BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2623051.2.1
(991 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN011658.1|CN011658 WHE3886_H05_P10ZS Wheat Fusarium gra... 246 2e-063
gb|CK155262.1|CK155262 FGAS033983 Triticum aestivum FGAS: T... 176 2e-042
gb|BQ619761.1|BQ619761 TaLr1169D01F TaLr1 Triticum aestivum... 172 3e-041
gb|BQ620351.1|BQ620351 TaLr1169D01R TaLr1 Triticum aestivum... 172 3e-041
gb|CK155245.1|CK155245 FGAS033966 Triticum aestivum FGAS: T... 151 1e-034
gb|CA617704.1|CA617704 wl1n.pk0023.b2 wl1n Triticum aestivu... 111 9e-023
gb|BF202651.1|BF202651 WHE1783_E07_I13ZS Wheat pre-anthesis... 94 2e-017
gb|BE418545.1|BE418545 SCL071.D11R990707 ITEC SCL Wheat Lea... 88 1e-015
gb|BE418615.1|BE418615 SCL072.D10R990708 ITEC SCL Wheat Lea... 88 1e-015
gb|BF201750.1|BF201750 WHE1765_B10_D19ZS Wheat pre-anthesis... 88 1e-015
gb|BG263827.1|BG263827 WHE2338_E02_I04ZS Wheat pre-anthesis... 88 1e-015
gb|BJ282154.1|BJ282154 BJ282154 Y. Ogihara unpublished cDNA... 88 1e-015
gb|BJ303709.1|BJ303709 BJ303709 Y. Ogihara unpublished cDNA... 88 1e-015
gb|BJ316789.1|BJ316789 BJ316789 Y. Ogihara unpublished cDNA... 88 1e-015
gb|CA632593.1|CA632593 wle1n.pk0054.g3 wle1n Triticum aesti... 88 1e-015
gb|CD909412.1|CD909412 G468.112J06F010820 G468 Triticum aes... 88 1e-015
gb|AL811600.1|AL811600 AL811600 d:15 Triticum aestivum cDNA... 86 5e-015
gb|BJ309590.1|BJ309590 BJ309590 Y. Ogihara unpublished cDNA... 80 3e-013
gb|BG904388.1|BG904388 TaLr1131G07R TaLr1 Triticum aestivum... 72 8e-011
gb|BG904389.1|BG904389 TaLr1131G07F TaLr1 Triticum aestivum... 72 8e-011
gb|BJ287270.1|BJ287270 BJ287270 Y. Ogihara unpublished cDNA... 72 8e-011
gb|BJ322347.1|BJ322347 BJ322347 Y. Ogihara unpublished cDNA... 72 8e-011
gb|BQ619950.1|BQ619950 TaLr1143G11F TaLr1 Triticum aestivum... 72 8e-011
gb|BQ620561.1|BQ620561 TaLr1143G11R TaLr1 Triticum aestivum... 72 8e-011
gb|CD934614.1|CD934614 OV.001H22R001002 OV Triticum aestivu... 72 8e-011
gb|AL811929.1|AL811929 AL811929 d:15 Triticum aestivum cDNA... 72 8e-011
gb|CV765195.1|CV765195 FGAS059580 Triticum aestivum FGAS: L... 72 8e-011
gb|CK154308.1|CK154308 FGAS033006 Triticum aestivum FGAS: T... 66 5e-009
gb|BQ483791.1|BQ483791 WHE3512_F08_L16ZS Wheat unstressed r... 64 2e-008
gb|BQ620857.1|BQ620857 TaLr1103B01R TaLr1 Triticum aestivum... 64 2e-008
gb|BQ620859.1|BQ620859 TaLr1102E05R TaLr1 Triticum aestivum... 64 2e-008
gb|AL828671.1|AL828671 AL828671 p:739 Triticum aestivum cDN... 64 2e-008
gb|CV758907.1|CV758907 FGAS053289 Triticum aestivum FGAS: L... 64 2e-008
gb|CV768556.1|CV768556 FGAS062947 Triticum aestivum FGAS: L... 64 2e-008
gb|CD922855.1|CD922855 G750.105E24F010529 G750 Triticum aes... 62 8e-008
gb|BJ224062.1|BJ224062 BJ224062 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ224206.1|BJ224206 BJ224206 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ224208.1|BJ224208 BJ224208 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ228910.1|BJ228910 BJ228910 Y. Ogihara unpublished cDNA... 60 3e-007
gb|CD934605.1|CD934605 OV.001H18F000912 OV Triticum aestivu... 60 3e-007
gb|BF484005.1|BF484005 WHE2305_B06_C11ZS Wheat pre-anthesis... 56 5e-006
gb|BJ255084.1|BJ255084 BJ255084 Y. Ogihara unpublished cDNA... 56 5e-006
gb|CA723468.1|CA723468 wdr1f.pk003.i19 wdr1f Triticum aesti... 54 2e-005
gb|BQ170776.1|BQ170776 WHE2305_B06_C11ZT Wheat pre-anthesis... 50 3e-004
gb|CA622740.1|CA622740 wl1n.pk0097.d2 wl1n Triticum aestivu... 50 3e-004
gb|CA652600.1|CA652600 wre1n.pk167.c7 wre1n Triticum aestiv... 50 3e-004
gb|U76383.1|U76383 TAU76383 Triticum aestivum (G.Segal) Tri... 46 0.005
gb|BE500139.1|BE500139 WHE0978_B12_D24ZS Wheat pre-anthesis... 46 0.005
gb|BJ256225.1|BJ256225 BJ256225 Y. Ogihara unpublished cDNA... 46 0.005
gb|BJ261762.1|BJ261762 BJ261762 Y. Ogihara unpublished cDNA... 46 0.005
gb|BQ806587.1|BQ806587 WHE3580_G08_M16ZS Wheat developing g... 46 0.005
gb|BJ211893.1|BJ211893 BJ211893 Y. Ogihara unpublished cDNA... 46 0.005
gb|BJ219346.1|BJ219346 BJ219346 Y. Ogihara unpublished cDNA... 46 0.005
gb|BJ267199.1|BJ267199 BJ267199 Y. Ogihara unpublished cDNA... 46 0.005
gb|BJ278664.1|BJ278664 BJ278664 Y. Ogihara unpublished cDNA... 46 0.005
gb|BJ283717.1|BJ283717 BJ283717 Y. Ogihara unpublished cDNA... 46 0.005
gb|CA642169.1|CA642169 wre1n.pk0053.e12 wre1n Triticum aest... 46 0.005
gb|CD909746.1|CD909746 G468.113G24F010820 G468 Triticum aes... 46 0.005
gb|CK164366.1|CK164366 FGAS048268 Triticum aestivum FGAS: T... 46 0.005
gb|CK164382.1|CK164382 FGAS048285 Triticum aestivum FGAS: T... 46 0.005
gb|CK164385.1|CK164385 FGAS048288 Triticum aestivum FGAS: T... 46 0.005
gb|CK164544.1|CK164544 FGAS048458 Triticum aestivum FGAS: T... 46 0.005
gb|CK164577.1|CK164577 FGAS048491 Triticum aestivum FGAS: T... 46 0.005
gb|CK164623.1|CK164623 FGAS048541 Triticum aestivum FGAS: T... 46 0.005
gb|CK164897.1|CK164897 FGAS048824 Triticum aestivum FGAS: T... 46 0.005
gb|CK164983.1|CK164983 FGAS048916 Triticum aestivum FGAS: T... 46 0.005
gb|CK165149.1|CK165149 FGAS049090 Triticum aestivum FGAS: T... 46 0.005
gb|CK167118.1|CK167118 FGAS051402 Triticum aestivum FGAS: T... 46 0.005
gb|CK167406.1|CK167406 FGAS051756 Triticum aestivum FGAS: T... 46 0.005
gb|CK167530.1|CK167530 FGAS051913 Triticum aestivum FGAS: T... 46 0.005
gb|CK167552.1|CK167552 FGAS051941 Triticum aestivum FGAS: T... 46 0.005
gb|CK167661.1|CK167661 FGAS052070 Triticum aestivum FGAS: T... 46 0.005
gb|CK168029.1|CK168029 FGAS052506 Triticum aestivum FGAS: T... 46 0.005
gb|CK168280.1|CK168280 FGAS052798 Triticum aestivum FGAS: T... 46 0.005
gb|CK209831.1|CK209831 FGAS021615 Triticum aestivum FGAS: L... 46 0.005
gb|CV764291.1|CV764291 FGAS058676 Triticum aestivum FGAS: L... 46 0.005
gb|CV781335.1|CV781335 FGAS075746 Triticum aestivum FGAS: L... 46 0.005
gb|DR734049.1|DR734049 FGAS079805 Triticum aestivum FGAS: L... 46 0.005
gb|BF483858.1|BF483858 WHE2307_F01_L01ZS Wheat pre-anthesis... 44 0.018
gb|BJ287476.1|BJ287476 BJ287476 Y. Ogihara unpublished cDNA... 44 0.018
gb|BJ314373.1|BJ314373 BJ314373 Y. Ogihara unpublished cDNA... 44 0.018
gb|BJ315172.1|BJ315172 BJ315172 Y. Ogihara unpublished cDNA... 44 0.018
gb|BJ320652.1|BJ320652 BJ320652 Y. Ogihara unpublished cDNA... 44 0.018
gb|BQ238470.1|BQ238470 TaE05003G02F TaE05 Triticum aestivum... 44 0.018
gb|BQ242352.1|BQ242352 TaE15030F06F TaE15 Triticum aestivum... 44 0.018
gb|CD454392.1|CD454392 WHE2307_F01_L01ZT CS wheat pre-anthe... 44 0.018
gb|CD875762.1|CD875762 AZO3.107E20F011008 AZO3 Triticum aes... 44 0.018
gb|CK159285.1|CK159285 FGAS040708 Triticum aestivum FGAS: T... 44 0.018
gb|CV776631.1|CV776631 FGAS071035 Triticum aestivum FGAS: L... 44 0.018
gb|BE213341.1|BE213341 EST0110 Triticum aestivum Lambda Zap... 42 0.072
gb|BE500815.1|BE500815 WHE0991-0994_F01_F01ZS Wheat pre-ant... 42 0.072
gb|BI480011.1|BI480011 WHE3453_F08_L15ZS Wheat pre-anthesis... 42 0.072
gb|BQ169933.1|BQ169933 WHE0980_E03_I06ZT Wheat pre-anthesis... 42 0.072
gb|AL825827.1|AL825827 AL825827 p:234 Triticum aestivum cDN... 42 0.072
gb|BQ806546.1|BQ806546 WHE3580_C10_E20ZS Wheat developing g... 42 0.072
gb|BJ210930.1|BJ210930 BJ210930 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ218298.1|BJ218298 BJ218298 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ235920.1|BJ235920 BJ235920 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ241127.1|BJ241127 BJ241127 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ245663.1|BJ245663 BJ245663 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ251551.1|BJ251551 BJ251551 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ279221.1|BJ279221 BJ279221 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ279238.1|BJ279238 BJ279238 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ284287.1|BJ284287 BJ284287 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ284305.1|BJ284305 BJ284305 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ298946.1|BJ298946 BJ298946 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ304720.1|BJ304720 BJ304720 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ310531.1|BJ310531 BJ310531 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ315568.1|BJ315568 BJ315568 Y. Ogihara unpublished cDNA... 42 0.072
gb|BJ315783.1|BJ315783 BJ315783 Y. Ogihara unpublished cDNA... 42 0.072
gb|CA499991.1|CA499991 WHE4014_B03_C06ZT Wheat meiotic anth... 42 0.072
gb|CA500025.1|CA500025 WHE4014_E03_I06ZT Wheat meiotic anth... 42 0.072
gb|CA612175.1|CA612175 wr1.pk0141.f8 wr1 Triticum aestivum ... 42 0.072
gb|CA622219.1|CA622219 wl1n.pk0088.b8 wl1n Triticum aestivu... 42 0.072
gb|CA625918.1|CA625918 wl1n.pk0142.h2 wl1n Triticum aestivu... 42 0.072
gb|CA640238.1|CA640238 wre1n.pk0033.b2 wre1n Triticum aesti... 42 0.072
gb|CA665675.1|CA665675 wlk1.pk0027.e3 wlk1 Triticum aestivu... 42 0.072
gb|CD882646.1|CD882646 F1.110J14F010531 F1 Triticum aestivu... 42 0.072
gb|CD903598.1|CD903598 G356.110M14F010919 G356 Triticum aes... 42 0.072
gb|CK200542.1|CK200542 FGAS009057 Triticum aestivum FGAS: L... 42 0.072
gb|CK215716.1|CK215716 FGAS027685 Triticum aestivum FGAS: L... 42 0.072
gb|AJ610237.1|AJ610237 AJ610237 Triticum turgidum subsp. du... 42 0.072
gb|CV764659.1|CV764659 FGAS059044 Triticum aestivum FGAS: L... 42 0.072
gb|CV770173.1|CV770173 FGAS064566 Triticum aestivum FGAS: L... 42 0.072
gb|CV771159.1|CV771159 FGAS065552 Triticum aestivum FGAS: L... 42 0.072
gb|DR739447.1|DR739447 FGAS084664 Triticum aestivum FGAS: L... 42 0.072
gb|BG263182.1|BG263182 WHE2339_A06_B11ZS Wheat pre-anthesis... 40 0.28
gb|BG907646.1|BG907646 TaLr1161G01F TaLr1 Triticum aestivum... 40 0.28
gb|BM134419.1|BM134419 WHE0490_A10_B20ZS Wheat Fusarium gra... 40 0.28
gb|BJ247888.1|BJ247888 BJ247888 Y. Ogihara unpublished cDNA... 40 0.28
gb|BJ248149.1|BJ248149 BJ248149 Y. Ogihara unpublished cDNA... 40 0.28
gb|CA499779.1|CA499779 WHE4011_E04_J07ZT Wheat meiotic anth... 40 0.28
gb|CA621464.1|CA621464 wl1n.pk0078.b8 wl1n Triticum aestivu... 40 0.28
gb|CA632148.1|CA632148 wle1n.pk0049.h11 wle1n Triticum aest... 40 0.28
gb|CA701022.1|CA701022 wkm2c.pk0001.b4 wkm2c Triticum aesti... 40 0.28
gb|CA725530.1|CA725530 wds3f.pk002.b5 wds3f Triticum aestiv... 40 0.28
gb|CD908009.1|CD908009 G468.108L04F010816 G468 Triticum aes... 40 0.28
>gb|CN011658.1|CN011658 WHE3886_H05_P10ZS Wheat Fusarium graminearum infected spike cDNA
library Triticum aestivum cDNA clone WHE3886_H05_P10,
mRNA sequence
Length = 654
Score = 246 bits (124), Expect = 2e-063
Identities = 202/228 (88%)
Strand = Plus / Minus
Query: 442 gggctgcttccgcttcagcaggtgtgacttgagcttcttcatgtcggccggcttcacggg 501
||||||||||||| | |||||| |||||||||||||||||||| || ||||||||||
Sbjct: 335 gggctgcttccgccggaccaggtgcgacttgagcttcttcatgtcagcgagcttcacggg 276
Query: 502 cttcaggaagaactcctccgcgccatcctgcaagcacctgctgatccgggcaggcacgtt 561
||| |||||||||||||||||||| |||| ||||||||||||||||| ||||||||| ||
Sbjct: 275 cttgaggaagaactcctccgcgccgtcctccaagcacctgctgatcctggcaggcacatt 216
Query: 562 ctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttcactcgcgt 621
||||||||||||||||||||| ||||||||| | | || || |||||||| || | | |
Sbjct: 215 ctcagacgacatgatcaccactggaatgtccttcaatgaagatgaccccttgaccctcct 156
Query: 622 gagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 155 cagcagatcgtatcctgtcatgccaggcatgcagtagtcagtgatgat 108
>gb|CK155262.1|CK155262 FGAS033983 Triticum aestivum FGAS: TaLt2 Triticum aestivum cDNA,
mRNA sequence
Length = 885
Score = 176 bits (89), Expect = 2e-042
Identities = 123/133 (92%), Gaps = 1/133 (0%)
Strand = Plus / Plus
Query: 460 caggtgtgacttgagcttcttcatgtcggccggcttcacgggcttcaggaagaactcctc 519
|||||| |||||||||||||||||||| ||| ||||||||||||| ||||||||||| ||
Sbjct: 715 caggtgggacttgagcttcttcatgtcagccagcttcacgggcttgaggaagaactc-tc 773
Query: 520 cgcgccatcctgcaagcacctgctgatccgggcaggcacgttctcagacgacatgatcac 579
|||||| |||| ||||||||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 774 cgcgccgtcctccaagcacctgctgatcctggcaggcacattctcagacgacatgatcac 833
Query: 580 caccggaatgtcc 592
||| |||||||||
Sbjct: 834 cactggaatgtcc 846
>gb|BQ619761.1|BQ619761 TaLr1169D01F TaLr1 Triticum aestivum cDNA clone TaLr1169D01F, mRNA
sequence
Length = 582
Score = 172 bits (87), Expect = 3e-041
Identities = 141/159 (88%)
Strand = Plus / Plus
Query: 764 ctcagccccagcagctccagcgccttgttcccggaatccaccgtggtcacttggtaagac 823
||||| ||||| | ||||||||||||| ||||||| |||||| |||| |||||||| ||
Sbjct: 405 ctcagtcccaggacctccagcgccttgctcccggagtccaccatggtgacttggtaggag 464
Query: 824 gagctcttgagcagcatctcgatgagcttcctgtcgatgatgctgtcgtccaccgccagg 883
||| || |||||||||||||||||||||||| |||||||| |||||||||||||||||||
Sbjct: 465 gaggtcctgagcagcatctcgatgagcttccggtcgatgacgctgtcgtccaccgccagg 524
Query: 884 acatggaaccgcgactcggcgtccagcaccgtcatggct 922
|| |||||||| | ||||||||| | |||||||||||||
Sbjct: 525 acgtggaaccgggcctcggcgtcgaccaccgtcatggct 563
Score = 141 bits (71), Expect = 1e-031
Identities = 137/159 (86%)
Strand = Plus / Plus
Query: 537 acctgctgatccgggcaggcacgttctcagacgacatgatcaccaccggaatgtccgtga 596
|||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||| | |
Sbjct: 196 acctgctgatcctggcaggcacattctcagacgacatgatcaccactggaatgtccttca 255
Query: 597 gcgatgaggaccccttcactcgcgtgagcagatcgtatcctgtcatgccgggcatgcagt 656
|| || |||||||| || | | | ||||||||||||||||||||||| ||||||||||
Sbjct: 256 atgaagatgaccccttgaccctcctcagcagatcgtatcctgtcatgccaggcatgcagt 315
Query: 657 agtcagtgatgatgagactcacgtcgatctcctgatggt 695
|||| |||||||| | | ||||| | | |||||||||||
Sbjct: 316 agtctgtgatgatcaaattcacgcccacctcctgatggt 354
>gb|BQ620351.1|BQ620351 TaLr1169D01R TaLr1 Triticum aestivum cDNA clone TaLr1169D01R, mRNA
sequence
Length = 677
Score = 172 bits (87), Expect = 3e-041
Identities = 141/159 (88%)
Strand = Plus / Minus
Query: 764 ctcagccccagcagctccagcgccttgttcccggaatccaccgtggtcacttggtaagac 823
||||| ||||| | ||||||||||||| ||||||| |||||| |||| |||||||| ||
Sbjct: 646 ctcagtcccaggacctccagcgccttgctcccggagtccaccatggtgacttggtaggag 587
Query: 824 gagctcttgagcagcatctcgatgagcttcctgtcgatgatgctgtcgtccaccgccagg 883
||| || |||||||||||||||||||||||| |||||||| |||||||||||||||||||
Sbjct: 586 gaggtcctgagcagcatctcgatgagcttccggtcgatgacgctgtcgtccaccgccagg 527
Query: 884 acatggaaccgcgactcggcgtccagcaccgtcatggct 922
|| |||||||| | ||||||||| | |||||||||||||
Sbjct: 526 acgtggaaccgggcctcggcgtcgaccaccgtcatggct 488
>gb|CK155245.1|CK155245 FGAS033966 Triticum aestivum FGAS: TaLt2 Triticum aestivum cDNA,
mRNA sequence
Length = 887
Score = 151 bits (76), Expect = 1e-034
Identities = 135/152 (88%), Gaps = 2/152 (1%)
Strand = Plus / Plus
Query: 442 gggctgcttccgcttcagcaggtgtgacttgagcttcttcatgtcggccggcttcacggg 501
||||||||||||| | |||||| |||||||||||||||||||| ||| ||||||||||
Sbjct: 696 gggctgcttccgccggaccaggtgggacttgagcttcttcatgtcagccagcttcacggg 755
Query: 502 cttcaggaagaactcctccgcgccatcctgc-aagcacctgctgatccgggcaggcacgt 560
||| |||||||||||||||||||| || | ||||| |||||||||| ||||||||| |
Sbjct: 756 cttgaggaagaactcctccgcgcccgtctccaaagca-ctgctgatcctggcaggcacat 814
Query: 561 tctcagacgacatgatcaccaccggaatgtcc 592
|||||||||||||||||||||| |||||||||
Sbjct: 815 tctcagacgacatgatcaccactggaatgtcc 846
>gb|CA617704.1|CA617704 wl1n.pk0023.b2 wl1n Triticum aestivum cDNA clone wl1n.pk0023.b2 5'
end, mRNA sequence
Length = 583
Score = 111 bits (56), Expect = 9e-023
Identities = 98/112 (87%)
Strand = Plus / Minus
Query: 781 cagcgccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcat 840
|||||||||| ||||||| || || |||||||||||| | || ||| ||||||| ||| |
Sbjct: 257 cagcgccttgctcccggagtcgacagtggtcacttggaaggaagaggtcttgaggagcct 198
Query: 841 ctcgatgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 197 ctcgatgagcttcctgtccgggaggctgtcgtccaccgccaggacatggaac 146
Score = 65.9 bits (33), Expect = 5e-009
Identities = 45/49 (91%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
||||||| || |||||||||||||| |||||||||||||| ||||||||
Sbjct: 402 tgagcaggtcatatcctgtcatgccaggcatgcagtagtctgtgatgat 354
>gb|BF202651.1|BF202651 WHE1783_E07_I13ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1783_E07_I13, mRNA sequence
Length = 378
Score = 93.7 bits (47), Expect = 2e-017
Identities = 92/107 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| |||||
Sbjct: 225 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctcg 166
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaa 891
|||||||||||||||| || |||||| ||||| |||| |||||||||
Sbjct: 165 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaa 119
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||| || |||||||| || ||||||||||||||||||||||||||
Sbjct: 362 tgagcagatcataccctgtcatcccaggcatgcagtagtcagtgatgatgag 311
>gb|BE418545.1|BE418545 SCL071.D11R990707 ITEC SCL Wheat Leaf Library Triticum aestivum
cDNA clone SCL071.D11, mRNA sequence
Length = 892
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 275 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 216
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||| || |||||| ||||| |||| ||||||||||
Sbjct: 215 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaac 168
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 412 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 361
>gb|BE418615.1|BE418615 SCL072.D10R990708 ITEC SCL Wheat Leaf Library Triticum aestivum
cDNA clone SCL072.D10, mRNA sequence
Length = 897
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 275 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 216
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||| || |||||| ||||| |||| ||||||||||
Sbjct: 215 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaac 168
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 412 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 361
>gb|BF201750.1|BF201750 WHE1765_B10_D19ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1765_B10_D19, mRNA sequence
Length = 483
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| ||||||||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 229 gccttggtcccggaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 170
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||| | || |||||| ||||| |||| ||||||||||
Sbjct: 169 atgagcttcctgtcaaggacgctgtcatccacggccaagacatggaac 122
Score = 79.8 bits (40), Expect = 3e-013
Identities = 49/52 (94%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 366 tgagcagatcgtatcctgtcatcccaggcatgcagtagtcggtgatgatgag 315
>gb|BG263827.1|BG263827 WHE2338_E02_I04ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2338_E02_I04, mRNA sequence
Length = 514
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 256 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 197
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||| || |||||| ||||| |||| ||||||||||
Sbjct: 196 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaac 149
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 393 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 342
>gb|BJ282154.1|BJ282154 BJ282154 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr25g04 5', mRNA sequence
Length = 673
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 259 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 200
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||| || |||||| ||||| |||| ||||||||||
Sbjct: 199 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaac 152
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 396 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 345
>gb|BJ303709.1|BJ303709 BJ303709 Y. Ogihara unpublished cDNA library, Wh_yd Triticum
aestivum cDNA clone whyd20m14 5', mRNA sequence
Length = 588
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| ||||||||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 225 gccttggtcccggaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 166
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||| | || |||||| ||||| |||| ||||||||||
Sbjct: 165 atgagcttcctgtcaaggacgctgtcatccacggccaagacatggaac 118
Score = 79.8 bits (40), Expect = 3e-013
Identities = 49/52 (94%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 362 tgagcagatcgtatcctgtcatcccaggcatgcagtagtcggtgatgatgag 311
>gb|BJ316789.1|BJ316789 BJ316789 Y. Ogihara unpublished cDNA library, Wh_yf Triticum
aestivum cDNA clone whyf24n09 5', mRNA sequence
Length = 637
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 234 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 175
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||| || |||||| ||||| |||| ||||||||||
Sbjct: 174 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaac 127
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 371 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 320
>gb|CA632593.1|CA632593 wle1n.pk0054.g3 wle1n Triticum aestivum cDNA clone wle1n.pk0054.g3
5' end, mRNA sequence
Length = 551
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 263 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 204
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||| || |||||| ||||| |||| ||||||||||
Sbjct: 203 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaac 156
Score = 63.9 bits (32), Expect = 2e-008
Identities = 47/52 (90%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||| |||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 401 tgagcaaatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 350
>gb|CD909412.1|CD909412 G468.112J06F010820 G468 Triticum aestivum cDNA clone G468112J06,
mRNA sequence
Length = 624
Score = 87.7 bits (44), Expect = 1e-015
Identities = 92/108 (85%)
Strand = Plus / Minus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| |||| |||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 197 gccttggtcccagaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 138
Query: 845 atgagcttcctgtcgatgatgctgtcgtccaccgccaggacatggaac 892
|||||||||||||||| || |||||| ||||| |||| ||||||||||
Sbjct: 137 atgagcttcctgtcgaggacgctgtcatccacggccaagacatggaac 90
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 334 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 283
>gb|AL811600.1|AL811600 AL811600 d:15 Triticum aestivum cDNA clone D08_d15_plate_10, mRNA
sequence
Length = 437
Score = 85.7 bits (43), Expect = 5e-015
Identities = 52/55 (94%)
Strand = Plus / Minus
Query: 538 cctgctgatccgggcaggcacgttctcagacgacatgatcaccaccggaatgtcc 592
||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 65 cctgctgatcctggcaggcacattctcagacgacatgatcaccactggaatgtcc 11
>gb|BJ309590.1|BJ309590 BJ309590 Y. Ogihara unpublished cDNA library, Wh_yd Triticum
aestivum cDNA clone whyd20m14 3', mRNA sequence
Length = 735
Score = 79.8 bits (40), Expect = 3e-013
Identities = 49/52 (94%)
Strand = Plus / Plus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
|||||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 519 tgagcagatcgtatcctgtcatcccaggcatgcagtagtcggtgatgatgag 570
Score = 67.9 bits (34), Expect = 1e-009
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 785 gccttgttcccggaatccaccgtggtcacttggtaagacgagctcttgagcagcatctcg 844
|||||| ||||||||||||| ||||| |||||| |||| || ||||||| ||| ||||
Sbjct: 657 gccttggtcccggaatccacggtggtaacttggaaagaagatgtcttgaggagcctctca 716
Query: 845 atgagcttcctgtc 858
||||||||||||||
Sbjct: 717 atgagcttcctgtc 730
>gb|BG904388.1|BG904388 TaLr1131G07R TaLr1 Triticum aestivum cDNA clone TaLr1131G07 5',
mRNA sequence
Length = 660
Score = 71.9 bits (36), Expect = 8e-011
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 517 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 458
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 457 acgcgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 402
>gb|BG904389.1|BG904389 TaLr1131G07F TaLr1 Triticum aestivum cDNA clone TaLr1131G07 3',
mRNA sequence
Length = 611
Score = 71.9 bits (36), Expect = 8e-011
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 473 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 532
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 533 acgcgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 588
>gb|BJ287270.1|BJ287270 BJ287270 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr25g04 3', mRNA sequence
Length = 666
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Plus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 608 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 659
>gb|BJ322347.1|BJ322347 BJ322347 Y. Ogihara unpublished cDNA library, Wh_yf Triticum
aestivum cDNA clone whyf24n09 3', mRNA sequence
Length = 592
Score = 71.9 bits (36), Expect = 8e-011
Identities = 48/52 (92%)
Strand = Plus / Plus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgag 672
||||||||||||| |||||||| || |||||||||||||| |||||||||||
Sbjct: 489 tgagcagatcgtaccctgtcatcccaggcatgcagtagtcggtgatgatgag 540
>gb|BQ619950.1|BQ619950 TaLr1143G11F TaLr1 Triticum aestivum cDNA clone TaLr1143G11F, mRNA
sequence
Length = 612
Score = 71.9 bits (36), Expect = 8e-011
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 398 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 457
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 458 acgcgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 513
>gb|BQ620561.1|BQ620561 TaLr1143G11R TaLr1 Triticum aestivum cDNA clone TaLr1143G11R, mRNA
sequence
Length = 668
Score = 71.9 bits (36), Expect = 8e-011
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 517 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 458
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 457 acgcgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 402
>gb|CD934614.1|CD934614 OV.001H22R001002 OV Triticum aestivum cDNA clone OV001H22, mRNA
sequence
Length = 656
Score = 71.9 bits (36), Expect = 8e-011
Identities = 96/116 (82%)
Strand = Plus / Plus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 398 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 457
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 458 acccgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 513
>gb|AL811929.1|AL811929 AL811929 d:15 Triticum aestivum cDNA clone C06_d15_plate_18, mRNA
sequence
Length = 363
Score = 71.9 bits (36), Expect = 8e-011
Identities = 52/56 (92%), Gaps = 1/56 (1%)
Strand = Plus / Minus
Query: 538 cctgctgatccgggcaggcacgttctcagac-gacatgatcaccaccggaatgtcc 592
||||||||||| ||||||||| ||||||||| |||||||||||||| |||||||||
Sbjct: 59 cctgctgatcctggcaggcacattctcagacagacatgatcaccactggaatgtcc 4
>gb|CV765195.1|CV765195 FGAS059580 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 818
Score = 71.9 bits (36), Expect = 8e-011
Identities = 96/116 (82%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 734 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 675
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 674 acccgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 619
>gb|CK154308.1|CK154308 FGAS033006 Triticum aestivum FGAS: TaLt2 Triticum aestivum cDNA,
mRNA sequence
Length = 892
Score = 65.9 bits (33), Expect = 5e-009
Identities = 64/73 (87%), Gaps = 1/73 (1%)
Strand = Plus / Plus
Query: 442 gggctgcttccgcttcagcaggtgtgacttgagcttcttcatgtcggccggcttcac-gg 500
||||||||||||| | |||||| |||||||||||||||||||| ||| ||||||| ||
Sbjct: 698 gggctgcttccgccgaaccaggtgggacttgagcttcttcatgtcagccagcttcacggg 757
Query: 501 gcttcaggaagaa 513
|||| ||||||||
Sbjct: 758 gcttgaggaagaa 770
>gb|BQ483791.1|BQ483791 WHE3512_F08_L16ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3512_F08_L16, mRNA sequence
Length = 616
Score = 63.9 bits (32), Expect = 2e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 498 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 439
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 438 acgcgcttcagcagctcgtacccggtcatgccgggcatccaatagtcggtgatgat 383
>gb|BQ620857.1|BQ620857 TaLr1103B01R TaLr1 Triticum aestivum cDNA clone TaLr1103B01R, mRNA
sequence
Length = 504
Score = 63.9 bits (32), Expect = 2e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 488 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 429
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 428 acgcgcttcagcagctcgtacccggtcatgccgggcatccaatagtcggtgatgat 373
>gb|BQ620859.1|BQ620859 TaLr1102E05R TaLr1 Triticum aestivum cDNA clone TaLr1102E05R, mRNA
sequence
Length = 510
Score = 63.9 bits (32), Expect = 2e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 498 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 439
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 438 acgcgcttcagcagctcgtacccggtcatgccgggcatccaatagtcggtgatgat 383
>gb|AL828671.1|AL828671 AL828671 p:739 Triticum aestivum cDNA clone D11_p739_plate_7, mRNA
sequence
Length = 533
Score = 63.9 bits (32), Expect = 2e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 500 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 441
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 440 acgcgcttcagcagctcgtacccggtcatgccgggcatccaatagtcggtgatgat 385
>gb|CV758907.1|CV758907 FGAS053289 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 658
Score = 63.9 bits (32), Expect = 2e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| |||||||||||| |||| || || ||| |||| || ||| ||||
Sbjct: 625 ggcacgttctccgacgacatgatccccacggggatctcccggagctccgacgactccttg 566
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 565 acccgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 510
>gb|CV768556.1|CV768556 FGAS062947 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 830
Score = 63.9 bits (32), Expect = 2e-008
Identities = 95/116 (81%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttc 613
||||||||||| ||||||||||||||||| || || ||| |||| || ||| ||||
Sbjct: 304 ggcacgttctccgacgacatgatcaccacggggatctcccggagctccgacgactccttg 245
Query: 614 actcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| || ||||| ||||||||
Sbjct: 244 acgcgcttcagcagctcgtacccggtcatgccgggcatccaatagtcggtgatgat 189
>gb|CD922855.1|CD922855 G750.105E24F010529 G750 Triticum aestivum cDNA clone G750105E24,
mRNA sequence
Length = 492
Score = 61.9 bits (31), Expect = 8e-008
Identities = 82/99 (82%)
Strand = Plus / Minus
Query: 484 gtcggccggcttcacgggcttcaggaagaactcctccgcgccatcctgcaagcacctgct 543
||||| ||||| ||||||||||| | ||| ||||| || || |||| || ||||||| |
Sbjct: 189 gtcggacggctggacgggcttcagcaggaaatcctcggctccctcctccaggcacctgtt 130
Query: 544 gatccgggcaggcacgttctcagacgacatgatcaccac 582
||||| | |||||||||||| || ||||||||||||||
Sbjct: 129 gatccttgtaggcacgttctccgaggacatgatcaccac 91
>gb|BJ224062.1|BJ224062 BJ224062 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl8c01 5', mRNA sequence
Length = 433
Score = 60.0 bits (30), Expect = 3e-007
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 497 acgggcttcaggaagaactcctccgcgccatcctgcaagcacctgctgatccgggcaggc 556
||||||||||| | ||| ||||| || || |||| || ||||||| |||||| | ||||
Sbjct: 377 acgggcttcagcaggaaatcctcggctccctcctccaggcacctgttgatccttgtaggc 318
Query: 557 acgttctcagacgacatgatcaccac 582
|||||||| || ||||||||||||||
Sbjct: 317 acgttctctgaggacatgatcaccac 292
>gb|BJ224206.1|BJ224206 BJ224206 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl8n01 5', mRNA sequence
Length = 543
Score = 60.0 bits (30), Expect = 3e-007
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 497 acgggcttcaggaagaactcctccgcgccatcctgcaagcacctgctgatccgggcaggc 556
||||||||||| | ||| ||||| || || |||| || ||||||| |||||| | ||||
Sbjct: 435 acgggcttcagcaggaaatcctcggctccctcctccaggcacctgttgatccttgtaggc 376
Query: 557 acgttctcagacgacatgatcaccac 582
|||||||| || ||||||||||||||
Sbjct: 375 acgttctctgaggacatgatcaccac 350
>gb|BJ224208.1|BJ224208 BJ224208 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl8n08 5', mRNA sequence
Length = 486
Score = 60.0 bits (30), Expect = 3e-007
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 497 acgggcttcaggaagaactcctccgcgccatcctgcaagcacctgctgatccgggcaggc 556
|||||||||| | ||| ||||| ||||| |||| |||||| |||||||||| | |||
Sbjct: 467 acgggcttcatcaggaaatcctctgcgccttcctccaagcatctgctgatccttgtcggc 408
Query: 557 acgttctcagacgacatgatcaccac 582
|||||||| || ||||||||||||||
Sbjct: 407 acgttctccgaggacatgatcaccac 382
>gb|BJ228910.1|BJ228910 BJ228910 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl8n01 3', mRNA sequence
Length = 658
Score = 60.0 bits (30), Expect = 3e-007
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 497 acgggcttcaggaagaactcctccgcgccatcctgcaagcacctgctgatccgggcaggc 556
||||||||||| | ||| ||||| || || |||| || ||||||| |||||| | ||||
Sbjct: 300 acgggcttcagcaggaaatcctcggctccctcctccaggcacctgttgatccttgtaggc 359
Query: 557 acgttctcagacgacatgatcaccac 582
|||||||| || ||||||||||||||
Sbjct: 360 acgttctctgaggacatgatcaccac 385
>gb|CD934605.1|CD934605 OV.001H18F000912 OV Triticum aestivum cDNA clone OV001H18, mRNA
sequence
Length = 658
Score = 60.0 bits (30), Expect = 3e-007
Identities = 96/117 (82%), Gaps = 1/117 (0%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccaccgga-atgtccgtgagcgatgaggacccctt 612
||||||||||| |||||||||||||||| ||| || ||| |||| || ||| ||||
Sbjct: 514 ggcacgttctccgacgacatgatcaccancggggatctcccggagctccgacgactcctt 455
Query: 613 cactcgcgtgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||| | ||||| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 454 gacccgcttcagcagctcgtacccggtcatgccgggcatccagtagtcggtgatgat 398
>gb|BF484005.1|BF484005 WHE2305_B06_C11ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2305_B06_C11, mRNA sequence
Length = 474
Score = 56.0 bits (28), Expect = 5e-006
Identities = 85/104 (81%)
Strand = Plus / Minus
Query: 566 gacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttcactcgcgtgagc 625
||||||||||||||||| || || ||| |||| || ||| |||| || ||| | |||
Sbjct: 473 gacgacatgatcaccacggggatctcccggagctccgacgactccttgacccgcttcagc 414
Query: 626 agatcgtatcctgtcatgccgggcatgcagtagtcagtgatgat 669
|| ||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 413 agctcgtacccggtcatgccgggcatccagtagtcggtgatgat 370
>gb|BJ255084.1|BJ255084 BJ255084 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf8c18 3', mRNA sequence
Length = 566
Score = 56.0 bits (28), Expect = 5e-006
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatg 670
||||||||||||| |||||||| || |||||||| || || |||||||||
Sbjct: 517 tgagcagatcgtaccctgtcatcccaggcatgcantantcggtgatgatg 566
>gb|CA723468.1|CA723468 wdr1f.pk003.i19 wdr1f Triticum aestivum cDNA clone wdr1f.pk003.i19
5' end, mRNA sequence
Length = 318
Score = 54.0 bits (27), Expect = 2e-005
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 828 tcttgagcagcatctcgatgagcttcctgtcgatgatgctgtcgtccaccgccaggacat 887
||||||| ||| || | ||||||||||| |||| || |||||| ||||| |||| |||||
Sbjct: 212 tcttgaggagcctcncaatgagcttcctntcgaggacgctgtcatccacggccaagacat 153
Query: 888 ggaac 892
|||||
Sbjct: 152 ggaac 148
>gb|BQ170776.1|BQ170776 WHE2305_B06_C11ZT Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE2305_B06_C11, mRNA sequence
Length = 392
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 554 ggcacgttctcagacgacatgatcaccac 582
||||||||||| |||||||||||||||||
Sbjct: 361 ggcacgttctccgacgacatgatcaccac 389
>gb|CA622740.1|CA622740 wl1n.pk0097.d2 wl1n Triticum aestivum cDNA clone wl1n.pk0097.d2 5'
end, mRNA sequence
Length = 486
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccac 582
||||||||||| |||||||||||||||||
Sbjct: 47 ggcacgttctccgacgacatgatcaccac 19
>gb|CA652600.1|CA652600 wre1n.pk167.c7 wre1n Triticum aestivum cDNA clone wre1n.pk167.c7 5'
end, mRNA sequence
Length = 418
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 554 ggcacgttctcagacgacatgatcaccac 582
||||||||||| |||||||||||||||||
Sbjct: 40 ggcacgttctccgacgacatgatcaccac 12
>gb|U76383.1|U76383 TAU76383 Triticum aestivum (G.Segal) Triticum aestivum cDNA clone
WPG1, mRNA sequence
Length = 649
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 702 aggacgacgacgaagatgaggaggaggatga 732
||||||||||||| || ||||||||||||||
Sbjct: 261 aggacgacgacgacgaggaggaggaggatga 231
>gb|BE500139.1|BE500139 WHE0978_B12_D24ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE0978_B12_D24, mRNA sequence
Length = 386
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 702 aggacgacgacgaagatgaggaggaggatga 732
||||||||||||| || ||||||||||||||
Sbjct: 246 aggacgacgacgacgaggaggaggaggatga 216
>gb|BJ256225.1|BJ256225 BJ256225 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh4h10 5', mRNA sequence
Length = 685
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 704 gacgacgacgaagatgaggaggaggatgacg 734
||||||||||| ||||| |||||||||||||
Sbjct: 342 gacgacgacgacgatgacgaggaggatgacg 372
>gb|BJ261762.1|BJ261762 BJ261762 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh4h10 3', mRNA sequence
Length = 733
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 704 gacgacgacgaagatgaggaggaggatgacg 734
||||||||||| ||||| |||||||||||||
Sbjct: 563 gacgacgacgacgatgacgaggaggatgacg 533
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 390,829
Number of Sequences: 636343
Number of extensions: 390829
Number of successful extensions: 109332
Number of sequences better than 0.5: 139
Number of HSP's better than 0.5 without gapping: 138
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 108959
Number of HSP's gapped (non-prelim): 329
length of query: 991
length of database: 367,240,239
effective HSP length: 20
effective length of query: 971
effective length of database: 354,513,379
effective search space: 344232491009
effective search space used: 344232491009
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)