BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750929.2.1
(583 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BQ789105.1|BQ789105 WHE4157_F05_L09ZS Wheat CS whole pla... 133 1e-029
gb|CV775962.1|CV775962 FGAS070366 Triticum aestivum FGAS: L... 133 1e-029
gb|BJ314208.1|BJ314208 BJ314208 Y. Ogihara unpublished cDNA... 80 2e-013
gb|AL828067.1|AL828067 AL828067 p:739 Triticum aestivum cDN... 76 3e-012
gb|DR736378.1|DR736378 FGAS081748 Triticum aestivum FGAS: L... 76 3e-012
gb|BM134627.1|BM134627 WHE0451_C01_C01ZS Wheat Fusarium gra... 68 7e-010
gb|CK210012.1|CK210012 FGAS021803 Triticum aestivum FGAS: L... 66 3e-009
gb|BJ226877.1|BJ226877 BJ226877 Y. Ogihara unpublished cDNA... 40 0.17
gb|BJ292232.1|BJ292232 BJ292232 Y. Ogihara unpublished cDNA... 40 0.17
gb|CA700361.1|CA700361 wkm1c.pk005.g18 wkm1c Triticum aesti... 40 0.17
gb|CD921332.1|CD921332 G608.120D21F010913 G608 Triticum aes... 40 0.17
gb|CD932587.1|CD932587 GR45.118H10F010718 GR45 Triticum aes... 40 0.17
gb|CK205806.1|CK205806 FGAS017351 Triticum aestivum FGAS: L... 40 0.17
gb|CK208140.1|CK208140 FGAS019821 Triticum aestivum FGAS: L... 40 0.17
gb|AJ613277.1|AJ613277 AJ613277 Triticum turgidum subsp. du... 40 0.17
gb|AL810956.1|AL810956 AL810956 d:26 Triticum aestivum cDNA... 40 0.17
gb|CV774395.1|CV774395 FGAS068793 Triticum aestivum FGAS: L... 40 0.17
gb|AY952873.1| Triticum aestivum cultivar Shinchunaga clone... 40 0.17
gb|AY952874.1| Triticum aestivum cultivar 99L2 clone GWM337... 40 0.17
>gb|BQ789105.1|BQ789105 WHE4157_F05_L09ZS Wheat CS whole plant cDNA library Triticum
aestivum cDNA clone WHE4157_F05_L09, mRNA sequence
Length = 721
Score = 133 bits (67), Expect = 1e-029
Identities = 151/179 (84%)
Strand = Plus / Plus
Query: 405 agatgcagggctcgtcctctccaccgatgctaagcctcgcctgaaatggacacccgagct 464
|||||| |||||| |||| ||||| ||||| ||||| || || |||||||| || |||||
Sbjct: 306 agatgcggggctcatcctgtccacggatgcgaagccccggctcaaatggactcctgagct 365
Query: 465 gcacgagcgttttgttgaggcggtgcatcagctcggaggcccagacaaggccacgccgaa 524
|||||||||||||| || |||||| | |||| ||||| || ||||| |||||||||||
Sbjct: 366 gcacgagcgttttgcggatgcggtgaagaagctaggagggcctgacaaagccacgccgaa 425
Query: 525 aaccatcatgaggctcatggggatccctggactcaccctgtaccatctcaagagccatc 583
| ||||||||| ||||||| ||||| ||||| || ||||||||||||||||||||||
Sbjct: 426 ggcaatcatgagggtcatgggaatcccgggactaactctgtaccatctcaagagccatc 484
Score = 40.1 bits (20), Expect = 0.17
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 284 agcagatgtatcatcagcaacagc 307
||||||||||||| ||||||||||
Sbjct: 175 agcagatgtatcaccagcaacagc 198
>gb|CV775962.1|CV775962 FGAS070366 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 829
Score = 133 bits (67), Expect = 1e-029
Identities = 151/179 (84%)
Strand = Plus / Plus
Query: 405 agatgcagggctcgtcctctccaccgatgctaagcctcgcctgaaatggacacccgagct 464
|||||| |||||| |||| ||||| ||||| ||||| || || |||||||| || |||||
Sbjct: 421 agatgcggggctcatcctgtccacggatgcgaagccccggctcaaatggactcctgagct 480
Query: 465 gcacgagcgttttgttgaggcggtgcatcagctcggaggcccagacaaggccacgccgaa 524
|||||||||||||| || |||||| | |||| ||||| || ||||| |||||||||||
Sbjct: 481 gcacgagcgttttgcggatgcggtgaagaagctaggagggcctgacaaagccacgccgaa 540
Query: 525 aaccatcatgaggctcatggggatccctggactcaccctgtaccatctcaagagccatc 583
| ||||||||| ||||||| ||||| ||||| || ||||||||||||||||||||||
Sbjct: 541 ggcaatcatgagggtcatgggaatcccgggactaactctgtaccatctcaagagccatc 599
Score = 40.1 bits (20), Expect = 0.17
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 284 agcagatgtatcatcagcaacagc 307
||||||||||||| ||||||||||
Sbjct: 291 agcagatgtatcaccagcaacagc 314
>gb|BJ314208.1|BJ314208 BJ314208 Y. Ogihara unpublished cDNA library, Wh_yf Triticum
aestivum cDNA clone whyf9k24 5', mRNA sequence
Length = 672
Score = 79.8 bits (40), Expect = 2e-013
Identities = 112/136 (82%)
Strand = Plus / Plus
Query: 448 aaatggacacccgagctgcacgagcgttttgttgaggcggtgcatcagctcggaggccca 507
|||||||| || ||||| || || |||||||| ||||| || |||| ||||| || |||
Sbjct: 316 aaatggacccctgagctacatgatcgttttgtggaggcagtaaatcaactcggcggacca 375
Query: 508 gacaaggccacgccgaaaaccatcatgaggctcatggggatccctggactcaccctgtac 567
||||| ||||| || |||||||| |||||||||||||| |||||||||| || | ||
Sbjct: 376 gacaaagccaccccaaaaaccattatgaggctcatgggtgtccctggactaacattatat 435
Query: 568 catctcaagagccatc 583
||||| ||||||||||
Sbjct: 436 catcttaagagccatc 451
>gb|AL828067.1|AL828067 AL828067 p:739 Triticum aestivum cDNA clone F11_p739_plate_5, mRNA
sequence
Length = 587
Score = 75.8 bits (38), Expect = 3e-012
Identities = 137/170 (80%)
Strand = Plus / Plus
Query: 412 gggctcgtcctctccaccgatgctaagcctcgcctgaaatggacacccgagctgcacgag 471
|||||| |||| || || ||||| |||||||| || || ||||| || ||||||||||||
Sbjct: 305 gggctcatcctgtcgacggatgcgaagcctcggcttaagtggactcctgagctgcacgag 364
Query: 472 cgttttgttgaggcggtgcatcagctcggaggcccagacaaggccacgccgaaaaccatc 531
|| || | || |||||| | |||| ||||| || ||||| || |||||||| | |||
Sbjct: 365 cggttcgcggatgcggtgaagaagctaggagggcctgacaaagctacgccgaaggcaatc 424
Query: 532 atgaggctcatggggatccctggactcaccctgtaccatctcaagagcca 581
|||||| ||||||| ||||| ||| | || ||||||||||| ||||||||
Sbjct: 425 atgagggtcatgggaatcccgggattaactctgtaccatcttaagagcca 474
>gb|DR736378.1|DR736378 FGAS081748 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1070
Score = 75.8 bits (38), Expect = 3e-012
Identities = 137/170 (80%)
Strand = Plus / Plus
Query: 412 gggctcgtcctctccaccgatgctaagcctcgcctgaaatggacacccgagctgcacgag 471
|||||| |||| || || ||||| |||||||| || || ||||| || ||||||||||||
Sbjct: 309 gggctcatcctgtcgacggatgcgaagcctcggcttaagtggactcctgagctgcacgag 368
Query: 472 cgttttgttgaggcggtgcatcagctcggaggcccagacaaggccacgccgaaaaccatc 531
|| || | || |||||| | |||| ||||| || ||||| || |||||||| | |||
Sbjct: 369 cggttcgcggatgcggtgaagaagctaggagggcctgacaaagctacgccgaaggcaatc 428
Query: 532 atgaggctcatggggatccctggactcaccctgtaccatctcaagagcca 581
|||||| ||||||| ||||| ||| | || ||||||||||| ||||||||
Sbjct: 429 atgagggtcatgggaatcccgggattaactctgtaccatcttaagagcca 478
>gb|BM134627.1|BM134627 WHE0451_C01_C01ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE0451_C01_C01,
mRNA sequence
Length = 597
Score = 67.9 bits (34), Expect = 7e-010
Identities = 91/110 (82%)
Strand = Plus / Plus
Query: 448 aaatggacacccgagctgcacgagcgttttgttgaggcggtgcatcagctcggaggccca 507
|||||||| || ||||| || || ||||| || ||||| || |||| ||||| || |||
Sbjct: 194 aaatggacccctgagctacatgatcgtttcgtggaggcagtaaatcaactcggcggacca 253
Query: 508 gacaaggccacgccgaaaaccatcatgaggctcatggggatccctggact 557
||||| ||||| || |||||||| |||||||||||||| ||||||||||
Sbjct: 254 gacaaagccaccccaaaaaccattatgaggctcatgggtgtccctggact 303
>gb|CK210012.1|CK210012 FGAS021803 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1103
Score = 65.9 bits (33), Expect = 3e-009
Identities = 75/89 (84%)
Strand = Plus / Plus
Query: 493 cagctcggaggcccagacaaggccacgccgaaaaccatcatgaggctcatggggatccct 552
|||||||| ||||| |||||||| |||||||| || ||||||||| |||||||| ||
Sbjct: 499 cagctcggcggccccgacaaggcgacgccgaagacgatcatgagggtcatgggggtcaag 558
Query: 553 ggactcaccctgtaccatctcaagagcca 581
|| ||||| || ||||| |||||||||||
Sbjct: 559 gggctcactctctaccacctcaagagcca 587
>gb|BJ226877.1|BJ226877 BJ226877 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl10g21 3', mRNA sequence
Length = 550
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 261 tctcactcactcactcactc 280
>gb|BJ292232.1|BJ292232 BJ292232 Y. Ogihara unpublished cDNA library, Wh_SL Triticum
aestivum cDNA clone whsl26n24 5', mRNA sequence
Length = 116
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 50 tctcactcactcactcactc 31
>gb|CA700361.1|CA700361 wkm1c.pk005.g18 wkm1c Triticum aestivum cDNA clone wkm1c.pk005.g18
5' end, mRNA sequence
Length = 405
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 313 tctcactcactcactcactc 294
>gb|CD921332.1|CD921332 G608.120D21F010913 G608 Triticum aestivum cDNA clone G608120D21,
mRNA sequence
Length = 632
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 556 tctcactcactcactcactc 537
>gb|CD932587.1|CD932587 GR45.118H10F010718 GR45 Triticum aestivum cDNA clone GR45118H10,
mRNA sequence
Length = 381
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 135 tctcactcactcactcactc 116
>gb|CK205806.1|CK205806 FGAS017351 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1041
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 84 tctcactcactcactcactc 103
>gb|CK208140.1|CK208140 FGAS019821 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1123
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 304 tctcactcactcactcactc 323
>gb|AJ613277.1|AJ613277 AJ613277 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 08530R, mRNA
sequence
Length = 538
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 458 tctcactcactcactcactc 439
>gb|AL810956.1|AL810956 AL810956 d:26 Triticum aestivum cDNA clone G06_d26_plate_14, mRNA
sequence
Length = 305
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 216 tctcactcactcactcactc 197
>gb|CV774395.1|CV774395 FGAS068793 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 847
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 140 ctcactcactcactcactcc 159
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 135 tctcactcactcactcactc 154
>gb|AY952873.1| Triticum aestivum cultivar Shinchunaga clone GWM337
microsatellite sequence
Length = 172
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 28 tctcactcactcactcactc 47
>gb|AY952874.1| Triticum aestivum cultivar 99L2 clone GWM337 microsatellite
sequence
Length = 186
Score = 40.1 bits (20), Expect = 0.17
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 30 tctcactcactcactcactc 49
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 106,614
Number of Sequences: 636343
Number of extensions: 106614
Number of successful extensions: 29568
Number of sequences better than 0.5: 19
Number of HSP's better than 0.5 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29494
Number of HSP's gapped (non-prelim): 56
length of query: 583
length of database: 367,240,239
effective HSP length: 19
effective length of query: 564
effective length of database: 355,149,722
effective search space: 200304443208
effective search space used: 200304443208
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)