116 Triticum aestivum cDN... 40 0.28
gb|CV770817.1|CV770817 FGAS065210 Triticum aestivum FGAS: L... 40 0.28
gb|CV773970.1|CV773970 FGAS068367 Triticum aestivum FGAS: L... 40 0.28
gb|DR738339.1|DR738339 FGAS083556 Triticum aestivum FGAS: L... 40 0.28
>gb|BJ254143.1|BJ254143 BJ254143 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf4j04 3', mRNA sequence
Length = 679
Score = 212 bits (107), Expect = 3e-053
Identities = 254/303 (83%)
Strand = Plus / Plus
Query: 298 ttagaagttcttggatgcctggtacgtgacgccgaacttccagtcagcggggagaacgtg 357
|||||||||||||| ||||||||| ||||| || |||| |||||| ||||| |||||
Sbjct: 147 ttagaagttcttgggtgcctggtaggtgacaccaaactgccagtcccgcgggaggacgtg 206
Query: 358 ccatgaggtggccttgcggtggtcgctggtcatcacccggaacgtcagcgactcgcaggt 417
||| || ||| |||||| ||||||| |||||| || |||||||| |||||||||| |||
Sbjct: 207 ccaggacgtgtgcttgcgatggtcgccggtcatgacgcggaacgtgagcgactcgccggt 266
Query: 418 gaggtcctccccggtctgccacacttgcccccagttgcgcttcatctccgtccacttgac 477
||||||||| |||||||||||| || ||||||||||||| || | ||||||||||||
Sbjct: 267 gaggtcctcggaggtctgccacacctggccccagttgcgctgcaacaacgtccacttgac 326
Query: 478 gcgcttgctccccttcaccgacaccgccgcgatgtcgccagcgccgcccacattggtgat 537
||||||| ||||||||||| | |||||| | ||| || || |||||||| || || |
Sbjct: 327 gcgcttgttccccttcaccttgagcgccgccacgtcccccgctccgcccacgttcgtcac 386
Query: 538 cgtcaccatgttgaagtacttgttcccggtgatggtgtaccggatgccgccctgcttcgc 597
|| ||||||||||||||| |||||||| ||||| ||||||||||| |||||| |||||||
Sbjct: 387 cgccaccatgttgaagtatttgttccccgtgatcgtgtaccggatcccgcccagcttcgc 446
Query: 598 gca 600
|||
Sbjct: 447 gca 449
Score = 79.8 bits (40), Expect = 3e-013
Identities = 82/96 (85%)
Strand = Plus / Plus
Query: 611 cggtaggagatcggcacgatgccggccttctcttgcgcgatctggaggaacgcgggcatg 670
||||| ||||| ||||| |||||||||||||| | ||||||||| ||||| || ||||||
Sbjct: 478 cggtacgagatgggcacaatgccggccttctcctccgcgatctgcaggaaggccggcatg 537
Query: 671 ctgaggtcgaagtgctcccgcggtggcttgcaccac 706
||||||| | |||||| ||||| || |||||||||
Sbjct: 538 gtgaggtccaggtgctcgcgcggcgggttgcaccac 573
>gb|BJ248015.1|BJ248015 BJ248015 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf4j04 5', mRNA sequence
Length = 679
Score = 125 bits (63), Expect = 6e-027
Identities = 141/167 (84%)
Strand = Plus / Minus
Query: 434 tgccacacttgcccccagttgcgcttcatctccgtccacttgacgcgcttgctccccttc 493
|||||||| || ||||||||||||| || | ||||||||||||||||||| ||||||||
Sbjct: 679 tgccacacctggccccagttgcgctgcaacaacgtccacttgacgcgcttgttccccttc 620
Query: 494 accgacaccgccgcgatgtcgccagcgccgcccacattggtgatcgtcaccatgttgaag 553
||| | |||||| | ||| || || |||||||| || || | || |||||||||||||
Sbjct: 619 accttgagcgccgccacgtcccccgctccgcccacgttcgtcaccgccaccatgttgaag 560
Query: 554 tacttgttcccggtgatggtgtaccggatgccgccctgcttcgcgca 600
|| |||||||| ||||| ||||||||||| |||||| ||||||||||
Sbjct: 559 tatttgttccccgtgatcgtgtaccggatcccgcccagcttcgcgca 513
Score = 107 bits (54), Expect = 1e-021
Identities = 123/146 (84%)
Strand = Plus / Minus
Query: 839 gtgctcacggccaccgtctgcacgccgtacccctgcgcgcgcgtgtccttgtacccgcac 898
|||||||||||| ||||||||| ||||||||||| ||| |||||||||||| ||||||
Sbjct: 235 gtgctcacggccgccgtctgcaggccgtacccctccgccaccgtgtccttgtagccgcac 176
Query: 899 gcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtgggcgggtttc 958
||||| || |||| ||||||| || || ||||| |||||||| ||||| || || |||
Sbjct: 175 gcgccggcgcgggtgtcggacccatcgcgtccgccatagaaggtggcgtgcgccggcttc 116
Query: 959 cacggcccggccgtgaacttgccgtg 984
||||| || ||||||||| |||||||
Sbjct: 115 cacgggcccgccgtgaacctgccgtg 90
Score = 79.8 bits (40), Expect = 3e-013
Identities = 82/96 (85%)
Strand = Plus / Minus
Query: 611 cggtaggagatcggcacgatgccggccttctcttgcgcgatctggaggaacgcgggcatg 670
||||| ||||| ||||| |||||||||||||| | ||||||||| ||||| || ||||||
Sbjct: 484 cggtacgagatgggcacaatgccggccttctcctccgcgatctgcaggaaggccggcatg 425
Query: 671 ctgaggtcgaagtgctcccgcggtggcttgcaccac 706
||||||| | |||||| ||||| || |||||||||
Sbjct: 424 gtgaggtccaggtgctcgcgcggcgggttgcaccac 389
>gb|CA741622.1|CA741622 wia1c.pk003.e8 wia1c Triticum aestivum cDNA clone wia1c.pk003.e8 5'
end, mRNA sequence
Length = 506
Score = 107 bits (54), Expect = 1e-021
Identities = 123/146 (84%)
Strand = Plus / Minus
Query: 839 gtgctcacggccaccgtctgcacgccgtacccctgcgcgcgcgtgtccttgtacccgcac 898
|||||||||||| ||||||||| ||||||||||| ||| |||||||||||| ||||||
Sbjct: 329 gtgctcacggccgccgtctgcaggccgtacccctccgccaccgtgtccttgtagccgcac 270
Query: 899 gcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtgggcgggtttc 958
||||| || |||| ||||||| || || ||||| |||||||| ||||| || || |||
Sbjct: 269 gcgccggcgcgggtgtcggacccatcgcgtccgccatagaaggtggcgtgcgccggcttc 210
Query: 959 cacggcccggccgtgaacttgccgtg 984
||||| || ||||||||| |||||||
Sbjct: 209 cacgggcccgccgtgaacctgccgtg 184
>gb|BQ839416.1|BQ839416 WHE4165_H03_P05ZS Wheat CS whole plant cDNA library Triticum
aestivum cDNA clone WHE4165_H03_P05, mRNA sequence
Length = 639
Score = 85.7 bits (43), Expect = 5e-015
Identities = 106/127 (83%)
Strand = Plus / Minus
Query: 511 gtcgccagcgccgcccacattggtgatcgtcaccatgttgaagtacttgttcccggtgat 570
|||||||| ||||||||| ||||||| ||||| ||||||||| || ||| ||||
Sbjct: 566 gtcgccagggccgcccacgttggtgacgagcaccaggttgaagtaggagtggccgttgat 507
Query: 571 ggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggcacgat 630
|||| ||||||||||||||| |||| ||||||||||||||||||||||| || || ||
Sbjct: 506 ggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacggggacaat 447
Query: 631 gccggcc 637
|||||||
Sbjct: 446 gccggcc 440
>gb|BE427223.1|BE427223 PSR6135 ITEC PSR Wheat Pericarp/Testa Library Triticum aestivum
cDNA clone PSR6135, mRNA sequence
Length = 1173
Score = 77.8 bits (39), Expect = 1e-012
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| |||| ||||||||||||||||||||||| || |
Sbjct: 521 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 462
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 461 caatgccggcc 451
>gb|BE427226.1|BE427226 PSR6138 ITEC PSR Wheat Pericarp/Testa Library Triticum aestivum
cDNA clone PSR6138, mRNA sequence
Length = 1193
Score = 77.8 bits (39), Expect = 1e-012
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| |||| ||||||||||||||||||||||| || |
Sbjct: 530 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 471
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 470 caatgccggcc 460
>gb|BE515834.1|BE515834 WHE0606_C03_E06ZA Wheat ABA-treated embryo cDNA library Triticum
aestivum cDNA clone WHE0606_C03_E06, mRNA sequence
Length = 292
Score = 77.8 bits (39), Expect = 1e-012
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| |||| ||||||||||||||||||||||| || |
Sbjct: 113 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 54
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 53 caatgccggcc 43
>gb|BJ314216.1|BJ314216 BJ314216 Y. Ogihara unpublished cDNA library, Wh_yf Triticum
aestivum cDNA clone whyf9l11 5', mRNA sequence
Length = 207
Score = 77.8 bits (39), Expect = 1e-012
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| |||| ||||||||||||||||||||||| || |
Sbjct: 105 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 46
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 45 caatgccggcc 35
>gb|AL819700.1|AL819700 AL819700 n:129 Triticum aestivum cDNA clone F07_n129_plate_3, mRNA
sequence
Length = 611
Score = 77.8 bits (39), Expect = 1e-012
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| |||| ||||||||||||||||||||||| || |
Sbjct: 305 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 246
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 245 caatgccggcc 235
>gb|CA499840.1|CA499840 WHE4012_C08_F16ZT Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4012_C08_F16, mRNA sequence
Length = 511
Score = 77.8 bits (39), Expect = 1e-012
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| |||| ||||||||||||||||||||||| || |
Sbjct: 441 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 382
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 381 caatgccggcc 371
>gb|AJ611080.1|AJ611080 AJ611080 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 04276R, mRNA
sequence
Length = 452
Score = 77.8 bits (39), Expect = 1e-012
Identities = 63/71 (88%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| |||| ||||||||||||||||||||||| || |
Sbjct: 225 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggagacgggga 166
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 165 caatgccggcc 155
>gb|CD894504.1|CD894504 G118.126G10F010823 G118 Triticum aestivum cDNA clone G118126G10,
mRNA sequence
Length = 682
Score = 75.8 bits (38), Expect = 5e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 511 gtcgccagcgccgcccacattggtgatcgtcaccatgttgaagtacttgttcccggtgat 570
|||||| ||||||||||| ||||| | | ||||| ||||||||| || ||| ||||
Sbjct: 530 gtcgccggcgccgcccacgttggtcaccagcaccaggttgaagtaggagtggccgttgat 471
Query: 571 ggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggcacgat 630
|||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||||||
Sbjct: 470 ggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggcacgat 411
Query: 631 gccggc 636
||||||
Sbjct: 410 gccggc 405
>gb|CD937691.1|CD937691 OV.107N15F010205 OV Triticum aestivum cDNA clone OV107N15, mRNA
sequence
Length = 716
Score = 75.8 bits (38), Expect = 5e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 511 gtcgccagcgccgcccacattggtgatcgtcaccatgttgaagtacttgttcccggtgat 570
|||||| ||||||||||| ||||| | | ||||| ||||||||| || ||| ||||
Sbjct: 645 gtcgccggcgccgcccacgttggtcaccagcaccaggttgaagtaggagtggccgttgat 586
Query: 571 ggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggcacgat 630
|||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||||||
Sbjct: 585 ggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggcacgat 526
Query: 631 gccggc 636
||||||
Sbjct: 525 gccggc 520
Score = 40.1 bits (20), Expect = 0.28
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 929 ccgccgtagaaggtcgcgtgggcg 952
|||||||||||||| |||||||||
Sbjct: 212 ccgccgtagaaggtggcgtgggcg 189
>gb|CN009796.1|CN009796 WHE3862_H04_P08ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3862_H04_P08,
mRNA sequence
Length = 475
Score = 75.8 bits (38), Expect = 5e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 511 gtcgccagcgccgcccacattggtgatcgtcaccatgttgaagtacttgttcccggtgat 570
|||||| ||||||||||| ||||| | | ||||| ||||||||| || ||| ||||
Sbjct: 446 gtcgccggcgccgcccacgttggtcaccagcaccaggttgaagtaggagtggccgttgat 387
Query: 571 ggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggcacgat 630
|||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||||||
Sbjct: 386 ggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggcacgat 327
Query: 631 gccggc 636
||||||
Sbjct: 326 gccggc 321
>gb|CV764564.1|CV764564 FGAS058949 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 798
Score = 75.8 bits (38), Expect = 5e-012
Identities = 104/126 (82%)
Strand = Plus / Minus
Query: 511 gtcgccagcgccgcccacattggtgatcgtcaccatgttgaagtacttgttcccggtgat 570
|||||| ||||||||||| ||||| | | ||||| ||||||||| || ||| ||||
Sbjct: 713 gtcgccggcgccgcccacgttggtcaccagcaccaggttgaagtaggagtggccgttgat 654
Query: 571 ggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggcacgat 630
|||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||||||
Sbjct: 653 ggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggcacgat 594
Query: 631 gccggc 636
||||||
Sbjct: 593 gccggc 588
Score = 40.1 bits (20), Expect = 0.28
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 929 ccgccgtagaaggtcgcgtgggcg 952
|||||||||||||| |||||||||
Sbjct: 280 ccgccgtagaaggtggcgtgggcg 257
>gb|DR736988.1|DR736988 FGAS082358 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1135
Score = 75.8 bits (38), Expect = 5e-012
Identities = 50/54 (92%)
Strand = Plus / Plus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggaga 620
|||||||| ||||||||||||||| |||| |||||||||||||||||||||||
Sbjct: 793 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgcggtaggaga 846
>gb|BE499243.1|BE499243 WHE0972_F06_K12ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0972_F06_K12, mRNA sequence
Length = 416
Score = 71.9 bits (36), Expect = 8e-011
Identities = 62/71 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| ||| ||||||||||||||||||||||| || |
Sbjct: 346 tgatggtgaaccggatgccgcccttcttntggcacgccaccctgcggtaggagacgggga 287
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 286 caatgccggcc 276
>gb|BM136366.1|BM136366 WHE2609_A10_A19ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE2609_A10_A19,
mRNA sequence
Length = 373
Score = 69.9 bits (35), Expect = 3e-010
Identities = 62/71 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| ||| ||||||||||||||||||||||| || |
Sbjct: 336 tgatggtgaaccggatgccgcccttcttttggcacgccaccctgcggtaggagacgggga 277
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 276 caatgccggcc 266
>gb|CV767775.1|CV767775 FGAS062166 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 827
Score = 69.9 bits (35), Expect = 3e-010
Identities = 65/75 (86%)
Strand = Plus / Minus
Query: 562 cccggtgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagat 621
|||| |||||||| |||||||||| |||| |||| |||||| |||||| | ||||||||
Sbjct: 672 cccgttgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagac 613
Query: 622 cggcacgatgccggc 636
||||||||||||||
Sbjct: 612 gggcacgatgccggc 598
>gb|BE499740.1|BE499740 WHE0975_G03_M05ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0975_G03_M05, mRNA sequence
Length = 464
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 99 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 40
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 39 cgatgccggc 30
>gb|BG906964.1|BG906964 TaLr1156A11R TaLr1 Triticum aestivum cDNA clone TaLr1156A11 5',
mRNA sequence
Length = 664
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 577 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 518
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 517 cgatgccggc 508
>gb|CD891977.1|CD891977 G118.119D17F010724 G118 Triticum aestivum cDNA clone G118119D17,
mRNA sequence
Length = 598
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 585 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 526
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 525 cgatgccggc 516
Score = 40.1 bits (20), Expect = 0.28
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 929 ccgccgtagaaggtcgcgtgggcg 952
|||||||||||||| |||||||||
Sbjct: 208 ccgccgtagaaggtggcgtgggcg 185
>gb|CD896698.1|CD896698 G174.103K21F010822 G174 Triticum aestivum cDNA clone G174103K21,
mRNA sequence
Length = 601
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 467 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 408
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 407 cgatgccggc 398
>gb|CD931182.1|CD931182 GR45.113L20F010511 GR45 Triticum aestivum cDNA clone GR45113L20,
mRNA sequence
Length = 632
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 572 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 513
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 512 cgatgccggc 503
>gb|CD934160.1|CD934160 GR45.123D11F010723 GR45 Triticum aestivum cDNA clone GR45123D11,
mRNA sequence
Length = 630
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 582 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 523
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 522 cgatgccggc 513
>gb|CN009913.1|CN009913 WHE3864_C04_E08ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3864_C04_E08,
mRNA sequence
Length = 657
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 589 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 530
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 529 cgatgccggc 520
>gb|CN011610.1|CN011610 WHE3886_C10_F20ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3886_C10_F20,
mRNA sequence
Length = 568
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 312 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 253
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 252 cgatgccggc 243
>gb|AY910580.1| Triticum aestivum expansin EXPA10 mRNA, complete cds
Length = 1226
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 544 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 485
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 484 cgatgccggc 475
>gb|AY910581.1| Triticum aestivum expansin EXPA11 mRNA, complete cds
Length = 1246
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 543 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 484
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 483 cgatgccggc 474
>gb|AY910582.1| Triticum aestivum expansin EXPA12 mRNA, complete cds
Length = 1201
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | |||||||| ||||
Sbjct: 544 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggagacgggca 485
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 484 cgatgccggc 475
>gb|CD913624.1|CD913624 G550.118I10F010713 G550 Triticum aestivum cDNA clone G550118I10,
mRNA sequence
Length = 464
Score = 63.9 bits (32), Expect = 2e-008
Identities = 92/112 (82%)
Strand = Plus / Minus
Query: 525 ccacattggtgatcgtcaccatgttgaagtacttgttcccggtgatggtgtaccggatgc 584
|||| ||||||||| ||||| |||||||||| || |||| |||||||| |||| | |
Sbjct: 419 ccacgttggtgatcagcaccaggttgaagtacctgaacccgttgatggtgaaccgcaccc 360
Query: 585 cgccctgcttcgcgcacgccaccctgcggtaggagatcggcacgatgccggc 636
||||| |||| ||||||||||| ||||||||||| || |||||||||||
Sbjct: 359 cgcccgacttccggcacgccacccggcggtaggagacggggacgatgccggc 308
>gb|CV765677.1|CV765677 FGAS060064 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 826
Score = 63.9 bits (32), Expect = 2e-008
Identities = 63/72 (87%), Gaps = 1/72 (1%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctg-cggtaggagatcggc 625
|||||||| ||||||||||||||| |||| ||||||||||||| |||||||||| ||
Sbjct: 713 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgccggtaggagacgggg 654
Query: 626 acgatgccggcc 637
|| |||||||||
Sbjct: 653 acaatgccggcc 642
>gb|CK209163.1|CK209163 FGAS020911 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1156
Score = 61.9 bits (31), Expect = 8e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| ||||||||||||||| || ||||||||||||||||||||||| || |
Sbjct: 782 tgatggtgaaccggatgccgccctttttttggcacgccaccctgcggtaggagacgggga 723
Query: 627 cgatgccggcc 637
| |||||||||
Sbjct: 722 caatgccggcc 712
>gb|AL822120.1|AL822120 AL822120 p:234 Triticum aestivum cDNA clone
A07_p234_plate_20_run_2, mRNA sequence
Length = 598
Score = 60.0 bits (30), Expect = 3e-007
Identities = 57/66 (86%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||| ||||| || ||||||||||| |||| | ||||||||||| ||||||||
Sbjct: 230 gtacccgcaggcgccgcccatggtgccggacgcgtcgccgccgccgtagaacgtcgcgtg 171
Query: 949 ggcggg 954
||||||
Sbjct: 170 ggcggg 165
>gb|AL825640.1|AL825640 AL825640 p:234 Triticum aestivum cDNA clone A05_p234_plate_14, mRNA
sequence
Length = 484
Score = 60.0 bits (30), Expect = 3e-007
Identities = 57/66 (86%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||| ||||| || ||||||||||| |||| | ||||||||||| ||||||||
Sbjct: 201 gtacccgcaggcgccgcccatggtgccggacgcgtcgccgccgccgtagaacgtcgcgtg 142
Query: 949 ggcggg 954
||||||
Sbjct: 141 ggcggg 136
>gb|CD872661.1|CD872661 AZO2.121C17F010209 AZO2 Triticum aestivum cDNA clone AZO2121C17,
mRNA sequence
Length = 685
Score = 60.0 bits (30), Expect = 3e-007
Identities = 57/66 (86%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||| ||||| || ||||||||||| |||| | ||||||||||| ||||||||
Sbjct: 215 gtacccgcaggcgccgcccatggtgccggacgcgtcgccgccgccgtagaacgtcgcgtg 156
Query: 949 ggcggg 954
||||||
Sbjct: 155 ggcggg 150
>gb|CK194738.1|CK194738 FGAS003170 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 810
Score = 60.0 bits (30), Expect = 3e-007
Identities = 57/66 (86%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||| ||||| || ||||||||||| |||| | ||||||||||| ||||||||
Sbjct: 342 gtacccgcaggcgccgcccatggtgccggacgcgtcgccgccgccgtagaacgtcgcgtg 283
Query: 949 ggcggg 954
||||||
Sbjct: 282 ggcggg 277
>gb|AY543531.1| Triticum aestivum expansin EXPA5 mRNA, complete cds
Length = 1004
Score = 60.0 bits (30), Expect = 3e-007
Identities = 57/66 (86%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||| ||||| || ||||||||||| |||| | ||||||||||| ||||||||
Sbjct: 151 gtacccgcaggcgccgcccatggtgccggacgcgtcgccgccgccgtagaacgtcgcgtg 92
Query: 949 ggcggg 954
||||||
Sbjct: 91 ggcggg 86
>gb|AY485121.3| Triticum aestivum expansin EXPA1 mRNA, complete cds
Length = 1265
Score = 60.0 bits (30), Expect = 3e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| |||||| |||||| | ||||| || ||||
Sbjct: 543 tgatggtgaaccggatgccccccttcttcacgcacggcacccttctgtaggggacgggca 484
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 483 cgatgccggc 474
>gb|BE517456.1|BE517456 WHE0626_A11_A22ZA Wheat ABA-treated embryo cDNA library Triticum
aestivum cDNA clone WHE0626_A11_A22, mRNA sequence
Length = 505
Score = 58.0 bits (29), Expect = 1e-006
Identities = 83/101 (82%)
Strand = Plus / Minus
Query: 511 gtcgccagcgccgcccacattggtgatcgtcaccatgttgaagtacttgttcccggtgat 570
|||||| ||||||||||| ||||| | | ||||| ||||||||| || ||| ||||
Sbjct: 487 gtcgccggcgccgcccacgttggtcaccagcaccaggttgaagtaggagtggccgttgat 428
Query: 571 ggtgtaccggatgccgccctgcttcgcgcacgccaccctgc 611
|||| |||||||||| |||| |||| |||||| ||||||||
Sbjct: 427 ggtgaaccggatgccccccttcttcacgcacggcaccctgc 387
>gb|CD892359.1|CD892359 G118.120L11F010725 G118 Triticum aestivum cDNA clone G118120L11,
mRNA sequence
Length = 501
Score = 58.0 bits (29), Expect = 1e-006
Identities = 41/45 (91%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgc 611
|||||||| ||||||||||||||| |||| ||||||||||||||
Sbjct: 62 tgatggtgaaccggatgccgcccttcttctggcacgccaccctgc 18
>gb|CV774820.1|CV774820 FGAS069220 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 816
Score = 54.0 bits (27), Expect = 2e-005
Identities = 53/62 (85%)
Strand = Plus / Minus
Query: 576 accggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggcacgatgccgg 635
||||||||||||||| ||| |||||||| |||||||||||||| || || |||||||
Sbjct: 703 accggatgccgcccttcttttggcacgccancctgcggtaggagacggggacaatgccgg 644
Query: 636 cc 637
||
Sbjct: 643 cc 642
>gb|CD934021.1|CD934021 GR45.122L24F010720 GR45 Triticum aestivum cDNA clone GR45122L24,
mRNA sequence
Length = 664
Score = 52.0 bits (26), Expect = 7e-005
Identities = 60/70 (85%), Gaps = 1/70 (1%)
Strand = Plus / Minus
Query: 567 tgatggtgtaccggatgccgccctgcttcgcgcacgccaccctgcggtaggagatcggca 626
|||||||| |||||||||| |||| |||| ||| || |||||| | |||||||| ||||
Sbjct: 618 tgatggtgaaccggatgccccccttcttcacgc-cggcacccttctgtaggagacgggca 560
Query: 627 cgatgccggc 636
||||||||||
Sbjct: 559 cgatgccggc 550
>gb|BE400943.1|BE400943 AWB009.F03F000328 ITEC AWB Wheat Meiotic Stage Library Triticum
aestivum cDNA clone AWB009.F03, mRNA sequence
Length = 393
Score = 48.1 bits (24), Expect = 0.001
Identities = 51/60 (85%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||||||||| || |||||||||| |||| | |||||||||||||| |||||
Sbjct: 63 gtacccgcacgcgccgcccatggtgccggaggcgtcgctgccgccgtagaaggtggcgtg 4
Score = 46.1 bits (23), Expect = 0.005
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 598 gcacgccaccctgcggtaggagatcggcacgatgccggc 636
||||||||||| ||||||||||| || |||||||||||
Sbjct: 381 gcacgccacccggcggtaggagacggggacgatgccggc 343
>gb|BE417174.1|BE417174 MUG017.E03R990204 ITEC MUG Wheat Spikelet Library Triticum aestivum
cDNA clone MUG017.E03, mRNA sequence
Length = 423
Score = 48.1 bits (24), Expect = 0.001
Identities = 51/60 (85%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||||||||| || |||||||||| |||| | |||||||||||||| |||||
Sbjct: 245 gtacccgcacgcgccgcccatggtgccggaggcgtcgctgccgccgtagaaggtggcgtg 186
>gb|BE498867.1|BE498867 WHE0966_A06_B12ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0966_A06_B12, mRNA sequence
Length = 416
Score = 48.1 bits (24), Expect = 0.001
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||||||||| || | ||||||||| |||| | ||||| |||||||| |||||
Sbjct: 231 gtacccgcacgcgccgcccattgtgccggacgcgtcgccgccgccatagaaggtggcgtg 172
Query: 949 ggcg 952
||||
Sbjct: 171 ggcg 168
>gb|BF201351.1|BF201351 WHE0990_E12_J24ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0990_E12_J24, mRNA sequence
Length = 438
Score = 48.1 bits (24), Expect = 0.001
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 889 gtacccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtg 948
||||||||||||||| || | ||||||||| |||| | ||||| |||||||| |||||
Sbjct: 216 gtacccgcacgcgccgcccattgtgccggacgcgtcgccgccgccatagaaggtggcgtg 157
Query: 949 ggcg 952
||||
Sbjct: 156 ggcg 153
>gb|BF201531.1|BF201531 WHE1771_F09_K17ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1771_F09_K17, mRNA sequence
Length = 442
Score = 48.1 bits (24), Expect = 0.001
Identities = 51/60 (85%)
Strand = Plus / Minus
Query: 893 ccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtgggcg 952
||||||||||| || | ||||||||| |||| | |||||||||||||| |||||||||
Sbjct: 214 ccgcacgcgccgcccattgtgccggacgcgtcgccgccgccgtagaaggtggcgtgggcg 155
>gb|BF203005.1|BF203005 WHE1768_C04_E08ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1768_C04_E08, mRNA sequence
Length = 303
Score = 48.1 bits (24), Expect = 0.001
Identities = 78/96 (81%)
Strand = Plus / Minus
Query: 541 caccatgttgaagtacttgttcccggtgatggtgtaccggatgccgccctgcttcgcgca 600
||||| |||||||||| || |||| |||| ||| |||| | |||||| |||| |||
Sbjct: 261 caccaggttgaagtacctgaacccgttgatcgtgaaccgcaccccgcccgacttccggca 202
Query: 601 cgccaccctgcggtaggagatcggcacgatgccggc 636
|||||||| ||||||||||| || |||||||||||
Sbjct: 201 cgccacccggcggtaggagacggggacgatgccggc 166
>gb|BF484994.1|BF484994 WHE1792_A11_A22ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1792_A11_A22, mRNA sequence
Length = 449
Score = 48.1 bits (24), Expect = 0.001
Identities = 51/60 (85%)
Strand = Plus / Minus
Query: 893 ccgcacgcgcccgccgtggtgccggacccgtcccgcccgccgtagaaggtcgcgtgggcg 952
||||||||||| || | ||||||||| |||| | |||||||||||||| |||||||||
Sbjct: 204 ccgcacgcgccgcccattgtgccggacgcgtcgcagccgccgtagaaggtggcgtgggcg 145
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 247,439
Number of Sequences: 636343
Number of extensions: 247439
Number of successful extensions: 69046
Number of sequences better than 0.5: 91
Number of HSP's better than 0.5 without gapping: 81
Number of HSP's successfully gapped in prelim test: 10
Number of HSP's that attempted gapping in prelim test: 68806
Number of HSP's gapped (non-prelim): 243
length of query: 987
length of database: 367,240,239
effective HSP length: 20
effective length of query: 967
effective length of database: 354,513,379
effective search space: 342814437493
effective search space used: 342814437493
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)