BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3042568.2.1
(1174 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA502235.1|CA502235 WHE4044_F09_L18ZT Wheat meiotic anth... 440 e-121
gb|AL820672.1|AL820672 AL820672 O:232 Triticum aestivum cDN... 365 5e-099
gb|CD897587.1|CD897587 G174.106G21F010823 G174 Triticum aes... 248 7e-064
gb|BJ273393.1|BJ273393 BJ273393 Y. Ogihara unpublished cDNA... 222 4e-056
gb|CA650294.1|CA650294 wre1n.pk0150.g10 wre1n Triticum aest... 222 4e-056
gb|CD918312.1|CD918312 G608.108N24F010907 G608 Triticum aes... 222 4e-056
gb|CA667480.1|CA667480 wlsu1.pk015.b6 wlsu1 Triticum aestiv... 163 3e-038
gb|CA670118.1|CA670118 wlsu1.pk025.m7 wlsu1 Triticum aestiv... 163 3e-038
gb|CA733049.1|CA733049 wlp1c.pk006.j16 wlp1c Triticum aesti... 143 3e-032
gb|CA668899.1|CA668899 wlsu1.pk023.i2 wlsu1 Triticum aestiv... 133 3e-029
gb|BQ246010.1|BQ246010 TaE15017C07R TaE15 Triticum aestivum... 121 1e-025
gb|BE428060.1|BE428060 MTD002.H02F990615 ITEC MTD Durum Whe... 109 4e-022
gb|CA669387.1|CA669387 wlsu1.pk022.h13 wlsu1 Triticum aesti... 101 1e-019
gb|CV522741.1|CV522741 LH-363 Triticum aestivum subtracted,... 101 1e-019
gb|DQ086485.1| Triticum aestivum putative 1,3-beta-glucan s... 101 1e-019
gb|CA669450.1|CA669450 wlsu1.pk022.p1 wlsu1 Triticum aestiv... 84 3e-014
gb|CA668332.1|CA668332 wlsu1.pk019.i4 wlsu1 Triticum aestiv... 80 4e-013
gb|CA669530.1|CA669530 wlsu1.pk022.m20 wlsu1 Triticum aesti... 74 2e-011
gb|CA735540.1|CA735540 wpi1s.pk002.l1 wpi1s Triticum aestiv... 58 1e-006
gb|CA736963.1|CA736963 wpi1s.pk009.o22 wpi1s Triticum aesti... 58 1e-006
gb|CA737516.1|CA737516 wpi2s.pk004.i9 wpi2s Triticum aestiv... 58 1e-006
gb|CA739164.1|CA739164 wpi2s.pk009.l22 wpi2s Triticum aesti... 58 1e-006
gb|CA739349.1|CA739349 wpi2s.pk007.e19 wpi2s Triticum aesti... 58 1e-006
gb|CA743676.1|CA743676 wri1s.pk005.e22 wri1s Triticum aesti... 58 1e-006
gb|CA744847.1|CA744847 wri1s.pk009.g10 wri1s Triticum aesti... 58 1e-006
gb|CA744853.1|CA744853 wri1s.pk009.h9 wri1s Triticum aestiv... 58 1e-006
gb|CA668631.1|CA668631 wlsu1.pk020.o18 wlsu1 Triticum aesti... 56 6e-006
gb|CA726538.1|CA726538 wet1s.pk003.n24 wet1s Triticum aesti... 56 6e-006
gb|CA735908.1|CA735908 wpi1s.pk005.g16 wpi1s Triticum aesti... 56 6e-006
gb|CA736477.1|CA736477 wpi1s.pk007.e18 wpi1s Triticum aesti... 56 6e-006
gb|CA737045.1|CA737045 wpi1s.pk009.j6 wpi1s Triticum aestiv... 56 6e-006
gb|CA737517.1|CA737517 wpi2s.pk004.g11 wpi2s Triticum aesti... 56 6e-006
gb|CA737624.1|CA737624 wpi2s.pk004.h23 wpi2s Triticum aesti... 56 6e-006
gb|CA737667.1|CA737667 wpi2s.pk004.k22 wpi2s Triticum aesti... 56 6e-006
gb|CA737680.1|CA737680 wpi2s.pk004.m20 wpi2s Triticum aesti... 56 6e-006
gb|CA737895.1|CA737895 wpi2s.pk005.k13 wpi2s Triticum aesti... 56 6e-006
gb|CA739458.1|CA739458 wpi2s.pk007.k24 wpi2s Triticum aesti... 56 6e-006
gb|CA742481.1|CA742481 wri1s.pk001.a10 wri1s Triticum aesti... 56 6e-006
gb|CA745304.1|CA745304 wri1s.pk003.i15 wri1s Triticum aesti... 56 6e-006
gb|CA746618.1|CA746618 wri2s.pk004.e6 wri2s Triticum aestiv... 56 6e-006
gb|CA747337.1|CA747337 wri2s.pk008.f5.f wri2s Triticum aest... 56 6e-006
gb|AJ602674.1|AJ602674 AJ602674 T06 Triticum aestivum cDNA ... 56 6e-006
gb|AJ602909.1|AJ602909 AJ602909 T06 Triticum aestivum cDNA ... 56 6e-006
gb|AJ603021.1|AJ603021 AJ603021 T06 Triticum aestivum cDNA ... 56 6e-006
gb|AJ603368.1|AJ603368 AJ603368 T06 Triticum aestivum cDNA ... 56 6e-006
gb|CV522241.1|CV522241 RH-658 Triticum aestivum subtracted,... 56 6e-006
gb|DW986534.1|DW986534 01G21 AAFC_CRC Fusarium graminearum ... 56 6e-006
gb|CA735070.1|CA735070 wpi1s.pk003.p19 wpi1s Triticum aesti... 54 2e-005
gb|CA735411.1|CA735411 wpi1s.pk002.b23 wpi1s Triticum aesti... 54 2e-005
gb|CA735655.1|CA735655 wpi1s.pk005.a11 wpi1s Triticum aesti... 54 2e-005
gb|CA735815.1|CA735815 wpi1s.pk005.d17 wpi1s Triticum aesti... 54 2e-005
gb|CA735870.1|CA735870 wpi1s.pk005.l18 wpi1s Triticum aesti... 54 2e-005
gb|CA735968.1|CA735968 wpi1s.pk006.k5 wpi1s Triticum aestiv... 54 2e-005
gb|CA736725.1|CA736725 wpi1s.pk008.k16 wpi1s Triticum aesti... 54 2e-005
gb|CA736780.1|CA736780 wpi1s.pk008.j16 wpi1s Triticum aesti... 54 2e-005
gb|CA737529.1|CA737529 wpi2s.pk004.m17 wpi2s Triticum aesti... 54 2e-005
gb|CA737702.1|CA737702 wpi2s.pk004.o4 wpi2s Triticum aestiv... 54 2e-005
gb|CA737716.1|CA737716 wpi2s.pk004.n23 wpi2s Triticum aesti... 54 2e-005
gb|CA737954.1|CA737954 wpi2s.pk005.l21 wpi2s Triticum aesti... 54 2e-005
gb|CA738131.1|CA738131 wpi2s.pk002.h7 wpi2s Triticum aestiv... 54 2e-005
gb|CA738134.1|CA738134 wpi2s.pk002.n12 wpi2s Triticum aesti... 54 2e-005
gb|CA738209.1|CA738209 wpi2s.pk002.j6 wpi2s Triticum aestiv... 54 2e-005
gb|CA738232.1|CA738232 wpi2s.pk006.e4 wpi2s Triticum aestiv... 54 2e-005
gb|CA738397.1|CA738397 wpi2s.pk006.k8 wpi2s Triticum aestiv... 54 2e-005
gb|CA738414.1|CA738414 wpi2s.pk006.j24 wpi2s Triticum aesti... 54 2e-005
gb|CA738512.1|CA738512 wpi2s.pk008.e13 wpi2s Triticum aesti... 54 2e-005
gb|CA738568.1|CA738568 wpi2s.pk006.l6 wpi2s Triticum aestiv... 54 2e-005
gb|CA738800.1|CA738800 wpi2s.pk008.j21 wpi2s Triticum aesti... 54 2e-005
gb|CA739205.1|CA739205 wpi2s.pk009.p7 wpi2s Triticum aestiv... 54 2e-005
gb|CA739221.1|CA739221 wpi2s.pk005.p24 wpi2s Triticum aesti... 54 2e-005
gb|CA739312.1|CA739312 wpi2s.pk007.c1 wpi2s Triticum aestiv... 54 2e-005
gb|CA739450.1|CA739450 wpi2s.pk007.o22 wpi2s Triticum aesti... 54 2e-005
gb|CA739573.1|CA739573 wpi2s.pk007.h6 wpi2s Triticum aestiv... 54 2e-005
gb|CA739651.1|CA739651 wpi2s.pk010.c17 wpi2s Triticum aesti... 54 2e-005
gb|CA739674.1|CA739674 wpi2s.pk010.c10 wpi2s Triticum aesti... 54 2e-005
gb|CA739821.1|CA739821 wpi2s.pk010.p3 wpi2s Triticum aestiv... 54 2e-005
gb|CA742427.1|CA742427 wri1s.pk001.m15 wri1s Triticum aesti... 54 2e-005
gb|CA742921.1|CA742921 wri1s.pk004.m8 wri1s Triticum aestiv... 54 2e-005
gb|CA743604.1|CA743604 wri1s.pk002.l15 wri1s Triticum aesti... 54 2e-005
gb|CA743651.1|CA743651 wri1s.pk005.o8 wri1s Triticum aestiv... 54 2e-005
gb|CA743771.1|CA743771 wri1s.pk005.l19 wri1s Triticum aesti... 54 2e-005
gb|CA743831.1|CA743831 wri1s.pk005.f8 wri1s Triticum aestiv... 54 2e-005
gb|CA743950.1|CA743950 wri1s.pk006.m15 wri1s Triticum aesti... 54 2e-005
gb|CA744377.1|CA744377 wri1s.pk007.i12 wri1s Triticum aesti... 54 2e-005
gb|CA744384.1|CA744384 wri1s.pk007.l9 wri1s Triticum aestiv... 54 2e-005
gb|CA744932.1|CA744932 wri1s.pk009.n12 wri1s Triticum aesti... 54 2e-005
gb|CA745388.1|CA745388 wri2s.pk001.i9 wri2s Triticum aestiv... 54 2e-005
gb|CA745603.1|CA745603 wri2s.pk002.i14 wri2s Triticum aesti... 54 2e-005
gb|CA745606.1|CA745606 wri2s.pk002.i15 wri2s Triticum aesti... 54 2e-005
gb|CA745629.1|CA745629 wri2s.pk002.g13 wri2s Triticum aesti... 54 2e-005
gb|CA745717.1|CA745717 wri2s.pk002.l9 wri2s Triticum aestiv... 54 2e-005
gb|CA745729.1|CA745729 wri2s.pk002.f1 wri2s Triticum aestiv... 54 2e-005
gb|CA745895.1|CA745895 wri2s.pk003.d4 wri2s Triticum aestiv... 54 2e-005
gb|CA745980.1|CA745980 wri2s.pk003.c21 wri2s Triticum aesti... 54 2e-005
gb|CA746059.1|CA746059 wri2s.pk003.m10 wri2s Triticum aesti... 54 2e-005
gb|CA746078.1|CA746078 wri2s.pk003.g8 wri2s Triticum aestiv... 54 2e-005
gb|CA746454.1|CA746454 wri2s.pk007.a20 wri2s Triticum aesti... 54 2e-005
gb|CA746729.1|CA746729 wri2s.pk004.j14 wri2s Triticum aesti... 54 2e-005
gb|CA746752.1|CA746752 wri2s.pk004.p18 wri2s Triticum aesti... 54 2e-005
gb|CA747056.1|CA747056 wri2s.pk007.b19 wri2s Triticum aesti... 54 2e-005
gb|AJ602470.1|AJ602470 AJ602470 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602473.1|AJ602473 AJ602473 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602517.1|AJ602517 AJ602517 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602557.1|AJ602557 AJ602557 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602869.1|AJ602869 AJ602869 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602881.1|AJ602881 AJ602881 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602886.1|AJ602886 AJ602886 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602899.1|AJ602899 AJ602899 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602934.1|AJ602934 AJ602934 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ602963.1|AJ602963 AJ602963 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ603014.1|AJ603014 AJ603014 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ603028.1|AJ603028 AJ603028 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ603086.1|AJ603086 AJ603086 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ603096.1|AJ603096 AJ603096 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ603245.1|AJ603245 AJ603245 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ603384.1|AJ603384 AJ603384 T06 Triticum aestivum cDNA ... 54 2e-005
gb|AJ603414.1|AJ603414 AJ603414 T06 Triticum aestivum cDNA ... 54 2e-005
gb|CV522705.1|CV522705 LH-311 Triticum aestivum subtracted,... 54 2e-005
gb|CV523060.1|CV523060 LP-93 Triticum aestivum subtracted, ... 54 2e-005
gb|DV799721.1|DV799721 12E11 AAFC_CRC Fusarium graminearum ... 54 2e-005
gb|CA612946.1|CA612946 wr1.pk0149.f7 wr1 Triticum aestivum ... 52 9e-005
gb|CA725691.1|CA725691 wet1s.pk001.k18 wet1s Triticum aesti... 52 9e-005
gb|CA725759.1|CA725759 wet1s.pk001.o10 wet1s Triticum aesti... 52 9e-005
gb|CA725769.1|CA725769 wet1s.pk001.g3 wet1s Triticum aestiv... 52 9e-005
gb|CA725877.1|CA725877 wet1s.pk001.i17 wet1s Triticum aesti... 52 9e-005
gb|CA725958.1|CA725958 wet1s.pk001.l7 wet1s Triticum aestiv... 52 9e-005
gb|CA725969.1|CA725969 wet1s.pk001.d8 wet1s Triticum aestiv... 52 9e-005
gb|CA726028.1|CA726028 wet1s.pk002.m21 wet1s Triticum aesti... 52 9e-005
gb|CA726040.1|CA726040 wet1s.pk002.g23 wet1s Triticum aesti... 52 9e-005
gb|CA726278.1|CA726278 wet1s.pk002.n24 wet1s Triticum aesti... 52 9e-005
gb|CA726309.1|CA726309 wet1s.pk002.l14 wet1s Triticum aesti... 52 9e-005
gb|CA726531.1|CA726531 wet1s.pk003.a19 wet1s Triticum aesti... 52 9e-005
gb|CA726573.1|CA726573 wet1s.pk003.l12 wet1s Triticum aesti... 52 9e-005
gb|CA726578.1|CA726578 wet1s.pk003.n12 wet1s Triticum aesti... 52 9e-005
gb|CA734844.1|CA734844 wpi1s.pk002.a12 wpi1s Triticum aesti... 52 9e-005
gb|CA734890.1|CA734890 wpi1s.pk002.g12 wpi1s Triticum aesti... 52 9e-005
gb|CA734899.1|CA734899 wpi1s.pk002.m8 wpi1s Triticum aestiv... 52 9e-005
gb|CA735077.1|CA735077 wpi1s.pk003.h17 wpi1s Triticum aesti... 52 9e-005
gb|CA735115.1|CA735115 wpi1s.pk003.p23 wpi1s Triticum aesti... 52 9e-005
gb|CA735122.1|CA735122 wpi1s.pk003.l21 wpi1s Triticum aesti... 52 9e-005
gb|CA735229.1|CA735229 wpi1s.pk003.f18 wpi1s Triticum aesti... 52 9e-005
gb|CA735235.1|CA735235 wpi1s.pk003.j8 wpi1s Triticum aestiv... 52 9e-005
gb|CA735294.1|CA735294 wpi1s.pk004.l15 wpi1s Triticum aesti... 52 9e-005
gb|CA735353.1|CA735353 wpi1s.pk004.h3 wpi1s Triticum aestiv... 52 9e-005
gb|CA735450.1|CA735450 wpi1s.pk003.g24 wpi1s Triticum aesti... 52 9e-005
gb|CA735623.1|CA735623 wpi1s.pk004.l10 wpi1s Triticum aesti... 52 9e-005
gb|CA735748.1|CA735748 wpi1s.pk004.h4 wpi1s Triticum aestiv... 52 9e-005
gb|CA735925.1|CA735925 wpi1s.pk006.g1 wpi1s Triticum aestiv... 52 9e-005
gb|CA735945.1|CA735945 wpi1s.pk005.p20 wpi1s Triticum aesti... 52 9e-005
gb|CA736024.1|CA736024 wpi1s.pk006.m15 wpi1s Triticum aesti... 52 9e-005
gb|CA736126.1|CA736126 wpi1s.pk006.a17 wpi1s Triticum aesti... 52 9e-005
gb|CA736141.1|CA736141 wpi1s.pk006.i7 wpi1s Triticum aestiv... 52 9e-005
gb|CA736204.1|CA736204 wpi1s.pk006.h20 wpi1s Triticum aesti... 52 9e-005
gb|CA736213.1|CA736213 wpi1s.pk006.b14 wpi1s Triticum aesti... 52 9e-005
gb|CA736255.1|CA736255 wpi1s.pk006.j8 wpi1s Triticum aestiv... 52 9e-005
gb|CA736293.1|CA736293 wpi1s.pk007.m21 wpi1s Triticum aesti... 52 9e-005
gb|CA736447.1|CA736447 wpi1s.pk007.d22 wpi1s Triticum aesti... 52 9e-005
gb|CA736479.1|CA736479 wpi1s.pk007.i22 wpi1s Triticum aesti... 52 9e-005
gb|CA736526.1|CA736526 wpi1s.pk007.k10 wpi1s Triticum aesti... 52 9e-005
gb|CA736568.1|CA736568 wpi1s.pk007.p8 wpi1s Triticum aestiv... 52 9e-005
gb|CA736744.1|CA736744 wpi1s.pk008.h7 wpi1s Triticum aestiv... 52 9e-005
gb|CA736748.1|CA736748 wpi1s.pk008.h19 wpi1s Triticum aesti... 52 9e-005
gb|CA736796.1|CA736796 wpi1s.pk008.p12 wpi1s Triticum aesti... 52 9e-005
gb|CA736882.1|CA736882 wpi1s.pk008.j6 wpi1s Triticum aestiv... 52 9e-005
gb|CA736997.1|CA736997 wpi1s.pk009.e12 wpi1s Triticum aesti... 52 9e-005
gb|CA737028.1|CA737028 wpi1s.pk009.l18 wpi1s Triticum aesti... 52 9e-005
gb|CA737088.1|CA737088 wpi1s.pk009.b17 wpi1s Triticum aesti... 52 9e-005
gb|CA737126.1|CA737126 wpi1s.pk009.d11 wpi1s Triticum aesti... 52 9e-005
gb|CA737646.1|CA737646 wpi2s.pk004.d20 wpi2s Triticum aesti... 52 9e-005
gb|CA737762.1|CA737762 wpi2s.pk004.f4 wpi2s Triticum aestiv... 52 9e-005
gb|CA737925.1|CA737925 wpi2s.pk005.m3 wpi2s Triticum aestiv... 52 9e-005
gb|CA737950.1|CA737950 wpi2s.pk005.h7 wpi2s Triticum aestiv... 52 9e-005
gb|CA737964.1|CA737964 wpi2s.pk005.p13 wpi2s Triticum aesti... 52 9e-005
gb|CA737996.1|CA737996 wpi2s.pk005.d3 wpi2s Triticum aestiv... 52 9e-005
gb|CA738024.1|CA738024 wpi2s.pk002.d22 wpi2s Triticum aesti... 52 9e-005
gb|CA738199.1|CA738199 wpi2s.pk002.b22 wpi2s Triticum aesti... 52 9e-005
gb|CA738243.1|CA738243 wpi2s.pk006.b13 wpi2s Triticum aesti... 52 9e-005
gb|CA738291.1|CA738291 wpi2s.pk006.b5 wpi2s Triticum aestiv... 52 9e-005
gb|CA738407.1|CA738407 wpi2s.pk006.p18 wpi2s Triticum aesti... 52 9e-005
gb|CA738452.1|CA738452 wpi2s.pk006.j8 wpi2s Triticum aestiv... 52 9e-005
gb|CA738454.1|CA738454 wpi2s.pk006.j6 wpi2s Triticum aestiv... 52 9e-005
gb|CA738472.1|CA738472 wpi2s.pk008.m16 wpi2s Triticum aesti... 52 9e-005
gb|CA738475.1|CA738475 wpi2s.pk008.a6 wpi2s Triticum aestiv... 52 9e-005
gb|CA738487.1|CA738487 wpi2s.pk008.k18 wpi2s Triticum aesti... 52 9e-005
gb|CA738676.1|CA738676 wpi2s.pk002.m13 wpi2s Triticum aesti... 52 9e-005
gb|CA738694.1|CA738694 wpi2s.pk002.i12 wpi2s Triticum aesti... 52 9e-005
gb|CA738871.1|CA738871 wpi2s.pk008.l4 wpi2s Triticum aestiv... 52 9e-005
gb|CA738894.1|CA738894 wpi2s.pk008.d9 wpi2s Triticum aestiv... 52 9e-005
gb|CA738926.1|CA738926 wpi2s.pk009.i5 wpi2s Triticum aestiv... 52 9e-005
gb|CA738953.1|CA738953 wpi2s.pk008.d16 wpi2s Triticum aesti... 52 9e-005
gb|CA739079.1|CA739079 wpi2s.pk009.n21 wpi2s Triticum aesti... 52 9e-005
gb|CA739100.1|CA739100 wpi2s.pk009.d3 wpi2s Triticum aestiv... 52 9e-005
gb|CA739104.1|CA739104 wpi2s.pk009.d6 wpi2s Triticum aestiv... 52 9e-005
gb|CA739202.1|CA739202 wpi2s.pk009.p3 wpi2s Triticum aestiv... 52 9e-005
gb|CA739267.1|CA739267 wpi2s.pk005.d2 wpi2s Triticum aestiv... 52 9e-005
gb|CA739373.1|CA739373 wpi2s.pk007.k10 wpi2s Triticum aesti... 52 9e-005
gb|CA739376.1|CA739376 wpi2s.pk007.e13 wpi2s Triticum aesti... 52 9e-005
gb|CA739394.1|CA739394 wpi2s.pk007.g12 wpi2s Triticum aesti... 52 9e-005
gb|CA739524.1|CA739524 wpi2s.pk007.b16 wpi2s Triticum aesti... 52 9e-005
gb|CA739558.1|CA739558 wpi2s.pk007.p22 wpi2s Triticum aesti... 52 9e-005
gb|CA739581.1|CA739581 wpi2s.pk007.j20 wpi2s Triticum aesti... 52 9e-005
gb|CA739604.1|CA739604 wpi2s.pk010.a13 wpi2s Triticum aesti... 52 9e-005
gb|CA739661.1|CA739661 wpi2s.pk010.e11 wpi2s Triticum aesti... 52 9e-005
gb|CA739696.1|CA739696 wpi2s.pk010.o2 wpi2s Triticum aestiv... 52 9e-005
gb|CA739730.1|CA739730 wpi2s.pk010.i8 wpi2s Triticum aestiv... 52 9e-005
gb|CA739745.1|CA739745 wpi2s.pk010.i20 wpi2s Triticum aesti... 52 9e-005
gb|CA739752.1|CA739752 wpi2s.pk010.k15 wpi2s Triticum aesti... 52 9e-005
gb|CA739818.1|CA739818 wpi2s.pk010.n14 wpi2s Triticum aesti... 52 9e-005
gb|CA739832.1|CA739832 wpi2s.pk010.l10 wpi2s Triticum aesti... 52 9e-005
gb|CA742562.1|CA742562 wri1s.pk001.a6 wri1s Triticum aestiv... 52 9e-005
gb|CA742634.1|CA742634 wri1s.pk001.d16 wri1s Triticum aesti... 52 9e-005
gb|CA742691.1|CA742691 wri1s.pk001.j23 wri1s Triticum aesti... 52 9e-005
gb|CA742759.1|CA742759 wri1s.pk004.b11 wri1s Triticum aesti... 52 9e-005
gb|CA742796.1|CA742796 wri1s.pk004.f11 wri1s Triticum aesti... 52 9e-005
gb|CA742832.1|CA742832 wri1s.pk004.c7 wri1s Triticum aestiv... 52 9e-005
gb|CA742886.1|CA742886 wri1s.pk004.c1 wri1s Triticum aestiv... 52 9e-005
gb|CA742907.1|CA742907 wri1s.pk004.c2 wri1s Triticum aestiv... 52 9e-005
gb|CA743000.1|CA743000 wri1s.pk002.e23 wri1s Triticum aesti... 52 9e-005
gb|CA743015.1|CA743015 wri1s.pk002.g23 wri1s Triticum aesti... 52 9e-005
gb|CA743038.1|CA743038 wri1s.pk002.k13 wri1s Triticum aesti... 52 9e-005
gb|CA743092.1|CA743092 wri1s.pk002.m19 wri1s Triticum aesti... 52 9e-005
gb|CA743116.1|CA743116 wri1s.pk004.n18 wri1s Triticum aesti... 52 9e-005
gb|CA743150.1|CA743150 wri1s.pk004.f6 wri1s Triticum aestiv... 52 9e-005
gb|CA743221.1|CA743221 wri1s.pk002.l16 wri1s Triticum aesti... 52 9e-005
gb|CA743224.1|CA743224 wri1s.pk002.j18 wri1s Triticum aesti... 52 9e-005
gb|CA743260.1|CA743260 wri1s.pk002.a22 wri1s Triticum aesti... 52 9e-005
gb|CA743288.1|CA743288 wri1s.pk002.m20 wri1s Triticum aesti... 52 9e-005
gb|CA743351.1|CA743351 wri1s.pk005.m9 wri1s Triticum aestiv... 52 9e-005
gb|CA743362.1|CA743362 wri1s.pk005.i11 wri1s Triticum aesti... 52 9e-005
gb|CA743432.1|CA743432 wri1s.pk003.i16 wri1s Triticum aesti... 52 9e-005
gb|CA743566.1|CA743566 wri1s.pk003.l13 wri1s Triticum aesti... 52 9e-005
gb|CA743641.1|CA743641 wri1s.pk005.i22 wri1s Triticum aesti... 52 9e-005
gb|CA743700.1|CA743700 wri1s.pk005.m12 wri1s Triticum aesti... 52 9e-005
gb|CA743754.1|CA743754 wri1s.pk005.f15 wri1s Triticum aesti... 52 9e-005
gb|CA743904.1|CA743904 wri1s.pk006.i5 wri1s Triticum aestiv... 52 9e-005
gb|CA743942.1|CA743942 wri1s.pk006.a7 wri1s Triticum aestiv... 52 9e-005
gb|CA743994.1|CA743994 wri1s.pk006.g13 wri1s Triticum aesti... 52 9e-005
gb|CA744018.1|CA744018 wri1s.pk006.j11 wri1s Triticum aesti... 52 9e-005
gb|CA744021.1|CA744021 wri1s.pk006.j19 wri1s Triticum aesti... 52 9e-005
gb|CA744108.1|CA744108 wri1s.pk006.j20 wri1s Triticum aesti... 52 9e-005
gb|CA744151.1|CA744151 wri1s.pk006.j12 wri1s Triticum aesti... 52 9e-005
gb|CA744160.1|CA744160 wri1s.pk006.f12 wri1s Triticum aesti... 52 9e-005
gb|CA744501.1|CA744501 wri1s.pk007.d22 wri1s Triticum aesti... 52 9e-005
gb|CA744517.1|CA744517 wri1s.pk008.b17 wri1s Triticum aesti... 52 9e-005
gb|CA744562.1|CA744562 wri1s.pk008.h21 wri1s Triticum aesti... 52 9e-005
gb|CA744586.1|CA744586 wri1s.pk008.l19 wri1s Triticum aesti... 52 9e-005
gb|CA744588.1|CA744588 wri1s.pk008.n7 wri1s Triticum aestiv... 52 9e-005
gb|CA744604.1|CA744604 wri1s.pk008.b18 wri1s Triticum aesti... 52 9e-005
gb|CA744623.1|CA744623 wri1s.pk008.b8 wri1s Triticum aestiv... 52 9e-005
gb|CA744654.1|CA744654 wri1s.pk008.h14 wri1s Triticum aesti... 52 9e-005
gb|CA744766.1|CA744766 wri1s.pk009.m21 wri1s Triticum aesti... 52 9e-005
gb|CA744833.1|CA744833 wri1s.pk009.k16 wri1s Triticum aesti... 52 9e-005
gb|CA744962.1|CA744962 wri1s.pk009.l15 wri1s Triticum aesti... 52 9e-005
gb|CA744982.1|CA744982 wri1s.pk009.j22 wri1s Triticum aesti... 52 9e-005
gb|CA744996.1|CA744996 wri1s.pk009.p6 wri1s Triticum aestiv... 52 9e-005
gb|CA745113.1|CA745113 wri1s.pk008.c8 wri1s Triticum aestiv... 52 9e-005
gb|CA745146.1|CA745146 wri1s.pk008.m21 wri1s Triticum aesti... 52 9e-005
gb|CA745319.1|CA745319 wri1s.pk003.m23 wri1s Triticum aesti... 52 9e-005
gb|CA745460.1|CA745460 wri2s.pk001.h17 wri2s Triticum aesti... 52 9e-005
gb|CA745662.1|CA745662 wri2s.pk002.a23 wri2s Triticum aesti... 52 9e-005
gb|CA745727.1|CA745727 wri2s.pk002.k6 wri2s Triticum aestiv... 52 9e-005
gb|CA745799.1|CA745799 wri2s.pk002.n2 wri2s Triticum aestiv... 52 9e-005
gb|CA745882.1|CA745882 wri2s.pk003.b21 wri2s Triticum aesti... 52 9e-005
gb|CA746063.1|CA746063 wri2s.pk003.o20 wri2s Triticum aesti... 52 9e-005
gb|CA746166.1|CA746166 wri2s.pk005.a21 wri2s Triticum aesti... 52 9e-005
gb|CA746348.1|CA746348 wri2s.pk005.j21 wri2s Triticum aesti... 52 9e-005
gb|CA746439.1|CA746439 wri2s.pk007.e11 wri2s Triticum aesti... 52 9e-005
gb|CA746502.1|CA746502 wri2s.pk007.g14 wri2s Triticum aesti... 52 9e-005
gb|CA746628.1|CA746628 wri2s.pk004.i7 wri2s Triticum aestiv... 52 9e-005
gb|CA746719.1|CA746719 wri2s.pk004.j3 wri2s Triticum aestiv... 52 9e-005
gb|CA746886.1|CA746886 wri2s.pk006.c10 wri2s Triticum aesti... 52 9e-005
gb|CA746960.1|CA746960 wri2s.pk006.f4 wri2s Triticum aestiv... 52 9e-005
gb|CA747104.1|CA747104 wri2s.pk007.d6 wri2s Triticum aestiv... 52 9e-005
gb|CA747147.1|CA747147 wri2s.pk007.n24 wri2s Triticum aesti... 52 9e-005
gb|CA747338.1|CA747338 wri2s.pk008.f9.f wri2s Triticum aest... 52 9e-005
gb|CB275421.1|CB275421 WLR15I-15C_ID01 Subtracted wheat lea... 52 9e-005
gb|CB275425.1|CB275425 WLR15I-15C_IDO8 Subtracted wheat lea... 52 9e-005
gb|AJ602461.1|AJ602461 AJ602461 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602482.1|AJ602482 AJ602482 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602523.1|AJ602523 AJ602523 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602536.1|AJ602536 AJ602536 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602593.1|AJ602593 AJ602593 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602599.1|AJ602599 AJ602599 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602602.1|AJ602602 AJ602602 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602662.1|AJ602662 AJ602662 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602676.1|AJ602676 AJ602676 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602697.1|AJ602697 AJ602697 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602702.1|AJ602702 AJ602702 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602745.1|AJ602745 AJ602745 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602782.1|AJ602782 AJ602782 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602812.1|AJ602812 AJ602812 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602815.1|AJ602815 AJ602815 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602855.1|AJ602855 AJ602855 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602859.1|AJ602859 AJ602859 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602888.1|AJ602888 AJ602888 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602904.1|AJ602904 AJ602904 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602960.1|AJ602960 AJ602960 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602968.1|AJ602968 AJ602968 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ602996.1|AJ602996 AJ602996 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603018.1|AJ603018 AJ603018 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603023.1|AJ603023 AJ603023 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603060.1|AJ603060 AJ603060 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603069.1|AJ603069 AJ603069 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603083.1|AJ603083 AJ603083 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603118.1|AJ603118 AJ603118 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603155.1|AJ603155 AJ603155 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603209.1|AJ603209 AJ603209 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603220.1|AJ603220 AJ603220 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603283.1|AJ603283 AJ603283 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603285.1|AJ603285 AJ603285 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603374.1|AJ603374 AJ603374 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603377.1|AJ603377 AJ603377 T06 Triticum aestivum cDNA ... 52 9e-005
gb|AJ603387.1|AJ603387 AJ603387 T06 Triticum aestivum cDNA ... 52 9e-005
gb|CV522735.1|CV522735 LH-351 Triticum aestivum subtracted,... 52 9e-005
gb|CV522825.1|CV522825 LH-169 Triticum aestivum subtracted,... 52 9e-005
gb|CV522834.1|CV522834 LH-180 Triticum aestivum subtracted,... 52 9e-005
gb|CV522852.1|CV522852 LH-210 Triticum aestivum subtracted,... 52 9e-005
gb|CV522895.1|CV522895 LH-28 Triticum aestivum subtracted, ... 52 9e-005
gb|CV522907.1|CV522907 LH-41 Triticum aestivum subtracted, ... 52 9e-005
gb|CV522996.1|CV522996 LH-A82 Triticum aestivum subtracted,... 52 9e-005
gb|CV523154.1|CV523154 LP-251 Triticum aestivum subtracted,... 52 9e-005
gb|DT948978.1|DT948978 14-1-22 SSH-cDNA Library of stripe r... 52 9e-005
gb|DV799619.1|DV799619 05D24 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799635.1|DV799635 06H04 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799657.1|DV799657 07J21 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799682.1|DV799682 09E23 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799683.1|DV799683 09L13 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799684.1|DV799684 09M06 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799696.1|DV799696 10K04 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799701.1|DV799701 11B02 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799703.1|DV799703 11B21 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799706.1|DV799706 11E18 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799712.1|DV799712 11L21 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799718.1|DV799718 12D15 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799742.1|DV799742 14P09 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|DV799754.1|DV799754 15M14 AAFC_CRC Fusarium graminearum ... 52 9e-005
gb|BI750410.1|BI750410 Ta01_08a04_R Ta01_AAFC_ECORC_Fusariu... 50 4e-004
gb|CA667229.1|CA667229 wlsu1.pk0011.d5 wlsu1 Triticum aesti... 50 4e-004
gb|CA667547.1|CA667547 wlsu1.pk017.k7 wlsu1 Triticum aestiv... 50 4e-004
gb|CA668067.1|CA668067 wlsu1.pk017.n22 wlsu1 Triticum aesti... 50 4e-004
gb|CA668147.1|CA668147 wlsu1.pk018.n22 wlsu1 Triticum aesti... 50 4e-004
gb|CA668387.1|CA668387 wlsu1.pk019.j4 wlsu1 Triticum aestiv... 50 4e-004
gb|CA668688.1|CA668688 wlsu1.pk021.j17 wlsu1 Triticum aesti... 50 4e-004
gb|CA668954.1|CA668954 wlsu1.pk023.c10 wlsu1 Triticum aesti... 50 4e-004
gb|CA668970.1|CA668970 wlsu1.pk023.a10 wlsu1 Triticum aesti... 50 4e-004
gb|CA669470.1|CA669470 wlsu1.pk022.e4 wlsu1 Triticum aestiv... 50 4e-004
gb|CA669697.1|CA669697 wlsu1.pk022.b8 wlsu1 Triticum aestiv... 50 4e-004
gb|CA672963.1|CA672963 wlsu2.pk019.f9 wlsu2 Triticum aestiv... 50 4e-004
gb|CA673259.1|CA673259 wlsu2.pk021.c3 wlsu2 Triticum aestiv... 50 4e-004
gb|CA673332.1|CA673332 wlsu2.pk021.h16 wlsu2 Triticum aesti... 50 4e-004
gb|CA673430.1|CA673430 wlsu2.pk022.c15 wlsu2 Triticum aesti... 50 4e-004
gb|CA673633.1|CA673633 wlsu2.pk021.p1 wlsu2 Triticum aestiv... 50 4e-004
gb|CA675558.1|CA675558 wlsu2.pk027.n10 wlsu2 Triticum aesti... 50 4e-004
gb|CA725683.1|CA725683 wet1s.pk001.g2 wet1s Triticum aestiv... 50 4e-004
gb|CA725686.1|CA725686 wet1s.pk001.g20 wet1s Triticum aesti... 50 4e-004
gb|CA725690.1|CA725690 wet1s.pk001.k2 wet1s Triticum aestiv... 50 4e-004
gb|CA725694.1|CA725694 wet1s.pk001.k22 wet1s Triticum aesti... 50 4e-004
gb|CA725706.1|CA725706 wet1s.pk001.e20 wet1s Triticum aesti... 50 4e-004
gb|CA725712.1|CA725712 wet1s.pk001.i24 wet1s Triticum aesti... 50 4e-004
gb|CA725721.1|CA725721 wet1s.pk001.a18 wet1s Triticum aesti... 50 4e-004
gb|CA725723.1|CA725723 wet1s.pk001.a22 wet1s Triticum aesti... 50 4e-004
gb|CA725729.1|CA725729 wet1s.pk001.o4 wet1s Triticum aestiv... 50 4e-004
gb|CA725732.1|CA725732 wet1s.pk001.a4 wet1s Triticum aestiv... 50 4e-004
gb|CA725740.1|CA725740 wet1s.pk001.m10 wet1s Triticum aesti... 50 4e-004
gb|CA725750.1|CA725750 wet1s.pk001.i14 wet1s Triticum aesti... 50 4e-004
gb|CA725756.1|CA725756 wet1s.pk001.e10 wet1s Triticum aesti... 50 4e-004
gb|CA725764.1|CA725764 wet1s.pk001.c15 wet1s Triticum aesti... 50 4e-004
gb|CA725768.1|CA725768 wet1s.pk001.g23 wet1s Triticum aesti... 50 4e-004
gb|CA725774.1|CA725774 wet1s.pk001.k21 wet1s Triticum aesti... 50 4e-004
gb|CA725784.1|CA725784 wet1s.pk001.e3 wet1s Triticum aestiv... 50 4e-004
gb|CA725789.1|CA725789 wet1s.pk001.i3 wet1s Triticum aestiv... 50 4e-004
gb|CA725792.1|CA725792 wet1s.pk001.i23 wet1s Triticum aesti... 50 4e-004
gb|CA725800.1|CA725800 wet1s.pk001.a19 wet1s Triticum aesti... 50 4e-004
gb|CA725801.1|CA725801 wet1s.pk001.a21 wet1s Triticum aesti... 50 4e-004
gb|CA725811.1|CA725811 wet1s.pk001.o5 wet1s Triticum aestiv... 50 4e-004
gb|CA725813.1|CA725813 wet1s.pk001.p11 wet1s Triticum aesti... 50 4e-004
gb|CA725814.1|CA725814 wet1s.pk001.p13 wet1s Triticum aesti... 50 4e-004
gb|CA725829.1|CA725829 wet1s.pk001.f21 wet1s Triticum aesti... 50 4e-004
gb|CA725838.1|CA725838 wet1s.pk001.i9 wet1s Triticum aestiv... 50 4e-004
gb|CA725842.1|CA725842 wet1s.pk001.p17 wet1s Triticum aesti... 50 4e-004
gb|CA725843.1|CA725843 wet1s.pk001.p19 wet1s Triticum aesti... 50 4e-004
gb|CA725858.1|CA725858 wet1s.pk001.f7 wet1s Triticum aestiv... 50 4e-004
gb|CA725861.1|CA725861 wet1s.pk001.j9 wet1s Triticum aestiv... 50 4e-004
gb|CA725867.1|CA725867 wet1s.pk001.l19 wet1s Triticum aesti... 50 4e-004
gb|CA725870.1|CA725870 wet1s.pk001.p5 wet1s Triticum aestiv... 50 4e-004
gb|CA725875.1|CA725875 wet1s.pk001.g9 wet1s Triticum aestiv... 50 4e-004
gb|CA725876.1|CA725876 wet1s.pk001.h13 wet1s Triticum aesti... 50 4e-004
gb|CA725906.1|CA725906 wet1s.pk001.p14 wet1s Triticum aesti... 50 4e-004
gb|CA725914.1|CA725914 wet1s.pk001.f12 wet1s Triticum aesti... 50 4e-004
gb|CA725921.1|CA725921 wet1s.pk001.n14 wet1s Triticum aesti... 50 4e-004
gb|CA725923.1|CA725923 wet1s.pk001.j10 wet1s Triticum aesti... 50 4e-004
gb|CA725927.1|CA725927 wet1s.pk001.j18 wet1s Triticum aesti... 50 4e-004
gb|CA725929.1|CA725929 wet1s.pk001.j22 wet1s Triticum aesti... 50 4e-004
gb|CA725930.1|CA725930 wet1s.pk001.j21 wet1s Triticum aesti... 50 4e-004
gb|CA725931.1|CA725931 wet1s.pk001.j2 wet1s Triticum aestiv... 50 4e-004
gb|CA725948.1|CA725948 wet1s.pk001.f23 wet1s Triticum aesti... 50 4e-004
gb|CA725950.1|CA725950 wet1s.pk001.j6 wet1s Triticum aestiv... 50 4e-004
gb|CA725953.1|CA725953 wet1s.pk001.j23 wet1s Triticum aesti... 50 4e-004
gb|CA725962.1|CA725962 wet1s.pk001.l8 wet1s Triticum aestiv... 50 4e-004
gb|CA725982.1|CA725982 wet1s.pk001.h22 wet1s Triticum aesti... 50 4e-004
gb|CA725984.1|CA725984 wet1s.pk001.h2 wet1s Triticum aestiv... 50 4e-004
gb|CA725988.1|CA725988 wet1s.pk001.h8 wet1s Triticum aestiv... 50 4e-004
gb|CA726000.1|CA726000 wet1s.pk002.a15 wet1s Triticum aesti... 50 4e-004
gb|CA726004.1|CA726004 wet1s.pk002.c17 wet1s Triticum aesti... 50 4e-004
gb|CA726010.1|CA726010 wet1s.pk002.g13 wet1s Triticum aesti... 50 4e-004
gb|CA726015.1|CA726015 wet1s.pk002.k13 wet1s Triticum aesti... 50 4e-004
gb|CA726020.1|CA726020 wet1s.pk002.e11 wet1s Triticum aesti... 50 4e-004
gb|CA726035.1|CA726035 wet1s.pk002.m5 wet1s Triticum aestiv... 50 4e-004
gb|CA726042.1|CA726042 wet1s.pk002.g5 wet1s Triticum aestiv... 50 4e-004
gb|CA726044.1|CA726044 wet1s.pk002.g9 wet1s Triticum aestiv... 50 4e-004
gb|CA726046.1|CA726046 wet1s.pk002.g1 wet1s Triticum aestiv... 50 4e-004
gb|CA726051.1|CA726051 wet1s.pk002.o9 wet1s Triticum aestiv... 50 4e-004
gb|CA726056.1|CA726056 wet1s.pk002.o23 wet1s Triticum aesti... 50 4e-004
gb|CA726070.1|CA726070 wet1s.pk002.c23 wet1s Triticum aesti... 50 4e-004
gb|CA726075.1|CA726075 wet1s.pk002.e1 wet1s Triticum aestiv... 50 4e-004
gb|CA726082.1|CA726082 wet1s.pk002.a12 wet1s Triticum aesti... 50 4e-004
gb|CA726083.1|CA726083 wet1s.pk002.a14 wet1s Triticum aesti... 50 4e-004
gb|CA726086.1|CA726086 wet1s.pk002.c20 wet1s Triticum aesti... 50 4e-004
gb|CA726092.1|CA726092 wet1s.pk002.k18 wet1s Triticum aesti... 50 4e-004
gb|CA726107.1|CA726107 wet1s.pk002.g12 wet1s Triticum aesti... 50 4e-004
gb|CA726130.1|CA726130 wet1s.pk002.a4 wet1s Triticum aestiv... 50 4e-004
gb|CA726131.1|CA726131 wet1s.pk002.m20 wet1s Triticum aesti... 50 4e-004
gb|CA726154.1|CA726154 wet1s.pk002.i6 wet1s Triticum aestiv... 50 4e-004
gb|CA726156.1|CA726156 wet1s.pk002.c6 wet1s Triticum aestiv... 50 4e-004
gb|CA726162.1|CA726162 wet1s.pk002.b19 wet1s Triticum aesti... 50 4e-004
gb|CA726171.1|CA726171 wet1s.pk002.f9 wet1s Triticum aestiv... 50 4e-004
gb|CA726172.1|CA726172 wet1s.pk002.h11 wet1s Triticum aesti... 50 4e-004
gb|CA726174.1|CA726174 wet1s.pk002.h15 wet1s Triticum aesti... 50 4e-004
gb|CA726197.1|CA726197 wet1s.pk002.h9 wet1s Triticum aestiv... 50 4e-004
gb|CA726207.1|CA726207 wet1s.pk002.n19 wet1s Triticum aesti... 50 4e-004
gb|CA726218.1|CA726218 wet1s.pk002.d21 wet1s Triticum aesti... 50 4e-004
gb|CA726222.1|CA726222 wet1s.pk002.d7 wet1s Triticum aestiv... 50 4e-004
gb|CA726225.1|CA726225 wet1s.pk002.l17 wet1s Triticum aesti... 50 4e-004
gb|CA726227.1|CA726227 wet1s.pk002.l21 wet1s Triticum aesti... 50 4e-004
gb|CA726228.1|CA726228 wet1s.pk002.l23 wet1s Triticum aesti... 50 4e-004
gb|CA726234.1|CA726234 wet1s.pk002.b10 wet1s Triticum aesti... 50 4e-004
gb|CA726245.1|CA726245 wet1s.pk002.f8 wet1s Triticum aestiv... 50 4e-004
gb|CA726247.1|CA726247 wet1s.pk002.h18 wet1s Triticum aesti... 50 4e-004
gb|CA726253.1|CA726253 wet1s.pk002.h8 wet1s Triticum aestiv... 50 4e-004
gb|CA726256.1|CA726256 wet1s.pk002.h24 wet1s Triticum aesti... 50 4e-004
gb|CA726272.1|CA726272 wet1s.pk003.a12 wet1s Triticum aesti... 50 4e-004
gb|CA726273.1|CA726273 wet1s.pk003.a14 wet1s Triticum aesti... 50 4e-004
gb|CA726291.1|CA726291 wet1s.pk002.j2 wet1s Triticum aestiv... 50 4e-004
gb|CA726297.1|CA726297 wet1s.pk002.j24 wet1s Triticum aesti... 50 4e-004
gb|CA726306.1|CA726306 wet1s.pk002.d8 wet1s Triticum aestiv... 50 4e-004
gb|CA726308.1|CA726308 wet1s.pk002.l12 wet1s Triticum aesti... 50 4e-004
gb|CA726310.1|CA726310 wet1s.pk002.l16 wet1s Triticum aesti... 50 4e-004
gb|CA726311.1|CA726311 wet1s.pk002.l18 wet1s Triticum aesti... 50 4e-004
gb|CA726328.1|CA726328 wet1s.pk003.a8 wet1s Triticum aestiv... 50 4e-004
gb|CA726331.1|CA726331 wet1s.pk003.g20 wet1s Triticum aesti... 50 4e-004
gb|CA726340.1|CA726340 wet1s.pk003.a20 wet1s Triticum aesti... 50 4e-004
gb|CA726347.1|CA726347 wet1s.pk003.o10 wet1s Triticum aesti... 50 4e-004
gb|CA726350.1|CA726350 wet1s.pk003.k14 wet1s Triticum aesti... 50 4e-004
gb|CA726354.1|CA726354 wet1s.pk003.i24 wet1s Triticum aesti... 50 4e-004
gb|CA726357.1|CA726357 wet1s.pk003.i18 wet1s Triticum aesti... 50 4e-004
gb|CA726373.1|CA726373 wet1s.pk003.m22 wet1s Triticum aesti... 50 4e-004
gb|CA726374.1|CA726374 wet1s.pk003.m24 wet1s Triticum aesti... 50 4e-004
gb|CA726381.1|CA726381 wet1s.pk003.m14 wet1s Triticum aesti... 50 4e-004
gb|CA726398.1|CA726398 wet1s.pk003.f7 wet1s Triticum aestiv... 50 4e-004
gb|CA726401.1|CA726401 wet1s.pk003.b21 wet1s Triticum aesti... 50 4e-004
gb|CA726414.1|CA726414 wet1s.pk003.n21 wet1s Triticum aesti... 50 4e-004
gb|CA726425.1|CA726425 wet1s.pk003.l21 wet1s Triticum aesti... 50 4e-004
gb|CA726426.1|CA726426 wet1s.pk003.p2 wet1s Triticum aestiv... 50 4e-004
gb|CA726433.1|CA726433 wet1s.pk003.p23 wet1s Triticum aesti... 50 4e-004
gb|CA726434.1|CA726434 wet1s.pk003.j1 wet1s Triticum aestiv... 50 4e-004
gb|CA726437.1|CA726437 wet1s.pk003.l11 wet1s Triticum aesti... 50 4e-004
gb|CA726452.1|CA726452 wet1s.pk003.l9 wet1s Triticum aestiv... 50 4e-004
gb|CA726459.1|CA726459 wet1s.pk003.j19 wet1s Triticum aesti... 50 4e-004
gb|CA726484.1|CA726484 wet1s.pk003.d13 wet1s Triticum aesti... 50 4e-004
gb|CA726490.1|CA726490 wet1s.pk003.d4 wet1s Triticum aestiv... 50 4e-004
gb|CA726499.1|CA726499 wet1s.pk003.e7 wet1s Triticum aestiv... 50 4e-004
gb|CA726515.1|CA726515 wet1s.pk003.g11 wet1s Triticum aesti... 50 4e-004
gb|CA726518.1|CA726518 wet1s.pk003.b20 wet1s Triticum aesti... 50 4e-004
gb|CA726519.1|CA726519 wet1s.pk003.b22 wet1s Triticum aesti... 50 4e-004
gb|CA726536.1|CA726536 wet1s.pk003.c21 wet1s Triticum aesti... 50 4e-004
gb|CA726544.1|CA726544 wet1s.pk003.l18 wet1s Triticum aesti... 50 4e-004
gb|CA726548.1|CA726548 wet1s.pk003.p20 wet1s Triticum aesti... 50 4e-004
gb|CA726557.1|CA726557 wet1s.pk003.j18 wet1s Triticum aesti... 50 4e-004
gb|CA726562.1|CA726562 wet1s.pk003.i17 wet1s Triticum aesti... 50 4e-004
gb|CA726565.1|CA726565 wet1s.pk003.o15 wet1s Triticum aesti... 50 4e-004
gb|CA726574.1|CA726574 wet1s.pk003.l14 wet1s Triticum aesti... 50 4e-004
gb|CA726575.1|CA726575 wet1s.pk003.k7 wet1s Triticum aestiv... 50 4e-004
gb|CA726576.1|CA726576 wet1s.pk003.k21 wet1s Triticum aesti... 50 4e-004
gb|CA726600.1|CA726600 wet1s.pk003.g9 wet1s Triticum aestiv... 50 4e-004
gb|CA734638.1|CA734638 wpi1s.pk001.d5 wpi1s Triticum aestiv... 50 4e-004
gb|CA734778.1|CA734778 wpi1s.pk002.i3 wpi1s Triticum aestiv... 50 4e-004
gb|CA734858.1|CA734858 wpi1s.pk002.i4 wpi1s Triticum aestiv... 50 4e-004
gb|CA734862.1|CA734862 wpi1s.pk002.o14 wpi1s Triticum aesti... 50 4e-004
gb|CA734865.1|CA734865 wpi1s.pk002.e16 wpi1s Triticum aesti... 50 4e-004
gb|CA734866.1|CA734866 wpi1s.pk002.e18 wpi1s Triticum aesti... 50 4e-004
gb|CA734869.1|CA734869 wpi1s.pk002.g14 wpi1s Triticum aesti... 50 4e-004
gb|CA734873.1|CA734873 wpi1s.pk002.k16 wpi1s Triticum aesti... 50 4e-004
gb|CA734875.1|CA734875 wpi1s.pk002.k20 wpi1s Triticum aesti... 50 4e-004
gb|CA734876.1|CA734876 wpi1s.pk002.k22 wpi1s Triticum aesti... 50 4e-004
gb|CA734881.1|CA734881 wpi1s.pk002.m16 wpi1s Triticum aesti... 50 4e-004
gb|CA734883.1|CA734883 wpi1s.pk002.m18 wpi1s Triticum aesti... 50 4e-004
gb|CA734893.1|CA734893 wpi1s.pk002.a8 wpi1s Triticum aestiv... 50 4e-004
gb|CA734896.1|CA734896 wpi1s.pk002.g24 wpi1s Triticum aesti... 50 4e-004
gb|CA734916.1|CA734916 wpi1s.pk002.e14 wpi1s Triticum aesti... 50 4e-004
gb|CA734917.1|CA734917 wpi1s.pk002.n10 wpi1s Triticum aesti... 50 4e-004
>gb|CA502235.1|CA502235 WHE4044_F09_L18ZT Wheat meiotic anther cDNA library Triticum aestivum
cDNA clone WHE4044_F09_L18, mRNA sequence
Length = 598
Score = 440 bits (222), Expect = e-121
Identities = 456/534 (85%)
Strand = Plus / Minus
Query: 621 tggaaatgtaccatggccttggggtttaaaccaaagaccaagaggaggatgaaaaggcca 680
|||||||| |||||||||||||||||||| | ||| |||| ||||||| ||||| ||
Sbjct: 592 tggaaatgaaccatggccttggggtttaagctaaataccattaggaggacaaaaagccct 533
Query: 681 ccaagcacagcccaagaaatccaatacaccaataaagctgtacttcctccgctagcattc 740
|||||||| ||||| |||| |||||| ||| |||| | ||||||| || | |||| |
Sbjct: 532 ccaagcactgcccatgaaacccaatataccgataatgttgtactttctttggctgcatgc 473
Query: 741 atgtggtaaacaactccgaattggaaaatgaaaaacctcaggcttaatatggtttccagt 800
||||||||||||||||| | |||||||| ||||| || | || | ||| |||||||||
Sbjct: 472 atgtggtaaacaactccatactggaaaataaaaaatcttaaactaagtatagtttccagt 413
Query: 801 atcctccctcgaatgctgtaaatatgttgcagttcttcttcccaccaagcttcccagctt 860
|||||||| || | | ||| ||||||| ||||||||| |||||||||||||||||||||
Sbjct: 412 atcctcccgcggaaggtgtgaatatgtgccagttcttcatcccaccaagcttcccagctt 353
Query: 861 tcttctcctttaacaccaataccacctcgataaaacagccaatttgtccagtctctgaaa 920
|||||||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||
Sbjct: 352 tcttctcctttaaccccaataccacctcggtaaaaaagccagtttgtccagtctctgaaa 293
Query: 921 tcctcaacaatcttctgccattcaaatccagatgggttaaataaatagggagcaaaaagc 980
||||| || | ||| ||||||||||||||||| ||||| |||| ||| ||||||||||||
Sbjct: 292 tcctcgacgaccttttgccattcaaatccagaagggttgaatacatatggagcaaaaagc 233
Query: 981 caagacaatgccataatccaactgcttatagagagtaaaatatagccaactgctccacca 1040
||||| | ||||||| ||| || ||||| || ||||| |||||||||| ||||||||
Sbjct: 232 caagaaagagccataaaccagctacttatggaaagtaagatatagccaattgctccactg 173
Query: 1041 ttgttaaacccatacgctaggaagatcaccaacaaaagtgcaacctccatccctttcaca 1100
|||||||| ||||| ||||| ||||| ||||||| |||||||||||||| ||||||||||
Sbjct: 172 ttgttaaaaccataagctagaaagataaccaacagaagtgcaacctccagccctttcaca 113
Query: 1101 aaatggcttcgagaataaatacggtagttctcagcaaacttgatatgtcgtacc 1154
||||||||||| ||||||| |||||| |||||||||||||| ||||| ||||||
Sbjct: 112 aaatggcttcgggaataaagacggtaattctcagcaaacttaatatgccgtacc 59
>gb|AL820672.1|AL820672 AL820672 O:232 Triticum aestivum cDNA clone E11_O232_plate_16, mRNA
sequence
Length = 592
Score = 365 bits (184), Expect = 5e-099
Identities = 410/484 (84%), Gaps = 1/484 (0%)
Strand = Plus / Minus
Query: 672 aaaaggccaccaagcacagcccaagaaatccaatacaccaataaagctgtacttcctccg 731
||||| || |||||||||||||| || | |||||| ||| |||| |||||| || || |
Sbjct: 592 aaaagccctccaagcacagcccatgatacccaatataccgataatgctgtattttcttgg 533
Query: 732 ctagcattcatgtggtaaacaactccgaattggaaaatgaaaaacctcaggcttaatatg 791
|| || |||||||||||||||||||| | |||||||| ||||| || | || | |||
Sbjct: 532 cttgctttcatgtggtaaacaactccatactggaaaataaaaaatcttaaactaagtata 473
Query: 792 gtttccagtatcctccctcgaatgctgtaaatatgttgcagttcttcttcccaccaagct 851
||||||| ||||||||| || | | ||| ||||||| ||||||||| ||||||||||||
Sbjct: 472 gtttccattatcctcccgcggaaggtgtgaatatgtgccagttcttcatcccaccaagct 413
Query: 852 tcccagctttcttctcctttaacaccaataccacctcgataaaacagccaatttgtccag 911
||||||||||||||||||||||| |||||||||||||| ||||| ||||| |||||||||
Sbjct: 412 tcccagctttcttctcctttaaccccaataccacctcggtaaaaaagccagtttgtccag 353
Query: 912 tctctgaaatcctcaacaatcttctgccattcaaatccagatgggttaaataaataggga 971
|||||||||||||| || | ||| ||||||||||||||||| ||||| || | || |||
Sbjct: 352 tctctgaaatcctcgacgaccttttgccattcaaatccagacgggttgaacacgtatgga 293
Query: 972 gcaaaaagccaagacaatgccataatccaactgcttatagagagtaaaatatagccaact 1031
|||||||||||||| | ||||||| | | || ||||| || ||||| |||||||||| |
Sbjct: 292 gcaaaaagccaagaaagagccataaactagctacttatggaaagtaagatatagccaatt 233
Query: 1032 gctccaccattgttaaacccatacgctaggaagatcaccaacaaaagtgcaacc-tccat 1090
|||||| |||||||| ||||| ||||| ||||| ||||||| |||||||||| ||||
Sbjct: 232 gctccattgttgttaaaaccataagctagaaagataaccaacagaagtgcaaccttccag 173
Query: 1091 ccctttcacaaaatggcttcgagaataaatacggtagttctcagcaaacttgatatgtcg 1150
||||||||||||||||||||| ||||||| |||||| |||||||||||||| ||||| ||
Sbjct: 172 ccctttcacaaaatggcttcgggaataaagacggtaattctcagcaaacttaatatgccg 113
Query: 1151 tacc 1154
||||
Sbjct: 112 tacc 109
>gb|CD897587.1|CD897587 G174.106G21F010823 G174 Triticum aestivum cDNA clone G174106G21, mRNA
sequence
Length = 424
Score = 248 bits (125), Expect = 7e-064
Identities = 251/293 (85%)
Strand = Plus / Minus
Query: 735 gcattcatgtggtaaacaactccgaattggaaaatgaaaaacctcaggcttaatatggtt 794
|||| |||||||||||||||||| | |||||||| ||||| || | || | ||| |||
Sbjct: 306 gcatgcatgtggtaaacaactccatactggaaaataaaaaatcttaaactaagtatagtt 247
Query: 795 tccagtatcctccctcgaatgctgtaaatatgttgcagttcttcttcccaccaagcttcc 854
|||||||||||||| || | | ||| ||||||| ||||||||| |||||||||||||||
Sbjct: 246 tccagtatcctcccgcggaaggtgtgaatatgtgccagttcttcatcccaccaagcttcc 187
Query: 855 cagctttcttctcctttaacaccaataccacctcgataaaacagccaatttgtccagtct 914
|||||||||||||||||||| |||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 186 cagctttcttctcctttaaccccaataccacctcggtaaaaaagccagtttgtccagtct 127
Query: 915 ctgaaatcctcaacaatcttctgccattcaaatccagatgggttaaataaatagggagca 974
||||||||||| || | ||| ||||||||||||||||| ||||| |||| ||| ||||||
Sbjct: 126 ctgaaatcctcgacgaccttttgccattcaaatccagaagggttgaatacatatggagca 67
Query: 975 aaaagccaagacaatgccataatccaactgcttatagagagtaaaatatagcc 1027
||||||| ||| | ||||||| ||| || ||||| || ||||| ||||||||
Sbjct: 66 aaaagcccagaaagagccataaaccagctacttatggaaagtaagatatagcc 14
>gb|BJ273393.1|BJ273393 BJ273393 Y. Ogihara unpublished cDNA library, Wh_oh Triticum
aestivum cDNA clone whoh17b01 3', mRNA sequence
Length = 468
Score = 222 bits (112), Expect = 4e-056
Identities = 247/292 (84%)
Strand = Plus / Plus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| ||||| |||||||||
Sbjct: 92 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagagaaatctccaaa 151
Query: 291 cctctgctgaacgcctggttgaacagaagtcgcgtctggaaagtggatatgaatggaaac 350
||||||||||| |||||||||||||| || || |||||||| ||||| ||||| ||||||
Sbjct: 152 cctctgctgaaagcctggttgaacagtagccgtgtctggaaggtggagatgaagggaaac 211
Query: 351 cacgagcaaatggctatgggtatgaaaatgaccatccccattccagcatcatagaggcga 410
|| ||||| ||||||||||| | ||||||| ||| ||||| ||||||||||| || |||
Sbjct: 212 caggagcagatggctatgggcacaaaaatgatcattcccatgccagcatcatacagacga 271
Query: 411 gctagggcacgaacagttttccacaaacccaatttcttcacgacaggtttccatgccatg 470
|| || | || || ||||||||||||||||| ||||||| | |||||||||||||
Sbjct: 272 gccagcgagcgcactattttccacaaacccaatctcttcacaattggtttccatgccaca 331
Query: 471 gcaatcgaaatgattccccacccagttggcacaaatgctagaatggaagcaa 522
|||||||||| |||||||| ||||| || ||| ||||||| ||||||||||
Sbjct: 332 gcaatcgaaagaattccccatccagtagggacatatgctaggatggaagcaa 383
>gb|CA650294.1|CA650294 wre1n.pk0150.g10 wre1n Triticum aestivum cDNA clone
wre1n.pk0150.g10 5' end, mRNA sequence
Length = 435
Score = 222 bits (112), Expect = 4e-056
Identities = 247/292 (84%)
Strand = Plus / Minus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| ||||| |||||||||
Sbjct: 339 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagagaaatctccaaa 280
Query: 291 cctctgctgaacgcctggttgaacagaagtcgcgtctggaaagtggatatgaatggaaac 350
||||||||||| |||||||||||||| || || |||||||| ||||| ||||| ||||||
Sbjct: 279 cctctgctgaaagcctggttgaacagtagccgtgtctggaaggtggagatgaagggaaac 220
Query: 351 cacgagcaaatggctatgggtatgaaaatgaccatccccattccagcatcatagaggcga 410
|| ||||| ||||||||||| | ||||||| ||| ||||| ||||||||||| || |||
Sbjct: 219 caggagcagatggctatgggcacaaaaatgatcattcccatgccagcatcatacagacga 160
Query: 411 gctagggcacgaacagttttccacaaacccaatttcttcacgacaggtttccatgccatg 470
|| || | || || ||||||||||||||||| ||||||| | |||||||||||||
Sbjct: 159 gccagcgagcgcactattttccacaaacccaatctcttcacaattggtttccatgccaca 100
Query: 471 gcaatcgaaatgattccccacccagttggcacaaatgctagaatggaagcaa 522
|||||||||| |||||||| ||||| || ||| ||||||| ||||||||||
Sbjct: 99 gcaatcgaaagaattccccatccagtagggacatatgctaggatggaagcaa 48
>gb|CD918312.1|CD918312 G608.108N24F010907 G608 Triticum aestivum cDNA clone G608108N24,
mRNA sequence
Length = 586
Score = 222 bits (112), Expect = 4e-056
Identities = 247/292 (84%)
Strand = Plus / Minus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| ||||| |||||||||
Sbjct: 323 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagagaaatctccaaa 264
Query: 291 cctctgctgaacgcctggttgaacagaagtcgcgtctggaaagtggatatgaatggaaac 350
||||||||||| |||||||||||||| || || |||||||| ||||| ||||| ||||||
Sbjct: 263 cctctgctgaaagcctggttgaacagtagccgtgtctggaaggtggagatgaagggaaac 204
Query: 351 cacgagcaaatggctatgggtatgaaaatgaccatccccattccagcatcatagaggcga 410
|| ||||| ||||||||||| | ||||||| ||| ||||| ||||||||||| || |||
Sbjct: 203 caggagcagatggctatgggcacaaaaatgatcattcccatgccagcatcatacagacga 144
Query: 411 gctagggcacgaacagttttccacaaacccaatttcttcacgacaggtttccatgccatg 470
|| || | || || ||||||||||||| ||| ||||||| | |||||||||||||
Sbjct: 143 gccagcgagcgcactattttccacaaaccaaatctcttcacaattggtttccatgccaca 84
Query: 471 gcaatcgaaatgattccccacccagttggcacaaatgctagaatggaagcaa 522
|||||||||| |||||||| ||||| |||||| ||||||| ||||||||||
Sbjct: 83 gcaatcgaaagaattccccatccagtaggcacatatgctaggatggaagcaa 32
>gb|CA667480.1|CA667480 wlsu1.pk015.b6 wlsu1 Triticum aestivum cDNA clone wlsu1.pk015.b6 5'
end, mRNA sequence
Length = 455
Score = 163 bits (82), Expect = 3e-038
Identities = 157/182 (86%)
Strand = Plus / Minus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| ||||| |||||||||
Sbjct: 228 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagagaaatctccaaa 169
Query: 291 cctctgctgaacgcctggttgaacagaagtcgcgtctggaaagtggatatgaatggaaac 350
||||||||||| |||||||||||||| || || |||||||| ||||| ||||| ||||||
Sbjct: 168 cctctgctgaaagcctggttgaacagtagccgtgtctggaaggtggagatgaagggaaac 109
Query: 351 cacgagcaaatggctatgggtatgaaaatgaccatccccattccagcatcatagaggcga 410
|| ||||| ||||||||||| | ||||||| ||| ||||| ||||||||||| || |||
Sbjct: 108 caggagcagatggctatgggcacaaaaatgatcattcccatgccagcatcatacagacga 49
Query: 411 gc 412
||
Sbjct: 48 gc 47
>gb|CA670118.1|CA670118 wlsu1.pk025.m7 wlsu1 Triticum aestivum cDNA clone wlsu1.pk025.m7 5'
end, mRNA sequence
Length = 460
Score = 163 bits (82), Expect = 3e-038
Identities = 157/182 (86%)
Strand = Plus / Minus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| ||||| |||||||||
Sbjct: 212 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagagaaatctccaaa 153
Query: 291 cctctgctgaacgcctggttgaacagaagtcgcgtctggaaagtggatatgaatggaaac 350
||||||||||| |||||||||||||| || || |||||||| ||||| ||||| ||||||
Sbjct: 152 cctctgctgaaagcctggttgaacagtagccgtgtctggaaggtggagatgaagggaaac 93
Query: 351 cacgagcaaatggctatgggtatgaaaatgaccatccccattccagcatcatagaggcga 410
|| ||||| ||||||||||| | ||||||| ||| ||||| ||||||||||| || |||
Sbjct: 92 caggagcagatggctatgggcacaaaaatgatcattcccatgccagcatcatacagacga 33
Query: 411 gc 412
||
Sbjct: 32 gc 31
>gb|CA733049.1|CA733049 wlp1c.pk006.j16 wlp1c Triticum aestivum cDNA clone wlp1c.pk006.j16
5' end, mRNA sequence
Length = 607
Score = 143 bits (72), Expect = 3e-032
Identities = 90/96 (93%)
Strand = Plus / Minus
Query: 830 cagttcttcttcccaccaagcttcccagctttcttctcctttaacaccaataccacctcg 889
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||
Sbjct: 359 cagttcttcatcccaccaagcttcccagctttcttctcctttaaccccaataccacttcg 300
Query: 890 ataaaacagccaatttgtccagtctctgaaatcctc 925
||||| ||||| |||||||||||||||||||||||
Sbjct: 299 gtaaaaaagccagtttgtccagtctctgaaatcctc 264
Score = 89.7 bits (45), Expect = 4e-016
Identities = 116/139 (83%), Gaps = 1/139 (0%)
Strand = Plus / Minus
Query: 936 tgccattcaaatccagatgggttaaataaatagggagcaaaaagccaagacaatgccata 995
||||||||||||||||| ||||| |||| ||| ||||||||||||||||| | ||||||
Sbjct: 150 tgccattcaaatccagaagggttgaatacatatggagcaaaaagccaagaaagagccata 91
Query: 996 atccaactgcttatagagagtaaaatatagccaactgctccaccattgttaaacccatac 1055
| ||| || |||| | ||||| |||||||||| |||||||| |||||||| |||||
Sbjct: 90 aaccagctactta-nnaaagtaagatatagccaattgctccactgttgttaaaaccataa 32
Query: 1056 gctaggaagatcaccaaca 1074
|||| ||||| |||||||
Sbjct: 31 gctaaaaagataaccaaca 13
>gb|CA668899.1|CA668899 wlsu1.pk023.i2 wlsu1 Triticum aestivum cDNA clone wlsu1.pk023.i2 5'
end, mRNA sequence
Length = 500
Score = 133 bits (67), Expect = 3e-029
Identities = 147/173 (84%), Gaps = 1/173 (0%)
Strand = Plus / Plus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| || || |||||||||
Sbjct: 307 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagggaaatctccaaa 366
Query: 291 cctctgctgaacgcctggttgaacagaagtcgcgtctggaaagtggatatgaatggaaac 350
||||||||||| |||||||||||||| | || |||||||| |||| ||||| ||||||
Sbjct: 367 cctctgctgaaagcctggttgaacagta-ccgtgtctggaaggtggngatgaagggaaac 425
Query: 351 cacgagcaaatggctatgggtatgaaaatgaccatccccattccagcatcata 403
|| ||||| ||||||||||| | ||||||| ||| ||||| |||||||||||
Sbjct: 426 caagagcanatggctatgggcacaaaaatgatcattcccatgccagcatcata 478
>gb|BQ246010.1|BQ246010 TaE15017C07R TaE15 Triticum aestivum cDNA clone TaE15017C07R, mRNA
sequence
Length = 653
Score = 121 bits (61), Expect = 1e-025
Identities = 85/93 (91%)
Strand = Plus / Minus
Query: 1062 aagatcaccaacaaaagtgcaacctccatccctttcacaaaatggcttcgagaataaata 1121
||||| ||||||| |||||||||||||| ||||||||||||||||||||| ||||||| |
Sbjct: 642 aagataaccaacagaagtgcaacctccagccctttcacaaaatggcttcgggaataaaga 583
Query: 1122 cggtagttctcagcaaacttgatatgtcgtacc 1154
||||| |||||||||||||| ||||| ||||||
Sbjct: 582 cggtaattctcagcaaacttaatatgccgtacc 550
>gb|BE428060.1|BE428060 MTD002.H02F990615 ITEC MTD Durum Wheat Root Library Triticum
turgidum subsp. durum cDNA clone MTD002.H02, mRNA
sequence
Length = 391
Score = 109 bits (55), Expect = 4e-022
Identities = 130/155 (83%)
Strand = Plus / Minus
Query: 597 cttttgaccaaacgcaggaacaattggaaatgtaccatggccttggggtttaaaccaaag 656
|||||||||| |||||||| ||| |||||||| |||||||||||||||||||||| |||
Sbjct: 155 cttttgaccagacgcaggagcaactggaaatgaaccatggccttggggtttaaactaaat 96
Query: 657 accaagaggaggatgaaaaggccaccaagcacagcccaagaaatccaatacaccaataaa 716
|||| ||||||| ||||| || |||||||| ||||| |||| |||||| ||| ||||
Sbjct: 95 accattaggaggacaaaaagccctccaagcactgcccatgaaacccaatataccgataat 36
Query: 717 gctgtacttcctccgctagcattcatgtggtaaac 751
| ||||||| || || |||| ||||||||||||
Sbjct: 35 gatgtactttctttgcctgcatgcatgtggtaaac 1
Score = 99.6 bits (50), Expect = 4e-019
Identities = 134/162 (82%)
Strand = Plus / Minus
Query: 361 tggctatgggtatgaaaatgaccatccccattccagcatcatagaggcgagctagggcac 420
|||||||||| | ||||||| ||| ||||| ||||||||||| || ||||| || | |
Sbjct: 391 tggctatgggcacaaaaatgatcattcccatgccagcatcatacagacgagccagcgagc 332
Query: 421 gaacagttttccacaaacccaatttcttcacgacaggtttccatgccatggcaatcgaaa 480
| || ||||||||||||| ||| ||||||| | ||||||||||||| ||||||||||
Sbjct: 331 gcactattttccacaaaccaaatctcttcacaattggtttccatgccacagcaatcgaaa 272
Query: 481 tgattccccacccagttggcacaaatgctagaatggaagcaa 522
|||||||| ||||| |||||| ||||||| ||||||||||
Sbjct: 271 gaattccccatccagtaggcacatatgctaggatggaagcaa 230
>gb|CA669387.1|CA669387 wlsu1.pk022.h13 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.h13
5' end, mRNA sequence
Length = 437
Score = 101 bits (51), Expect = 1e-019
Identities = 106/123 (86%), Gaps = 1/123 (0%)
Strand = Plus / Plus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| ||||| |||||||||
Sbjct: 305 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagagaaatctccaaa 364
Query: 291 cctctgctgaacgcctggttgaacagaagtcgcgtctggaa-agtggatatgaatggaaa 349
||||||||||| |||||||||||||| | || |||||||| ||||| ||||| |||||
Sbjct: 365 cctctgctgaaagcctggttgaacagtaaccgtgtctggaagggtggagatgaagggaaa 424
Query: 350 cca 352
|||
Sbjct: 425 cca 427
>gb|CV522741.1|CV522741 LH-363 Triticum aestivum subtracted, clontech Triticum aestivum
cDNA, mRNA sequence
Length = 193
Score = 101 bits (51), Expect = 1e-019
Identities = 102/119 (85%)
Strand = Plus / Minus
Query: 597 cttttgaccaaacgcaggaacaattggaaatgtaccatggccttggggtttaaaccaaag 656
|||||||||| |||||||| ||| |||||||| |||||||||||||||||||||| |||
Sbjct: 123 cttttgaccagacgcaggagcaactggaaatgaaccatggccttggggtttaaactaaat 64
Query: 657 accaagaggaggatgaaaaggccaccaagcacagcccaagaaatccaatacaccaataa 715
|||| ||||||| ||||| || |||||||| ||||| |||| |||||| ||| ||||
Sbjct: 63 accattaggaggacaaaaagccctccaagcactgcccatgaaacccaatataccgataa 5
>gb|DQ086485.1| Triticum aestivum putative 1,3-beta-glucan synthase 8 (GSL8) mRNA,
partial cds
Length = 580
Score = 101 bits (51), Expect = 1e-019
Identities = 69/75 (92%)
Strand = Plus / Minus
Query: 1080 gcaacctccatccctttcacaaaatggcttcgagaataaatacggtagttctcagcaaac 1139
|||||||||| ||||||||||||||||||||| ||||||| |||||| ||||||||||||
Sbjct: 580 gcaacctccagccctttcacaaaatggcttcgggaataaagacggtaattctcagcaaac 521
Query: 1140 ttgatatgtcgtacc 1154
|| ||||| ||||||
Sbjct: 520 ttaatatgccgtacc 506
>gb|CA669450.1|CA669450 wlsu1.pk022.p1 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.p1 5'
end, mRNA sequence
Length = 443
Score = 83.8 bits (42), Expect = 3e-014
Identities = 69/78 (88%)
Strand = Plus / Plus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| ||||| ||||| |||||||||
Sbjct: 304 tgccaccatcatatgcctgcattctgattgttgccagccaggatgagagaaatctccaaa 363
Query: 291 cctctgctgaacgcctgg 308
||||||||||| ||||||
Sbjct: 364 cctctgctgaaagcctgg 381
>gb|CA668332.1|CA668332 wlsu1.pk019.i4 wlsu1 Triticum aestivum cDNA clone wlsu1.pk019.i4 5'
end, mRNA sequence
Length = 445
Score = 79.8 bits (40), Expect = 4e-013
Identities = 111/131 (84%), Gaps = 3/131 (2%)
Strand = Plus / Plus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaagg-atcagagatatctccaa 289
||||||||||| || || ||||| ||||||||||||| ||| || ||||| ||||||||
Sbjct: 306 tgccaccatcatatgcctgcattctgattgttgccagccagggatgagagaaatctccaa 365
Query: 290 acctctgctgaacgcctggttgaac-agaagtcgcgtctggaaagtgga-tatgaatgga 347
|||||||||||| |||||| ||||| || || || |||||||| ||||| ||||| |||
Sbjct: 366 acctctgctgaaagcctggntgaacaagtagccgtgtctggaaggtggagaatgaaggga 425
Query: 348 aaccacgagca 358
||||| |||||
Sbjct: 426 aaccaggagca 436
>gb|CA669530.1|CA669530 wlsu1.pk022.m20 wlsu1 Triticum aestivum cDNA clone wlsu1.pk022.m20
5' end, mRNA sequence
Length = 425
Score = 73.8 bits (37), Expect = 2e-011
Identities = 71/81 (87%), Gaps = 1/81 (1%)
Strand = Plus / Plus
Query: 231 tgccaccatcagatcccagcatttggattgttgcca-gcaaggatcagagatatctccaa 289
||||||||||| || || ||||| ||||||||||| || ||||| ||||| ||||||||
Sbjct: 307 tgccaccatcatatgcctgcattctgattgttgccaagccaggatgagagaaatctccaa 366
Query: 290 acctctgctgaacgcctggtt 310
|||||||||||| ||||||||
Sbjct: 367 acctctgctgaaagcctggtt 387
>gb|CA735540.1|CA735540 wpi1s.pk002.l1 wpi1s Triticum aestivum cDNA clone wpi1s.pk002.l1 5'
end, mRNA sequence
Length = 283
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 255 tgtcgtacctgcccgggcggccgctcgaa 283
>gb|CA736963.1|CA736963 wpi1s.pk009.o22 wpi1s Triticum aestivum cDNA clone wpi1s.pk009.o22 5'
end, mRNA sequence
Length = 275
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 247 tgtcgtacctgcccgggcggccgctcgaa 275
>gb|CA737516.1|CA737516 wpi2s.pk004.i9 wpi2s Triticum aestivum cDNA clone wpi2s.pk004.i9 5'
end, mRNA sequence
Length = 354
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 326 tgtcgtacctgcccgggcggccgctcgaa 354
>gb|CA739164.1|CA739164 wpi2s.pk009.l22 wpi2s Triticum aestivum cDNA clone wpi2s.pk009.l22 5'
end, mRNA sequence
Length = 354
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 326 tgtcgtacctgcccgggcggccgctcgaa 354
>gb|CA739349.1|CA739349 wpi2s.pk007.e19 wpi2s Triticum aestivum cDNA clone wpi2s.pk007.e19 5'
end, mRNA sequence
Length = 361
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 326 tgtcgtacctgcccgggcggccgctcgaa 354
>gb|CA743676.1|CA743676 wri1s.pk005.e22 wri1s Triticum aestivum cDNA clone wri1s.pk005.e22 5'
end, mRNA sequence
Length = 489
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Minus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 29 tgtcgtacctgcccgggcggccgctcgaa 1
>gb|CA744847.1|CA744847 wri1s.pk009.g10 wri1s Triticum aestivum cDNA clone wri1s.pk009.g10 5'
end, mRNA sequence
Length = 217
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Minus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 29 tgtcgtacctgcccgggcggccgctcgaa 1
>gb|CA744853.1|CA744853 wri1s.pk009.h9 wri1s Triticum aestivum cDNA clone wri1s.pk009.h9 5'
end, mRNA sequence
Length = 217
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Minus
Query: 1146 tgtcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||||
Sbjct: 29 tgtcgtacctgcccgggcggccgctcgaa 1
>gb|CA668631.1|CA668631 wlsu1.pk020.o18 wlsu1 Triticum aestivum cDNA clone wlsu1.pk020.o18
5' end, mRNA sequence
Length = 526
Score = 56.0 bits (28), Expect = 6e-006
Identities = 62/72 (86%), Gaps = 1/72 (1%)
Strand = Plus / Plus
Query: 231 tgccaccatcagatcccagcatttggattgttgccagcaaggatcagagatatctccaaa 290
||||||||||| || || ||||| ||||||||||||| | ||| ||||| |||||||||
Sbjct: 305 tgccaccatcatatgcctgcattctgattgttgccagccaagatgagagaaatctccaaa 364
Query: 291 cct-ctgctgaa 301
||| ||||||||
Sbjct: 365 cctnctgctgaa 376
>gb|CA726538.1|CA726538 wet1s.pk003.n24 wet1s Triticum aestivum cDNA clone wet1s.pk003.n24 5'
end, mRNA sequence
Length = 295
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 268 gtcgtacctgcccgggcggccgctcgaa 295
>gb|CA735908.1|CA735908 wpi1s.pk005.g16 wpi1s Triticum aestivum cDNA clone wpi1s.pk005.g16 5'
end, mRNA sequence
Length = 328
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 301 gtcgtacctgcccgggcggccgctcgaa 328
>gb|CA736477.1|CA736477 wpi1s.pk007.e18 wpi1s Triticum aestivum cDNA clone wpi1s.pk007.e18 5'
end, mRNA sequence
Length = 155
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 128 gtcgtacctgcccgggcggccgctcgaa 155
>gb|CA737045.1|CA737045 wpi1s.pk009.j6 wpi1s Triticum aestivum cDNA clone wpi1s.pk009.j6 5'
end, mRNA sequence
Length = 282
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 255 gtcgtacctgcccgggcggccgctcgaa 282
>gb|CA737517.1|CA737517 wpi2s.pk004.g11 wpi2s Triticum aestivum cDNA clone wpi2s.pk004.g11 5'
end, mRNA sequence
Length = 353
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcga 1173
||||||||||||||||||||||||||||
Sbjct: 326 tgtcgtacctgcccgggcggccgctcga 353
>gb|CA737624.1|CA737624 wpi2s.pk004.h23 wpi2s Triticum aestivum cDNA clone wpi2s.pk004.h23 5'
end, mRNA sequence
Length = 355
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 319 gtcgtacctgcccgggcggccgctcgaa 346
>gb|CA737667.1|CA737667 wpi2s.pk004.k22 wpi2s Triticum aestivum cDNA clone wpi2s.pk004.k22 5'
end, mRNA sequence
Length = 386
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 359 gtcgtacctgcccgggcggccgctcgaa 386
>gb|CA737680.1|CA737680 wpi2s.pk004.m20 wpi2s Triticum aestivum cDNA clone wpi2s.pk004.m20 5'
end, mRNA sequence
Length = 332
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 305 gtcgtacctgcccgggcggccgctcgaa 332
>gb|CA737895.1|CA737895 wpi2s.pk005.k13 wpi2s Triticum aestivum cDNA clone wpi2s.pk005.k13 5'
end, mRNA sequence
Length = 225
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 198 gtcgtacctgcccgggcggccgctcgaa 225
>gb|CA739458.1|CA739458 wpi2s.pk007.k24 wpi2s Triticum aestivum cDNA clone wpi2s.pk007.k24 5'
end, mRNA sequence
Length = 344
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 317 gtcgtacctgcccgggcggccgctcgaa 344
>gb|CA742481.1|CA742481 wri1s.pk001.a10 wri1s Triticum aestivum cDNA clone wri1s.pk001.a10 5'
end, mRNA sequence
Length = 372
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 1146 tgtcgtacctgcccgggcggccgctcga 1173
||||||||||||||||||||||||||||
Sbjct: 28 tgtcgtacctgcccgggcggccgctcga 1
>gb|CA745304.1|CA745304 wri1s.pk003.i15 wri1s Triticum aestivum cDNA clone wri1s.pk003.i15 5'
end, mRNA sequence
Length = 234
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcga 1173
||||||||||||||||||||||||||||
Sbjct: 207 tgtcgtacctgcccgggcggccgctcga 234
>gb|CA746618.1|CA746618 wri2s.pk004.e6 wri2s Triticum aestivum cDNA clone wri2s.pk004.e6 5'
end, mRNA sequence
Length = 192
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 28 gtcgtacctgcccgggcggccgctcgaa 1
>gb|CA747337.1|CA747337 wri2s.pk008.f5.f wri2s Triticum aestivum cDNA clone wri2s.pk008.f5.f
3' end, mRNA sequence
Length = 332
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 28 gtcgtacctgcccgggcggccgctcgaa 1
>gb|AJ602674.1|AJ602674 AJ602674 T06 Triticum aestivum cDNA clone G06_T06_plate_1, mRNA
sequence
Length = 248
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 43 gtcgtacctgcccgggcggccgctcgaa 16
>gb|AJ602909.1|AJ602909 AJ602909 T06 Triticum aestivum cDNA clone E02_T06_plate_39, mRNA
sequence
Length = 251
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 30 gtcgtacctgcccgggcggccgctcgaa 3
>gb|AJ603021.1|AJ603021 AJ603021 T06 Triticum aestivum cDNA clone D02_T06_plate_47, mRNA
sequence
Length = 261
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcga 1173
||||||||||||||||||||||||||||
Sbjct: 234 tgtcgtacctgcccgggcggccgctcga 261
>gb|AJ603368.1|AJ603368 AJ603368 T06 Triticum aestivum cDNA clone H08_T06_plate_67, mRNA
sequence
Length = 320
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 1146 tgtcgtacctgcccgggcggccgctcga 1173
||||||||||||||||||||||||||||
Sbjct: 293 tgtcgtacctgcccgggcggccgctcga 320
>gb|CV522241.1|CV522241 RH-658 Triticum aestivum subtracted, clontech Triticum aestivum cDNA,
mRNA sequence
Length = 251
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 1146 tgtcgtacctgcccgggcggccgctcga 1173
||||||||||||||||||||||||||||
Sbjct: 28 tgtcgtacctgcccgggcggccgctcga 1
>gb|DW986534.1|DW986534 01G21 AAFC_CRC Fusarium graminearum inoculated wheat spikes Triticum
aestivum cDNA clone Ta02_04_D05_, mRNA sequence
Length = 445
Score = 56.0 bits (28), Expect = 6e-006
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 1147 gtcgtacctgcccgggcggccgctcgaa 1174
||||||||||||||||||||||||||||
Sbjct: 33 gtcgtacctgcccgggcggccgctcgaa 6
>gb|CA735070.1|CA735070 wpi1s.pk003.p19 wpi1s Triticum aestivum cDNA clone wpi1s.pk003.p19 5'
end, mRNA sequence
Length = 287
Score = 54.0 bits (27), Expect = 2e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 1148 tcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||
Sbjct: 261 tcgtacctgcccgggcggccgctcgaa 287
>gb|CA735411.1|CA735411 wpi1s.pk002.b23 wpi1s Triticum aestivum cDNA clone wpi1s.pk002.b23 5'
end, mRNA sequence
Length = 345
Score = 54.0 bits (27), Expect = 2e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 1148 tcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||
Sbjct: 319 tcgtacctgcccgggcggccgctcgaa 345
>gb|CA735655.1|CA735655 wpi1s.pk005.a11 wpi1s Triticum aestivum cDNA clone wpi1s.pk005.a11 5'
end, mRNA sequence
Length = 435
Score = 54.0 bits (27), Expect = 2e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 1148 tcgtacctgcccgggcggccgctcgaa 1174
|||||||||||||||||||||||||||
Sbjct: 409 tcgtacctgcccgggcggccgctcgaa 435
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 260,108
Number of Sequences: 636343
Number of extensions: 260108
Number of successful extensions: 98213
Number of sequences better than 0.5: 13992
Number of HSP's better than 0.5 without gapping: 13991
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 82806
Number of HSP's gapped (non-prelim): 15395
length of query: 1174
length of database: 367,240,239
effective HSP length: 20
effective length of query: 1154
effective length of database: 354,513,379
effective search space: 409108439366
effective search space used: 409108439366
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)