BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3042337.2.1
(945 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|AX660655.1| Sequence 1012 from Patent WO03000906 240 1e-061
gb|BE445503.1|BE445503 WHE1135_C08_F15ZS Wheat etiolated se... 234 9e-060
gb|CD452876.1|CD452876 WHE1135_C08_F15ZT CS wheat etiolated... 234 9e-060
gb|AL824806.1|AL824806 AL824806 p:234 Triticum aestivum cDN... 155 7e-036
gb|CN008027.1|CN008027 WHE2636_D07_H14ZE Wheat Fusarium gra... 135 6e-030
gb|CK163660.1|CK163660 FGAS016290 Triticum aestivum FGAS: L... 131 1e-028
gb|AL824805.1|AL824805 AL824805 p:234 Triticum aestivum cDN... 125 6e-027
gb|CV782747.1|CV782747 FGAS077160 Triticum aestivum FGAS: L... 123 2e-026
gb|BE419133.1|BE419133 WWR020.E7R000101 ITEC WWR Wheat Root... 105 5e-021
gb|CA697767.1|CA697767 wlk4.pk0010.e1 wlk4 Triticum aestivu... 105 5e-021
gb|BE425382.1|BE425382 WHE313_G09_G09ZS Wheat unstressed se... 103 2e-020
gb|AL822449.1|AL822449 AL822449 p:234 Triticum aestivum cDN... 103 2e-020
gb|CV782061.1|CV782061 FGAS076474 Triticum aestivum FGAS: L... 80 3e-013
gb|BE418633.1|BE418633 SCL072.F07R990707 ITEC SCL Wheat Lea... 64 2e-008
gb|AL827412.1|AL827412 AL827412 p:638 Triticum aestivum cDN... 62 7e-008
gb|AL827661.1|AL827661 AL827661 p:638 Triticum aestivum cDN... 62 7e-008
gb|CA676830.1|CA676830 wlm12.pk0007.f6 wlm12 Triticum aesti... 60 3e-007
gb|CA619927.1|CA619927 wl1n.pk0062.e3 wl1n Triticum aestivu... 58 1e-006
gb|BM137379.1|BM137379 WHE0463-0466_C07_C07ZS Wheat Fusariu... 56 5e-006
gb|BG605352.1|BG605352 WHE2331_G08_N15ZS Wheat pre-anthesis... 54 2e-005
gb|CA486317.1|CA486317 WHE4329_H04_O07ZS Wheat meiotic anth... 50 3e-004
gb|BE517706.1|BE517706 WHE0802_G10_M20ZS Wheat vernalized c... 48 0.001
gb|BU100001.1|BU100001 WHE3314_A03_A06ZS Chinese Spring whe... 48 0.001
gb|CA699330.1|CA699330 wlk8.pk0018.b8 wlk8 Triticum aestivu... 46 0.004
gb|BG905630.1|BG905630 TaLr1141A08F TaLr1 Triticum aestivum... 42 0.069
gb|CD874668.1|CD874668 AZO3.102M03R011123 AZO3 Triticum aes... 42 0.069
gb|BQ743971.1|BQ743971 WHE4110_C09_E18ZS Wheat salt-stresse... 40 0.27
gb|BQ803491.1|BQ803491 WHE2838_C09_E18ZS Triticum monococcu... 40 0.27
gb|CV770696.1|CV770696 FGAS065089 Triticum aestivum FGAS: L... 40 0.27
>emb|AX660655.1| Sequence 1012 from Patent WO03000906
Length = 923
Score = 240 bits (121), Expect = 1e-061
Identities = 367/449 (81%)
Strand = Plus / Minus
Query: 394 tcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagg 453
||||||||||||||||| | || ||||||||| |||| ||| | |||| ||||||| ||
Sbjct: 684 tcccagtcgaagcactgcaccagcgtccccagaaccaccccgaccgtctgcagcgccagc 625
Query: 454 gcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggca 513
| ||| |||||||| |||||| ||||||||||||||||||| | |||||||||| |
Sbjct: 624 gtctcgccggggcacctccgccgccccatcccgaacggcatcagcagcagcccgtcgccc 565
Query: 514 cggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtcc 573
||||||||||||||||||||||| |||||| | |||||| |||| | || ||||||
Sbjct: 564 ttgccgtcctcgaaccgctccggccggaacgccgtcgggtcctcccacacggccgggtcc 505
Query: 574 ctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccg 633
||||||||||||||| |||| |||| ||||| || ||||||||||| || |||||||
Sbjct: 504 ctgtggatggcgtacgcgttcacgatcagcatggtgccgctcggcacgtcgtagccgccg 445
Query: 634 accgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgc 693
||| |||||||||||| |||||||||||| | |||| |||| | |||||||||| ||
Sbjct: 444 accttgcagtcggcggaggactcgtgcggcagcagcagcggcgccgccgggtacaggcgt 385
Query: 694 agggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcgccgagc 753
|| |||||| ||| |||||| |||||||||| |||||| |||| |||||||||| || |
Sbjct: 384 agcgtctcgttgatgatgcactggaggtagctgaggcggggcacgtcgtcggcggtgacc 325
Query: 754 agccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaacatcgggg 813
| |||||| ||| ||||||||| ||||| |||||||| |||| ||| | | |||
Sbjct: 324 atgcgggaggtcccaatggacgcgtccatctcggcctgcgccttcttcagcgccgccggg 265
Query: 814 tggcttagcagcagcgacatcgcccattc 842
||| | ||||| |||||||||||||||||
Sbjct: 264 tggttcagcaggagcgacatcgcccattc 236
>gb|BE445503.1|BE445503 WHE1135_C08_F15ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1135_C08_F15,
mRNA sequence
Length = 494
Score = 234 bits (118), Expect = 9e-060
Identities = 295/354 (83%)
Strand = Plus / Minus
Query: 394 tcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagg 453
||||||||||||||||| | || |||||| || |||| ||| | |||| ||||||| ||
Sbjct: 354 tcccagtcgaagcactgcaccagcgtcccgagaaccaccccgaccgtctgcagcgccagc 295
Query: 454 gcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggca 513
| ||| |||||||| |||||| ||||||||||||||||||| | ||||||||||||
Sbjct: 294 gtctcgccggggcacctccgccgccccatcccgaacggcatcagcagcagcccgtcggcc 235
Query: 514 cggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtcc 573
||||||||||||||||||||||| |||||| || |||||| |||| | || ||||||
Sbjct: 234 ttgccgtcctcgaaccgctccggccggaacgccgccgggtcctcccacacggccgggtcc 175
Query: 574 ctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccg 633
||||||||||||||| |||| |||| |||||||| ||||| ||||| || |||||||
Sbjct: 174 ctgtggatggcgtacgcgttcacgatcagcatcgtgccgcttggcacgtcgtagccgccg 115
Query: 634 accgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgc 693
||| |||||||||||| |||||||||||| | |||| |||| | |||||||||| ||
Sbjct: 114 accttgcagtcggcggaggactcgtgcggcagcagcagcggcgccgccgggtacaggcgt 55
Query: 694 agggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
|| |||||| ||| |||||| |||||||||| |||||| |||| ||||||||||
Sbjct: 54 agcgtctcgttgatgatgcactggaggtagctgaggcggggcacgtcgtcggcg 1
>gb|CD452876.1|CD452876 WHE1135_C08_F15ZT CS wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1135_C08_F15,
mRNA sequence
Length = 694
Score = 234 bits (118), Expect = 9e-060
Identities = 295/354 (83%)
Strand = Plus / Plus
Query: 394 tcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagg 453
||||||||||||||||| | || |||||| || |||| ||| | |||| ||||||| ||
Sbjct: 338 tcccagtcgaagcactgcaccagcgtcccgagaaccaccccgaccgtctgcagcgccagc 397
Query: 454 gcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggca 513
| ||| |||||||| |||||| ||||||||||||||||||| | ||||||||||||
Sbjct: 398 gtctcgccggggcacctccgccgccccatcccgaacggcatcagcagcagcccgtcggcc 457
Query: 514 cggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtcc 573
||||||||||||||||||||||| |||||| || |||||| |||| | || ||||||
Sbjct: 458 ttgccgtcctcgaaccgctccggccggaacgccgccgggtcctcccacacggccgggtcc 517
Query: 574 ctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccg 633
||||||||||||||| |||| |||| |||||||| ||||| ||||| || |||||||
Sbjct: 518 ctgtggatggcgtacgcgttcacgatcagcatcgtgccgcttggcacgtcgtagccgccg 577
Query: 634 accgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgc 693
||| |||||||||||| |||||||||||| | |||| |||| | |||||||||| ||
Sbjct: 578 accttgcagtcggcggaggactcgtgcggcagcagcagcggcgccgccgggtacaggcgt 637
Query: 694 agggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
|| |||||| ||| |||||| |||||||||| |||||| |||| ||||||||||
Sbjct: 638 agcgtctcgttgatgatgcactggaggtagctgaggcggggcacgtcgtcggcg 691
>gb|AL824806.1|AL824806 AL824806 p:234 Triticum aestivum cDNA clone C12_p234_plate_3, mRNA
sequence
Length = 401
Score = 155 bits (78), Expect = 7e-036
Identities = 234/286 (81%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
||||||||||||||||||||| |||| || | |||||||| ||||||||||| || |
Sbjct: 381 gggtccctgtggatggcgtacgcgttcaccatcagcatcgtgccgctcggcacgtcgtag 322
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtac 687
||||||||| ||||||| || | ||||| |||||| | |||| ||||| | ||||||||
Sbjct: 321 ccgccgaccttgcagtccgccgaggactggtgcggcagcagcatcggcgccgccgggtac 262
Query: 688 agccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
|||||||| |||||||| |||||||| || |||||| |||| || |||| |||||| |||
Sbjct: 261 agccgcagcgtctcgctcacgatgcactgcaggtaggcgagccggggcacgtcgtccgcg 202
Query: 748 ccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaaca 807
| |||||||||| |||| ||| |||||| ||||| |||||||| ||| ||| |
Sbjct: 201 gtcaccagccgggaggtccccacggccgcgtcgatctcggcctgcgccttcctcagcgcc 142
Query: 808 tcggggtggcttagcagcagcgacatcgcccattccgccgtcgtcg 853
| |||||| | |||||||||||||||||||| |||| ||||||||
Sbjct: 141 gccgggtggttcagcagcagcgacatcgcccactccgtcgtcgtcg 96
Score = 60.0 bits (30), Expect = 3e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 892 agagccatgatcatggtatccgtgtacacctccggttctgacttctgcag 941
|||||| ||||||||||||| |||||||||||||| || | |||||||||
Sbjct: 57 agagccgtgatcatggtatcggtgtacacctccggctccgtcttctgcag 8
>gb|CN008027.1|CN008027 WHE2636_D07_H14ZE Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE2636_D07_H14,
mRNA sequence
Length = 497
Score = 135 bits (68), Expect = 6e-030
Identities = 281/352 (79%)
Strand = Plus / Minus
Query: 439 gtccgcagcgcgagggcctctccggggcatttccgccttcccatcccgaacggcatcacg 498
||||||||||| || | ||| |||||||| ||||| |||||||||||||| |||| |
Sbjct: 352 gtccgcagcgccagcgtctccccggggcaccgccgccggcccatcccgaacgggatcatg 293
Query: 499 aacagcccgtcggcacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcc 558
||| |||| ||||| |||||||||||||||||||| |||| | ||| | ||
Sbjct: 292 aaccgcccctcggccttcccgtcctcgaaccgctccgggacgaactccagcgggcgctcc 233
Query: 559 catatcgcggggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggc 618
|| | ||| ||||||||||||||||||||| |||| || | |||||||| |||||||||
Sbjct: 232 cacaccgccgggtccctgtggatggcgtacgcgttcaccatcagcatcgtgccgctcggc 173
Query: 619 acacggtggccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacg 678
|| || |||||||||| ||||||| || | ||||| |||||| | |||| ||||| |
Sbjct: 172 acgttgtagccgccgaccttgcagtccgccgaggactggtgcggcagcagcatcggcgcc 113
Query: 679 accgggtacagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcagg 738
|||||||||||||||| |||||||| |||||||| || |||||| |||| || |||| |
Sbjct: 112 gccgggtacagccgcagcgtctcgctcacgatgcactgcaggtaggcgagccggggcacg 53
Query: 739 tcgtcggcgccgagcagccgggagtgccccgcggacgcgtcaatctccgcct 790
||||| ||| | |||||||||| |||| ||| |||||| ||||| ||||
Sbjct: 52 tcgtccgcggtcaccagccgggaggtccccacggccgcgtcgatctcggcct 1
>gb|CK163660.1|CK163660 FGAS016290 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1089
Score = 131 bits (66), Expect = 1e-028
Identities = 231/286 (80%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
||||||| ||||||||||||| |||| || | |||||||| ||||||||||| || |
Sbjct: 679 gggtcccggtggatggcgtacgcgttcaccatcagcatcgtgccgctcggcacgttgtag 620
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtac 687
||||| ||| ||||||| || | |||||||||||| | |||| ||||| | ||||||||
Sbjct: 619 ccgcccaccttgcagtctgccgaggactcgtgcggcagcagcatcggcgccgccgggtac 560
Query: 688 agccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
|||||||| |||||||| |||||||| || |||||| | || || |||| ||||||||||
Sbjct: 559 agccgcagcgtctcgctcacgatgcactgcaggtaggccagccgtggcacgtcgtcggcg 500
Query: 748 ccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaaca 807
| |||||||||| ||| ||| |||||| ||||| |||||||| || | || |
Sbjct: 499 gtcaccagccgggaggtgcccacggccgcgtcgatctcggcctgcgcctttttgagcgcc 440
Query: 808 tcggggtggcttagcagcagcgacatcgcccattccgccgtcgtcg 853
| |||||| | |||||||||||||||||||| |||| ||||||||
Sbjct: 439 gccgggtggttcagcagcagcgacatcgcccactccgtcgtcgtcg 394
Score = 54.0 bits (27), Expect = 2e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 478 cccatcccgaacggcatcacgaacagcccgtcggcacggccgtcctcgaaccgctccgg 536
|||||||||||||| |||| |||| |||| ||||| ||||||||||||||||||||
Sbjct: 769 cccatcccgaacgggatcatgaaccgcccctcggccttcccgtcctcgaaccgctccgg 711
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 892 agagccatgatcatggtatccgtgtacacctccggttctgacttctgcag 941
|||||| ||||||||||||| | |||||||||||| || | |||||||||
Sbjct: 355 agagccgtgatcatggtatcggcgtacacctccggctccgtcttctgcag 306
>gb|AL824805.1|AL824805 AL824805 p:234 Triticum aestivum cDNA clone C11_p234_plate_3, mRNA
sequence
Length = 471
Score = 125 bits (63), Expect = 6e-027
Identities = 230/286 (80%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
||||||||||||||||||||| |||| || | |||||||| ||||||||||| ||| |
Sbjct: 382 gggtccctgtggatggcgtacgcgttcaccataagcatcgtgccgctcggcacgtggtag 323
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtac 687
||||||||| ||||||| || | ||||| |||||| | ||| | ||| | | ||||||
Sbjct: 322 ccgccgaccttgcagtccgccgaggactggtgcggcagcagtataggcgccgcagggtac 263
Query: 688 agccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
|||||||| |||||||| |||||||| || |||||| |||| || |||| |||||| |||
Sbjct: 262 agccgcagcgtctcgctcacgatgcactgcaggtaggcgagccggggcacgtcgtccgcg 203
Query: 748 ccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaaca 807
| |||||||||| |||| ||| |||||| ||||| |||||||| ||| || |
Sbjct: 202 gtcaccagccgggaggtccccacggccgcgtcgatctcggcctgcgccttcctnagcgcc 143
Query: 808 tcggggtggcttagcagcagcgacatcgcccattccgccgtcgtcg 853
| |||||| | |||||||||||||||||||| || | ||||||||
Sbjct: 142 gccgggtggttcagcagcagcgacatcgcccactcagtcgtcgtcg 97
Score = 60.0 bits (30), Expect = 3e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 892 agagccatgatcatggtatccgtgtacacctccggttctgacttctgcag 941
|||||| ||||||||||||| |||||||||||||| || | |||||||||
Sbjct: 57 agagccgtgatcatggtatcggtgtacacctccggctccgtcttctgcag 8
>gb|CV782747.1|CV782747 FGAS077160 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 845
Score = 123 bits (62), Expect = 2e-026
Identities = 224/278 (80%)
Strand = Plus / Minus
Query: 576 gtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgac 635
||||||||||||| |||| || | |||||||| ||||||||||| || |||||||||
Sbjct: 751 gtggatggcgtacgcgttcaccatcagcatcgtgccgctcggcacgttgtagccgccgac 692
Query: 636 cgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcag 695
| ||||||| || | ||||| |||||| | |||| |||| | ||||||||||||||||
Sbjct: 691 cttgcagtcagccgaggactggtgcggcagcagcatcggtgccgccgggtacagccgcag 632
Query: 696 ggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcgccgagcag 755
|||||||| |||||||| || |||||| | || || |||| |||||||||| | |||
Sbjct: 631 cgtctcgctcacgatgcactgcaggtaggccagccggggcacgtcgtcggcggtcaccag 572
Query: 756 ccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaacatcggggtg 815
||||||| |||| ||| |||||| ||||| ||||||| ||| ||| | | |||||
Sbjct: 571 ccgggaggtccccacggccgcgtcgatctcgtcctgcgccttcctcagcgccgccgggtg 512
Query: 816 gcttagcagcagcgacatcgcccattccgccgtcgtcg 853
| | |||||||||||||||||||| |||| ||||||||
Sbjct: 511 gttcagcagcagcgacatcgcccactccgtcgtcgtcg 474
Score = 60.0 bits (30), Expect = 3e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 892 agagccatgatcatggtatccgtgtacacctccggttctgacttctgcag 941
|||||| ||||||||||||| |||||||||||||| || | |||||||||
Sbjct: 435 agagccgtgatcatggtatcggtgtacacctccggctccgtcttctgcag 386
>gb|BE419133.1|BE419133 WWR020.E7R000101 ITEC WWR Wheat Root Library Triticum aestivum cDNA
clone WWR020.E7, mRNA sequence
Length = 306
Score = 105 bits (53), Expect = 5e-021
Identities = 152/185 (82%)
Strand = Plus / Minus
Query: 576 gtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgac 635
||||||||||||| |||| || | |||||||| ||||||||||| || |||||||||
Sbjct: 238 gtggatggcgtacgcgttcaccatcagcatcgtgccgctcggcacgttgtagccgccgac 179
Query: 636 cgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcag 695
| ||||||| || | ||||| |||||| | |||| ||||| | |||||||||| |||||
Sbjct: 178 cttgcagtccgctgaggactggtgcggcagcagcatcggcgccgccgggtacagtcgcag 119
Query: 696 ggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcgccgagcag 755
|||||||| |||||||| || |||||| | || ||||||| |||||||||| || |||
Sbjct: 118 cgtctcgctcacgatgcactgcaggtaggccagccgcggcacgtcgtcggcggtgaccag 59
Query: 756 ccggg 760
|||||
Sbjct: 58 ccggg 54
>gb|CA697767.1|CA697767 wlk4.pk0010.e1 wlk4 Triticum aestivum cDNA clone wlk4.pk0010.e1 5'
end, mRNA sequence
Length = 436
Score = 105 bits (53), Expect = 5e-021
Identities = 184/227 (81%), Gaps = 1/227 (0%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
|||||||||||||||| |||| |||| || | |||||||| |||||||| || || |
Sbjct: 254 gggtccctgtggatgg-gtacgcgttcaccatcagcatcgtgccgctcggnacgttgtag 196
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtac 687
|||| |||| ||||||| || | ||||| |||||| | |||| ||||| | ||||||||
Sbjct: 195 ccgcngaccttgcagtccgccgaggactggtgcggcagcagcatcggcgccgccgggtac 136
Query: 688 agccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
|||||||| |||||||| |||||||| || |||||| |||| || |||| |||||| |||
Sbjct: 135 agccgcagcgtctcgctcacgatgcactgcaggtaggcgagccggggcacgtcgtccgcg 76
Query: 748 ccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgc 794
| |||||||||| |||| ||| |||||| ||||| ||||||||
Sbjct: 75 gtcaccagccgggaggtccccacggccgcgtcgatctcggcctgcgc 29
>gb|BE425382.1|BE425382 WHE313_G09_G09ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE313_G09_G09, mRNA
sequence
Length = 374
Score = 103 bits (52), Expect = 2e-020
Identities = 148/180 (82%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
||||||| ||||||||||||| |||| || | |||||||| ||||||||||| || |
Sbjct: 208 gggtcccggtggatggcgtacgcgttcaccatcagcatcgtgccgctcggcacgttgtag 149
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtac 687
||||| ||| ||||||| || | |||||||||||| | |||| ||||| | |||| |||
Sbjct: 148 ccgcccaccttgcagtctgccgaggactcgtgcggcagcagcatcggcgccgccggatac 89
Query: 688 agccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
|||||||| |||||||| |||||||| || |||||| | || || |||| ||||||||||
Sbjct: 88 agccgcagcgtctcgctcacgatgcactgcaggtaggccagccgtggcacgtcgtcggcg 29
Score = 54.0 bits (27), Expect = 2e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 478 cccatcccgaacggcatcacgaacagcccgtcggcacggccgtcctcgaaccgctccgg 536
|||||||||||||| |||| |||| |||| ||||| ||||||||||||||||||||
Sbjct: 298 cccatcccgaacgggatcatgaaccgcccctcggccttcccgtcctcgaaccgctccgg 240
>gb|AL822449.1|AL822449 AL822449 p:234 Triticum aestivum cDNA clone G11_p234_plate_25, mRNA
sequence
Length = 588
Score = 103 bits (52), Expect = 2e-020
Identities = 148/180 (82%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
||||||| ||||||||||||| |||| || | |||||||| ||||||||||| || |
Sbjct: 560 gggtcccggtggatggcgtacgcgttcacaatcagcatcgtgccgctcggcacgtcgtag 501
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtac 687
||||| ||| ||||||| || | ||||| |||||| | |||| |||| | ||||||||
Sbjct: 500 ccgcccaccttgcagtccgccgaggactggtgcggcagcagcagcggcgccgccgggtac 441
Query: 688 agccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcg 747
||||| || |||||||| |||||||| || |||||| |||| ||||||| ||||||||||
Sbjct: 440 agccgaagcgtctcgctcacgatgcactgaaggtaggcgagccgcggcacgtcgtcggcg 381
Score = 46.1 bits (23), Expect = 0.004
Identities = 45/51 (88%), Gaps = 1/51 (1%)
Strand = Plus / Minus
Query: 892 agagccatgatcatggtatccg-tgtacacctccggttctgacttctgcag 941
|||||||||||||| ||||| | ||||||||||||| || | |||||||||
Sbjct: 234 agagccatgatcatagtatcaggtgtacacctccggctccgtcttctgcag 184
Score = 40.1 bits (20), Expect = 0.27
Identities = 39/44 (88%), Gaps = 1/44 (2%)
Strand = Plus / Minus
Query: 811 gggtggcttagcagcagcgacatc-gcccattccgccgtcgtcg 853
|||||| | ||||||||||||||| ||||| |||| ||||||||
Sbjct: 317 gggtggttcagcagcagcgacatcggcccactccgtcgtcgtcg 274
>gb|CV782061.1|CV782061 FGAS076474 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 892
Score = 79.8 bits (40), Expect = 3e-013
Identities = 139/172 (80%)
Strand = Plus / Minus
Query: 682 gggtacagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcg 741
|||||||||||||| |||||||| |||||||| || |||||| | | || |||| ||||
Sbjct: 525 gggtacagccgcagcgtctcgctcacgatgcactgcaggtaggccaaccggggcacgtcg 466
Query: 742 tcggcgccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctcc 801
|||||| | |||||||||| |||| ||| |||||| ||||| ||||||| ||| |
Sbjct: 465 tcggcggtcaccagccgggaggtccccacggccgcgtcgatctcgtcctgcgccttcctc 406
Query: 802 agaacatcggggtggcttagcagcagcgacatcgcccattccgccgtcgtcg 853
|| | | |||||| | |||||||||||||||||||| |||| ||||||||
Sbjct: 405 agcgccgccgggtggttcagcagcagcgacatcgcccactccgtcgtcgtcg 354
Score = 60.0 bits (30), Expect = 3e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 892 agagccatgatcatggtatccgtgtacacctccggttctgacttctgcag 941
|||||| ||||||||||||| |||||||||||||| || | |||||||||
Sbjct: 315 agagccgtgatcatggtatcggtgtacacctccggctccgtcttctgcag 266
>gb|BE418633.1|BE418633 SCL072.F07R990707 ITEC SCL Wheat Leaf Library Triticum aestivum
cDNA clone SCL072.F07, mRNA sequence
Length = 679
Score = 63.9 bits (32), Expect = 2e-008
Identities = 115/143 (80%)
Strand = Plus / Plus
Query: 394 tcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagg 453
||||||||||||||||| | || ||| |||| |||| || | ||||||||||| ||
Sbjct: 370 tcccagtcgaagcactgcaccagcgtggccagcaccatgccgatagtccgcagcgccagc 429
Query: 454 gcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggca 513
| |||||||||||| ||||| |||||||||||||| |||| |||| |||| ||||
Sbjct: 430 gtctctccggggcaccgccgccggcccatcccgaacgggatcatgaaccgcccctcggnc 489
Query: 514 cggccgtcctcgaaccgctccgg 536
||||||||||||||||||||
Sbjct: 490 ttcccgtcctcgaaccgctccgg 512
>gb|AL827412.1|AL827412 AL827412 p:638 Triticum aestivum cDNA clone H01_p638_plate_2, mRNA
sequence
Length = 583
Score = 61.9 bits (31), Expect = 7e-008
Identities = 80/95 (84%), Gaps = 1/95 (1%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
||||||||||||||||||||| |||| || | |||||||| ||||||||||| || |
Sbjct: 105 gggtccctgtggatggcgtacgcgttcac-atcagcatcgtgccgctcggcacgttgtag 47
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgg 662
||||||||| ||||||| || | ||||| ||||||
Sbjct: 46 ccgccgaccttgcagtccgccgaggactggtgcgg 12
Score = 46.1 bits (23), Expect = 0.004
Identities = 95/119 (79%)
Strand = Plus / Minus
Query: 394 tcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagg 453
||||||||||||||||| | || ||| |||| |||| || | ||||||||||| ||
Sbjct: 280 tcccagtcgaagcactgcaccagcgtggccagcaccatgccaatggtccgcagcgccagc 221
Query: 454 gcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggc 512
| ||| |||||||| ||||| |||||||||||||| |||| |||| |||| |||||
Sbjct: 220 gtctccccggggcaccgccgccggcccatcccgaacgggatcatgaaccgcccctcggc 162
>gb|AL827661.1|AL827661 AL827661 p:638 Triticum aestivum cDNA clone E03_p638_plate_13, mRNA
sequence
Length = 568
Score = 61.9 bits (31), Expect = 7e-008
Identities = 80/95 (84%), Gaps = 1/95 (1%)
Strand = Plus / Minus
Query: 568 gggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtgg 627
||||||||||||||||||||| |||| || | |||||||| ||||||||||| || |
Sbjct: 112 gggtccctgtggatggcgtacgcgttcac-atcagcatcgtgccgctcggcacgttgtag 54
Query: 628 ccgccgaccgtgcagtcggcggtggactcgtgcgg 662
||||||||| ||||||| || | ||||| ||||||
Sbjct: 53 ccgccgaccttgcagtccgccgaggactggtgcgg 19
>gb|CA676830.1|CA676830 wlm12.pk0007.f6 wlm12 Triticum aestivum cDNA clone wlm12.pk0007.f6
5' end, mRNA sequence
Length = 407
Score = 60.0 bits (30), Expect = 3e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 892 agagccatgatcatggtatccgtgtacacctccggttctgacttctgcag 941
|||||| ||||||||||||| |||||||||||||| || | |||||||||
Sbjct: 237 agagccgtgatcatggtatcggtgtacacctccggctccgtcttctgcag 188
Score = 50.1 bits (25), Expect = 3e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 811 gggtggcttagcagcagcgacatcgcccattccgccgtcgt 851
|||||| | |||||||||||||||||||| |||| ||||||
Sbjct: 319 gggtggttcagcagcagcgacatcgcccactccgtcgtcgt 279
>gb|CA619927.1|CA619927 wl1n.pk0062.e3 wl1n Triticum aestivum cDNA clone wl1n.pk0062.e3 5'
end, mRNA sequence
Length = 390
Score = 58.0 bits (29), Expect = 1e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 388 accgtgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagc 447
||||||||||||||||||||||||| || ||| | || |||||||| | |||||||||
Sbjct: 76 accgtgtcccagtcgaagcactggagcagcgtggcaagcaccagcccgacggtccgcagc 17
Query: 448 gcgag 452
|||||
Sbjct: 16 gcgag 12
>gb|BM137379.1|BM137379 WHE0463-0466_C07_C07ZS Wheat Fusarium graminearum infected spike
cDNA library Triticum aestivum cDNA clone
WHE0463-0466_C07_C07, mRNA sequence
Length = 603
Score = 56.0 bits (28), Expect = 5e-006
Identities = 115/144 (79%)
Strand = Plus / Minus
Query: 400 tcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggcctct 459
|||||||||||||| | ||| || || |||| |||| |||| || |||||| |||
Sbjct: 395 tcgaagcactggatgagcgtgccaagaaccatacccatggtcctcatggcgaggctctcc 336
Query: 460 ccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacggccg 519
|||||||| || ||||||||||||||||| | ||||| || | ||| ||||| | |||
Sbjct: 335 ccggggcacttgcgccttcccatcccgaaggacatcatgagcttcccctcggcgccgcca 276
Query: 520 tcctcgaaccgctccggcctgaac 543
| |||||||| |||||||||||||
Sbjct: 275 tgctcgaacctctccggcctgaac 252
Score = 48.1 bits (24), Expect = 0.001
Identities = 69/84 (82%)
Strand = Plus / Minus
Query: 639 gcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggt 698
||||||||||| || |||||| || | |||| |||| || ||||| ||||||||| ||
Sbjct: 153 gcagtcggcggcggcctcgtgtggtagcagcagcggcgcggccgggcacagccgcatcgt 94
Query: 699 ctcgctgacgatgcagtggaggta 722
||| ||| |||||||||||||||
Sbjct: 93 ctcattgatgatgcagtggaggta 70
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 576 gtggatggcgtacacgttgacgag 599
||||||||||||| ||||||||||
Sbjct: 216 gtggatggcgtacgcgttgacgag 193
>gb|BG605352.1|BG605352 WHE2331_G08_N15ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2331_G08_N15, mRNA sequence
Length = 328
Score = 54.0 bits (27), Expect = 2e-005
Identities = 69/83 (83%)
Strand = Plus / Minus
Query: 461 cggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacggccgt 520
||||||| || ||||||||||||||||| | ||||| || | ||| ||||| | ||| |
Sbjct: 328 cggggcacttgcgccttcccatcccgaaggacatcatgagcttcccctcggcgccgccat 269
Query: 521 cctcgaaccgctccggcctgaac 543
|||||||| |||||||||||||
Sbjct: 268 gctcgaacctctccggcctgaac 246
Score = 48.1 bits (24), Expect = 0.001
Identities = 69/84 (82%)
Strand = Plus / Minus
Query: 639 gcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggt 698
||||||||||| || |||||| || | |||| |||| || ||||| ||||||||| ||
Sbjct: 147 gcagtcggcggcggcctcgtgtggtagcagcagcggcgcggccgggcacagccgcatcgt 88
Query: 699 ctcgctgacgatgcagtggaggta 722
||| ||| |||||||||||||||
Sbjct: 87 ctcattgatgatgcagtggaggta 64
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 576 gtggatggcgtacacgttgacgag 599
||||||||||||| ||||||||||
Sbjct: 210 gtggatggcgtacgcgttgacgag 187
>gb|CA486317.1|CA486317 WHE4329_H04_O07ZS Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4329_H04_O07, mRNA sequence
Length = 345
Score = 50.1 bits (25), Expect = 3e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagcccca 436
|||||||||||| |||| || || |||||||||||||||||
Sbjct: 81 ccagtcgaagcattggagcagcgcccccaggaccagcccca 41
>gb|BE517706.1|BE517706 WHE0802_G10_M20ZS Wheat vernalized crown cDNA library Triticum
aestivum cDNA clone WHE0802_G10_M20, mRNA sequence
Length = 401
Score = 48.1 bits (24), Expect = 0.001
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 516 gccgtcctcgaaccgctccggcctgaac 543
||||||||||||||||||||||| ||||
Sbjct: 261 gccgtcctcgaaccgctccggccggaac 234
>gb|BU100001.1|BU100001 WHE3314_A03_A06ZS Chinese Spring wheat drought stressed root cDNA
library Triticum aestivum cDNA clone WHE3314_A03_A06,
mRNA sequence
Length = 633
Score = 48.1 bits (24), Expect = 0.001
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 516 gccgtcctcgaaccgctccggcctgaac 543
||||||||||||||||||||||| ||||
Sbjct: 627 gccgtcctcgaaccgctccggccggaac 600
>gb|CA699330.1|CA699330 wlk8.pk0018.b8 wlk8 Triticum aestivum cDNA clone wlk8.pk0018.b8 5'
end, mRNA sequence
Length = 465
Score = 46.1 bits (23), Expect = 0.004
Identities = 50/59 (84%)
Strand = Plus / Minus
Query: 478 cccatcccgaacggcatcacgaacagcccgtcggcacggccgtcctcgaaccgctccgg 536
||||||||||||| |||| |||| |||| ||||| ||||||||||||||||||||
Sbjct: 316 cccatcccgaacgagatcatgaaccgcccctcggccttcccgtcctcgaaccgctccgg 258
>gb|BG905630.1|BG905630 TaLr1141A08F TaLr1 Triticum aestivum cDNA clone TaLr1141A08 3',
mRNA sequence
Length = 338
Score = 42.1 bits (21), Expect = 0.069
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 394 tcccagtcgaagcactggatcaacgtccc 422
||||||||||||||||||| || ||||||
Sbjct: 237 tcccagtcgaagcactggaccagcgtccc 265
>gb|CD874668.1|CD874668 AZO3.102M03R011123 AZO3 Triticum aestivum cDNA clone AZO3102M03,
mRNA sequence
Length = 581
Score = 42.1 bits (21), Expect = 0.069
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 519 gtcctcgaaccgctccggcctgaac 543
||||||||||| |||||||||||||
Sbjct: 383 gtcctcgaacctctccggcctgaac 407
>gb|BQ743971.1|BQ743971 WHE4110_C09_E18ZS Wheat salt-stressed root cDNA library Triticum
aestivum cDNA clone WHE4110_C09_E18, mRNA sequence
Length = 717
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 681 cgggtacagccgcagggtctcgct 704
|||||||||||||| |||||||||
Sbjct: 391 cgggtacagccgcatggtctcgct 368
>gb|BQ803491.1|BQ803491 WHE2838_C09_E18ZS Triticum monococcum vernalized apex cDNA library
Triticum monococcum cDNA clone WHE2838_C09_E18, mRNA
sequence
Length = 621
Score = 40.1 bits (20), Expect = 0.27
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 811 gggtggcttagcagcagcgacatcgcccattc 842
|||||| | ||||| |||||||||||||||||
Sbjct: 559 gggtggttcagcaggagcgacatcgcccattc 528
>gb|CV770696.1|CV770696 FGAS065089 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 874
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 520 tcctcgaaccgctccggcctgaac 543
|||||||||| |||||||||||||
Sbjct: 534 tcctcgaacctctccggcctgaac 511
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 238,052
Number of Sequences: 636343
Number of extensions: 238052
Number of successful extensions: 68684
Number of sequences better than 0.5: 29
Number of HSP's better than 0.5 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68594
Number of HSP's gapped (non-prelim): 80
length of query: 945
length of database: 367,240,239
effective HSP length: 20
effective length of query: 925
effective length of database: 354,513,379
effective search space: 327924875575
effective search space used: 327924875575
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)