BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2161284.2.6
(621 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA484366.1|CA484366 WHE4305_F06_K11ZS Wheat meiotic anth... 589 e-167
gb|CA485563.1|CA485563 WHE4320_C10_F20ZS Wheat meiotic anth... 581 e-164
gb|CD491027.1|CD491027 WHE3070_G05_N10ZT CS wheat cold-stre... 581 e-164
gb|CA485270.1|CA485270 WHE4316_F04_L08ZS Wheat meiotic anth... 240 9e-062
gb|CA685445.1|CA685445 wlm96.pk029.d7 wlm96 Triticum aestiv... 208 3e-052
gb|CD867860.1|CD867860 AZO2.107F22F001113 AZO2 Triticum aes... 208 3e-052
gb|CD871701.1|CD871701 AZO2.118N16F010207 AZO2 Triticum aes... 208 3e-052
gb|CD913407.1|CD913407 G550.117M03R010920 G550 Triticum aes... 208 3e-052
gb|CD915950.1|CD915950 G550.128K12F010717 G550 Triticum aes... 208 3e-052
gb|CD936182.1|CD936182 OV.103P11F010205 OV Triticum aestivu... 208 3e-052
gb|CD936379.1|CD936379 OV.104K10F010202 OV Triticum aestivu... 208 3e-052
gb|CK164785.1|CK164785 FGAS048705 Triticum aestivum FGAS: T... 208 3e-052
gb|CK165179.1|CK165179 FGAS049122 Triticum aestivum FGAS: T... 208 3e-052
gb|CK166433.1|CK166433 FGAS050563 Triticum aestivum FGAS: T... 208 3e-052
gb|CK166856.1|CK166856 FGAS051089 Triticum aestivum FGAS: T... 208 3e-052
gb|CK167379.1|CK167379 FGAS051719 Triticum aestivum FGAS: T... 208 3e-052
gb|CK167665.1|CK167665 FGAS052074 Triticum aestivum FGAS: T... 208 3e-052
gb|CK167677.1|CK167677 FGAS052087 Triticum aestivum FGAS: T... 208 3e-052
gb|CK167943.1|CK167943 FGAS052406 Triticum aestivum FGAS: T... 208 3e-052
gb|CK217444.1|CK217444 FGAS029446 Triticum aestivum FGAS: L... 208 3e-052
gb|CK217555.1|CK217555 FGAS029557 Triticum aestivum FGAS: L... 208 3e-052
gb|CV774841.1|CV774841 FGAS069241 Triticum aestivum FGAS: L... 208 3e-052
gb|CK164537.1|CK164537 FGAS048450 Triticum aestivum FGAS: T... 204 5e-051
gb|CK165828.1|CK165828 FGAS049833 Triticum aestivum FGAS: T... 204 5e-051
gb|CK167366.1|CK167366 FGAS051705 Triticum aestivum FGAS: T... 204 5e-051
gb|CD913406.1|CD913406 G550.117M03F010525 G550 Triticum aes... 200 8e-050
gb|CK168143.1|CK168143 FGAS052638 Triticum aestivum FGAS: T... 200 8e-050
gb|BE216975.1|BE216975 EST0518 Triticum aestivum Lambda Zap... 192 2e-047
gb|BE402221.1|BE402221 CSB005F11F990908 ITEC CSB Wheat Endo... 192 2e-047
gb|BE445879.1|BE445879 WHE1147_H10_P19ZS Wheat etiolated se... 192 2e-047
gb|BQ483050.1|BQ483050 WHE0425_F10_K19ZY Wheat etiolated se... 192 2e-047
gb|BQ607840.1|BQ607840 BRY_3738 wheat EST endosperm library... 192 2e-047
gb|AL829364.1|AL829364 AL829364 q:141 Triticum aestivum cDN... 192 2e-047
gb|BJ210099.1|BJ210099 BJ210099 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ213472.1|BJ213472 BJ213472 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ214472.1|BJ214472 BJ214472 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ215977.1|BJ215977 BJ215977 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ220972.1|BJ220972 BJ220972 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ223799.1|BJ223799 BJ223799 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ227108.1|BJ227108 BJ227108 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ228536.1|BJ228536 BJ228536 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ237688.1|BJ237688 BJ237688 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ251852.1|BJ251852 BJ251852 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ256468.1|BJ256468 BJ256468 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ261985.1|BJ261985 BJ261985 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ271686.1|BJ271686 BJ271686 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ276903.1|BJ276903 BJ276903 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ281913.1|BJ281913 BJ281913 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ281923.1|BJ281923 BJ281923 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ282198.1|BJ282198 BJ282198 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ287029.1|BJ287029 BJ287029 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ287308.1|BJ287308 BJ287308 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ300631.1|BJ300631 BJ300631 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ303320.1|BJ303320 BJ303320 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ306454.1|BJ306454 BJ306454 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ309188.1|BJ309188 BJ309188 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ310572.1|BJ310572 BJ310572 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ314992.1|BJ314992 BJ314992 Y. Ogihara unpublished cDNA... 192 2e-047
gb|BJ320471.1|BJ320471 BJ320471 Y. Ogihara unpublished cDNA... 192 2e-047
gb|CA500084.1|CA500084 WHE4015_B11_D21ZT Wheat meiotic anth... 192 2e-047
gb|CA599684.1|CA599684 waw1c.pk003.n10 waw1c Triticum aesti... 192 2e-047
gb|CA696189.1|CA696189 wlmk8.pk0021.h10 wlmk8 Triticum aest... 192 2e-047
gb|CA698889.1|CA698889 wlk8.pk0009.h5 wlk8 Triticum aestivu... 192 2e-047
gb|CA710866.1|CA710866 wdk2c.pk014.m8 wdk2c Triticum aestiv... 192 2e-047
gb|CD863672.1|CD863672 AZO1.107I18F010131 AZO1 Triticum aes... 192 2e-047
gb|CD870811.1|CD870811 AZO2.115J20F001117 AZO2 Triticum aes... 192 2e-047
gb|CD887417.1|CD887417 G118.105C09F010605 G118 Triticum aes... 192 2e-047
gb|CD890837.1|CD890837 G118.115I22F010718 G118 Triticum aes... 192 2e-047
gb|CD893544.1|CD893544 G118.123O20F010829 G118 Triticum aes... 192 2e-047
gb|CD894769.1|CD894769 G118.127B13F010824 G118 Triticum aes... 192 2e-047
gb|CD899214.1|CD899214 G174.111I24F010827 G174 Triticum aes... 192 2e-047
gb|CD907086.1|CD907086 G468.105O24F011012 G468 Triticum aes... 192 2e-047
gb|CD928039.1|CD928039 GR45.103N07F010315 GR45 Triticum aes... 192 2e-047
gb|CD929123.1|CD929123 GR45.107B09F010320 GR45 Triticum aes... 192 2e-047
gb|CD929266.1|CD929266 GR45.107J09F010320 GR45 Triticum aes... 192 2e-047
gb|CD931454.1|CD931454 GR45.114I18F010419 GR45 Triticum aes... 192 2e-047
gb|CD932611.1|CD932611 GR45.118I12F010718 GR45 Triticum aes... 192 2e-047
gb|CD937262.1|CD937262 OV.106H07F010202 OV Triticum aestivu... 192 2e-047
gb|CB307125.1|CB307125 HFIG110 Hessian fly infested cDNA li... 192 2e-047
gb|CK153555.1|CK153555 FGAS032186 Triticum aestivum FGAS: T... 192 2e-047
gb|CK210543.1|CK210543 FGAS022364 Triticum aestivum FGAS: L... 192 2e-047
gb|CK211334.1|CK211334 FGAS023172 Triticum aestivum FGAS: L... 192 2e-047
gb|CK211730.1|CK211730 FGAS023584 Triticum aestivum FGAS: L... 192 2e-047
gb|AJ615201.1|AJ615201 AJ615201 Triticum turgidum subsp. du... 192 2e-047
gb|AL812648.1|AL812648 AL812648 e:310 Triticum aestivum cDN... 192 2e-047
gb|CV064766.1|CV064766 WNEL14h6 Wheat EST endosperm library... 192 2e-047
gb|CA598104.1|CA598104 wyr1c.pk003.d21 wyr1c Triticum aesti... 188 3e-046
gb|CA605416.1|CA605416 wr1.pk0053.e10 wr1 Triticum aestivum... 188 3e-046
gb|CA613530.1|CA613530 wr1.pk0152.h5 wr1 Triticum aestivum ... 188 3e-046
gb|CA670360.1|CA670360 wlsu1.pk026.a5 wlsu1 Triticum aestiv... 188 3e-046
gb|CA676868.1|CA676868 wlm12.pk0007.g7 wlm12 Triticum aesti... 188 3e-046
gb|CA679532.1|CA679532 wlm4.pk0015.e12 wlm4 Triticum aestiv... 188 3e-046
gb|BJ215978.1|BJ215978 BJ215978 Y. Ogihara unpublished cDNA... 186 1e-045
gb|CA643473.1|CA643473 wre1n.pk0065.e11 wre1n Triticum aest... 186 1e-045
gb|BQ801046.1|BQ801046 WHE2809_F12_K23ZS Triticum monococcu... 184 5e-045
gb|BQ803623.1|BQ803623 WHE2839_G06_N11ZS Triticum monococcu... 184 5e-045
gb|BJ245940.1|BJ245940 BJ245940 Y. Ogihara unpublished cDNA... 184 5e-045
gb|CA601656.1|CA601656 wr1.pk0002.g8 wr1 Triticum aestivum ... 184 5e-045
gb|CA705736.1|CA705736 wdk1c.pk021.k21 wdk1c Triticum aesti... 184 5e-045
gb|CD929124.1|CD929124 GR45.107B09R010612 GR45 Triticum aes... 184 5e-045
gb|CK164115.1|CK164115 FGAS048011 Triticum aestivum FGAS: T... 184 5e-045
gb|BJ213658.1|BJ213658 BJ213658 Y. Ogihara unpublished cDNA... 182 2e-044
gb|BJ221162.1|BJ221162 BJ221162 Y. Ogihara unpublished cDNA... 182 2e-044
gb|CA667045.1|CA667045 wlsu1.pk0010.b2 wlsu1 Triticum aesti... 182 2e-044
gb|AL820941.1|AL820941 AL820941 O:232 Triticum aestivum cDN... 180 8e-044
gb|BJ210100.1|BJ210100 BJ210100 Y. Ogihara unpublished cDNA... 180 8e-044
gb|BJ222145.1|BJ222145 BJ222145 Y. Ogihara unpublished cDNA... 180 8e-044
gb|CA658244.1|CA658244 wlm0.pk041.a7 wlm0 Triticum aestivum... 180 8e-044
gb|CD907085.1|CD907085 G468.105O24F010810 G468 Triticum aes... 180 8e-044
gb|CA656074.1|CA656074 wlm0.pk0020.f10 wlm0 Triticum aestiv... 178 3e-043
gb|CA703247.1|CA703247 wdk1c.pk009.j15 wdk1c Triticum aesti... 178 3e-043
gb|CA708104.1|CA708104 wdk2c.pk008.k8 wdk2c Triticum aestiv... 178 3e-043
gb|CV764598.1|CV764598 FGAS058983 Triticum aestivum FGAS: L... 178 3e-043
gb|CV781442.1|CV781442 FGAS075854 Triticum aestivum FGAS: L... 178 3e-043
gb|BJ207193.1|BJ207193 BJ207193 Y. Ogihara unpublished cDNA... 176 1e-042
gb|BE352609.1|BE352609 WHE0425_F10_K19ZS Wheat etiolated se... 174 5e-042
gb|BJ268283.1|BJ268283 BJ268283 Y. Ogihara unpublished cDNA... 174 5e-042
gb|CV781721.1|CV781721 FGAS076133 Triticum aestivum FGAS: L... 174 5e-042
gb|CA655909.1|CA655909 wlm0.pk0019.f6 wlm0 Triticum aestivu... 172 2e-041
gb|CA704427.1|CA704427 wdk1c.pk012.i6 wdk1c Triticum aestiv... 170 7e-041
gb|CK195963.1|CK195963 FGAS004409 Triticum aestivum FGAS: L... 168 3e-040
gb|CA667602.1|CA667602 wlsu1.pk017.i21 wlsu1 Triticum aesti... 167 1e-039
gb|CA712257.1|CA712257 wdk3c.pk005.m4 wdk3c Triticum aestiv... 165 4e-039
gb|AL809766.1|AL809766 AL809766 a:11 Triticum aestivum cDNA... 165 4e-039
gb|CV973386.1|CV973386 C03_q444_12 q:444 Triticum aestivum ... 165 4e-039
gb|CA599028.1|CA599028 wyr1c.pk004.p8 wyr1c Triticum aestiv... 161 7e-038
gb|CK213605.1|CK213605 FGAS025514 Triticum aestivum FGAS: L... 161 7e-038
gb|CA717215.1|CA717215 wdk4c.pk005.j12 wdk4c Triticum aesti... 159 3e-037
gb|CA649989.1|CA649989 wre1n.pk0147.e3 wre1n Triticum aesti... 157 1e-036
gb|CD861770.1|CD861770 AZO1.003L12F010109 AZO1 Triticum aes... 155 4e-036
gb|CA680349.1|CA680349 wlm24.pk0005.b1 wlm24 Triticum aesti... 151 7e-035
gb|CA724648.1|CA724648 wds3f.pk001.i13 wds3f Triticum aesti... 149 3e-034
gb|CN010920.1|CN010920 WHE3877_G04_N07ZS Wheat Fusarium gra... 145 4e-033
gb|CA742484.1|CA742484 wri1s.pk001.a16 wri1s Triticum aesti... 143 2e-032
gb|CA745372.1|CA745372 wri2s.pk001.c15 wri2s Triticum aesti... 143 2e-032
gb|CA746083.1|CA746083 wri2s.pk003.i22 wri2s Triticum aesti... 143 2e-032
gb|CA668408.1|CA668408 wlsu1.pk019.d19 wlsu1 Triticum aesti... 141 6e-032
gb|CA690713.1|CA690713 wlm96.pk052.h5 wlm96 Triticum aestiv... 137 1e-030
gb|AL809758.1|AL809758 AL809758 a:11 Triticum aestivum cDNA... 137 1e-030
gb|BJ241311.1|BJ241311 BJ241311 Y. Ogihara unpublished cDNA... 131 6e-029
gb|CA736104.1|CA736104 wpi1s.pk006.e12 wpi1s Triticum aesti... 131 6e-029
gb|DR733283.1|DR733283 FGAS079043 Triticum aestivum FGAS: L... 127 1e-027
gb|BE517457.1|BE517457 WHE0626_A10_A20ZA Wheat ABA-treated ... 117 9e-025
gb|BJ236011.1|BJ236011 BJ236011 Y. Ogihara unpublished cDNA... 117 9e-025
gb|BJ243662.1|BJ243662 BJ243662 Y. Ogihara unpublished cDNA... 117 9e-025
gb|BJ270740.1|BJ270740 BJ270740 Y. Ogihara unpublished cDNA... 111 6e-023
gb|CA605654.1|CA605654 wr1.pk0056.d3 wr1 Triticum aestivum ... 111 6e-023
gb|CA665550.1|CA665550 wlk1.pk0019.a6 wlk1 Triticum aestivu... 111 6e-023
gb|CA670654.1|CA670654 wlsu1.pk027.g12 wlsu1 Triticum aesti... 111 6e-023
gb|CK198277.1|CK198277 FGAS006761 Triticum aestivum FGAS: L... 111 6e-023
gb|CA604675.1|CA604675 wr1.pk0043.d1 wr1 Triticum aestivum ... 109 2e-022
gb|CA668881.1|CA668881 wlsu1.pk020.n15 wlsu1 Triticum aesti... 109 2e-022
gb|CA669441.1|CA669441 wlsu1.pk022.l11 wlsu1 Triticum aesti... 101 6e-020
gb|CD931060.1|CD931060 GR45.113F13F010418 GR45 Triticum aes... 101 6e-020
gb|CV522334.1|CV522334 RH-146 Triticum aestivum subtracted,... 101 6e-020
gb|CV522466.1|CV522466 RH-955 Triticum aestivum subtracted,... 101 6e-020
gb|BJ246508.1|BJ246508 BJ246508 Y. Ogihara unpublished cDNA... 94 1e-017
gb|CA693989.1|CA693989 wlmk4.pk0011.a3 wlmk4 Triticum aesti... 94 1e-017
gb|CV522314.1|CV522314 RH-064 Triticum aestivum subtracted,... 94 1e-017
gb|CV973460.1|CV973460 B08_q444_14 q:444 Triticum aestivum ... 92 5e-017
gb|CA609784.1|CA609784 wr1.pk0112.e1 wr1 Triticum aestivum ... 90 2e-016
gb|CA611760.1|CA611760 wr1.pk0134.d7 wr1 Triticum aestivum ... 82 5e-014
gb|CK195643.1|CK195643 FGAS004085 Triticum aestivum FGAS: L... 80 2e-013
gb|BJ287288.1|BJ287288 BJ287288 Y. Ogihara unpublished cDNA... 74 1e-011
gb|BE492925.1|BE492925 WHE0566_H01_H01ZE Triticum monococcu... 72 5e-011
gb|CA669819.1|CA669819 wlsu1.pk018.b7 wlsu1 Triticum aestiv... 70 2e-010
gb|CA670675.1|CA670675 wlsu1.pk027.d17 wlsu1 Triticum aesti... 66 3e-009
gb|CV973417.1|CV973417 H11_q444_12 q:444 Triticum aestivum ... 64 1e-008
gb|CA743615.1|CA743615 wri1s.pk003.d15 wri1s Triticum aesti... 60 2e-007
gb|CA483751.1|CA483751 14 A. Wheat subtracted library enric... 54 1e-005
gb|CA736102.1|CA736102 wpi1s.pk006.d5 wpi1s Triticum aestiv... 54 1e-005
gb|CA744799.1|CA744799 wri1s.pk009.e2 wri1s Triticum aestiv... 54 1e-005
gb|CA744862.1|CA744862 wri1s.pk009.f1 wri1s Triticum aestiv... 54 1e-005
gb|CA746116.1|CA746116 wri2s.pk005.a19 wri2s Triticum aesti... 54 1e-005
gb|CA746206.1|CA746206 wri2s.pk005.b11 wri2s Triticum aesti... 54 1e-005
gb|CA746263.1|CA746263 wri2s.pk005.a12 wri2s Triticum aesti... 54 1e-005
gb|CA746453.1|CA746453 wri2s.pk007.a6 wri2s Triticum aestiv... 54 1e-005
gb|CA746630.1|CA746630 wri2s.pk004.i8 wri2s Triticum aestiv... 54 1e-005
gb|CA747072.1|CA747072 wri2s.pk007.b5 wri2s Triticum aestiv... 54 1e-005
gb|CA605008.1|CA605008 wr1.pk0050.f8 wr1 Triticum aestivum ... 52 5e-005
gb|CA735635.1|CA735635 wpi1s.pk004.c15 wpi1s Triticum aesti... 52 5e-005
gb|CA735841.1|CA735841 wpi1s.pk005.h10 wpi1s Triticum aesti... 52 5e-005
gb|CA736085.1|CA736085 wpi1s.pk006.b21 wpi1s Triticum aesti... 52 5e-005
gb|CA736175.1|CA736175 wpi1s.pk006.d23 wpi1s Triticum aesti... 52 5e-005
gb|CA736233.1|CA736233 wpi1s.pk006.l24 wpi1s Triticum aesti... 52 5e-005
gb|CA736662.1|CA736662 wpi1s.pk008.i9 wpi1s Triticum aestiv... 52 5e-005
gb|CA736868.1|CA736868 wpi1s.pk009.g22 wpi1s Triticum aesti... 52 5e-005
gb|CA737503.1|CA737503 wpi2s.pk004.i7 wpi2s Triticum aestiv... 52 5e-005
gb|CA737764.1|CA737764 wpi2s.pk004.f8 wpi2s Triticum aestiv... 52 5e-005
gb|CA738611.1|CA738611 wpi2s.pk006.p8 wpi2s Triticum aestiv... 52 5e-005
gb|CA739636.1|CA739636 wpi2s.pk010.m21 wpi2s Triticum aesti... 52 5e-005
gb|CA739818.1|CA739818 wpi2s.pk010.n14 wpi2s Triticum aesti... 52 5e-005
gb|CA739821.1|CA739821 wpi2s.pk010.p3 wpi2s Triticum aestiv... 52 5e-005
gb|CA742420.1|CA742420 wri1s.pk001.i17 wri1s Triticum aesti... 52 5e-005
gb|CA742822.1|CA742822 wri1s.pk004.d7 wri1s Triticum aestiv... 52 5e-005
gb|CA742883.1|CA742883 wri1s.pk004.k23 wri1s Triticum aesti... 52 5e-005
gb|CA745336.1|CA745336 wri2s.pk001.e21 wri2s Triticum aesti... 52 5e-005
gb|CA746073.1|CA746073 wri2s.pk003.g18 wri2s Triticum aesti... 52 5e-005
gb|CA746115.1|CA746115 wri2s.pk005.o1 wri2s Triticum aestiv... 52 5e-005
gb|CA746798.1|CA746798 wri2s.pk006.e16 wri2s Triticum aesti... 52 5e-005
gb|CA747170.1|CA747170 wri2s.pk008.e9.f wri2s Triticum aest... 52 5e-005
gb|CA673373.1|CA673373 wlsu2.pk022.a19 wlsu2 Triticum aesti... 50 2e-004
gb|CA725791.1|CA725791 wet1s.pk001.i21 wet1s Triticum aesti... 50 2e-004
gb|CA725806.1|CA725806 wet1s.pk001.d17 wet1s Triticum aesti... 50 2e-004
gb|CA725859.1|CA725859 wet1s.pk001.g1 wet1s Triticum aestiv... 50 2e-004
gb|CA725864.1|CA725864 wet1s.pk001.j5 wet1s Triticum aestiv... 50 2e-004
gb|CA725979.1|CA725979 wet1s.pk001.h3 wet1s Triticum aestiv... 50 2e-004
gb|CA726076.1|CA726076 wet1s.pk002.k23 wet1s Triticum aesti... 50 2e-004
gb|CA726165.1|CA726165 wet1s.pk002.f15 wet1s Triticum aesti... 50 2e-004
gb|CA726369.1|CA726369 wet1s.pk003.o14 wet1s Triticum aesti... 50 2e-004
gb|CA726392.1|CA726392 wet1s.pk003.f17 wet1s Triticum aesti... 50 2e-004
gb|CA726494.1|CA726494 wet1s.pk003.d10 wet1s Triticum aesti... 50 2e-004
gb|CA726600.1|CA726600 wet1s.pk003.g9 wet1s Triticum aestiv... 50 2e-004
gb|CA734831.1|CA734831 wpi1s.pk002.o17 wpi1s Triticum aesti... 50 2e-004
gb|CA734833.1|CA734833 wpi1s.pk002.k3 wpi1s Triticum aestiv... 50 2e-004
gb|CA735082.1|CA735082 wpi1s.pk003.f3 wpi1s Triticum aestiv... 50 2e-004
gb|CA735497.1|CA735497 wpi1s.pk004.c21 wpi1s Triticum aesti... 50 2e-004
gb|CA735561.1|CA735561 wpi1s.pk004.d24 wpi1s Triticum aesti... 50 2e-004
gb|CA735615.1|CA735615 wpi1s.pk004.d12 wpi1s Triticum aesti... 50 2e-004
gb|CA735952.1|CA735952 wpi1s.pk005.p8 wpi1s Triticum aestiv... 50 2e-004
gb|CA735966.1|CA735966 wpi1s.pk005.m2 wpi1s Triticum aestiv... 50 2e-004
gb|CA736238.1|CA736238 wpi1s.pk006.f22 wpi1s Triticum aesti... 50 2e-004
gb|CA736241.1|CA736241 wpi1s.pk006.f6 wpi1s Triticum aestiv... 50 2e-004
gb|CA736460.1|CA736460 wpi1s.pk007.m24 wpi1s Triticum aesti... 50 2e-004
gb|CA736496.1|CA736496 wpi1s.pk007.f16 wpi1s Triticum aesti... 50 2e-004
gb|CA736697.1|CA736697 wpi1s.pk008.g6 wpi1s Triticum aestiv... 50 2e-004
gb|CA736735.1|CA736735 wpi1s.pk008.o19 wpi1s Triticum aesti... 50 2e-004
gb|CA736893.1|CA736893 wpi1s.pk009.i22 wpi1s Triticum aesti... 50 2e-004
gb|CA736946.1|CA736946 wpi1s.pk009.e9 wpi1s Triticum aestiv... 50 2e-004
gb|CA736947.1|CA736947 wpi1s.pk009.m9 wpi1s Triticum aestiv... 50 2e-004
gb|CA737039.1|CA737039 wpi1s.pk009.p12 wpi1s Triticum aesti... 50 2e-004
gb|CA737044.1|CA737044 wpi1s.pk009.p2 wpi1s Triticum aestiv... 50 2e-004
gb|CA737079.1|CA737079 wpi1s.pk009.p7 wpi1s Triticum aestiv... 50 2e-004
gb|CA737110.1|CA737110 wpi1s.pk009.f20 wpi1s Triticum aesti... 50 2e-004
gb|CA737111.1|CA737111 wpi1s.pk009.f11 wpi1s Triticum aesti... 50 2e-004
gb|CA737605.1|CA737605 wpi2s.pk004.f22 wpi2s Triticum aesti... 50 2e-004
gb|CA737772.1|CA737772 wpi2s.pk004.l2 wpi2s Triticum aestiv... 50 2e-004
gb|CA737829.1|CA737829 wpi2s.pk005.i7 wpi2s Triticum aestiv... 50 2e-004
gb|CA737854.1|CA737854 wpi2s.pk005.e24 wpi2s Triticum aesti... 50 2e-004
gb|CA737895.1|CA737895 wpi2s.pk005.k13 wpi2s Triticum aesti... 50 2e-004
gb|CA738074.1|CA738074 wpi2s.pk002.p3 wpi2s Triticum aestiv... 50 2e-004
gb|CA738221.1|CA738221 wpi2s.pk006.o2 wpi2s Triticum aestiv... 50 2e-004
gb|CA738424.1|CA738424 wpi2s.pk006.p3 wpi2s Triticum aestiv... 50 2e-004
gb|CA738678.1|CA738678 wpi2s.pk002.m15 wpi2s Triticum aesti... 50 2e-004
gb|CA738834.1|CA738834 wpi2s.pk002.k2 wpi2s Triticum aestiv... 50 2e-004
gb|CA738857.1|CA738857 wpi2s.pk008.h1 wpi2s Triticum aestiv... 50 2e-004
gb|CA738959.1|CA738959 wpi2s.pk008.p20 wpi2s Triticum aesti... 50 2e-004
gb|CA739088.1|CA739088 wpi2s.pk009.l16 wpi2s Triticum aesti... 50 2e-004
gb|CA739620.1|CA739620 wpi2s.pk010.i5 wpi2s Triticum aestiv... 50 2e-004
gb|CA739640.1|CA739640 wpi2s.pk010.i23 wpi2s Triticum aesti... 50 2e-004
gb|CA739764.1|CA739764 wpi2s.pk010.c2 wpi2s Triticum aestiv... 50 2e-004
gb|CA742414.1|CA742414 wri1s.pk001.e7 wri1s Triticum aestiv... 50 2e-004
gb|CA742425.1|CA742425 wri1s.pk001.i3 wri1s Triticum aestiv... 50 2e-004
gb|CA742451.1|CA742451 wri1s.pk001.i9 wri1s Triticum aestiv... 50 2e-004
gb|CA742493.1|CA742493 wri1s.pk001.i16 wri1s Triticum aesti... 50 2e-004
gb|CA742525.1|CA742525 wri1s.pk001.k16 wri1s Triticum aesti... 50 2e-004
gb|CA742555.1|CA742555 wri1s.pk001.i6 wri1s Triticum aestiv... 50 2e-004
gb|CA742571.1|CA742571 wri1s.pk001.j10 wri1s Triticum aesti... 50 2e-004
gb|CA742703.1|CA742703 wri1s.pk001.f3 wri1s Triticum aestiv... 50 2e-004
gb|CA742710.1|CA742710 wri1s.pk001.d3 wri1s Triticum aestiv... 50 2e-004
gb|CA742717.1|CA742717 wri1s.pk001.l7 wri1s Triticum aestiv... 50 2e-004
gb|CA742792.1|CA742792 wri1s.pk004.b7 wri1s Triticum aestiv... 50 2e-004
gb|CA742826.1|CA742826 wri1s.pk004.c15 wri1s Triticum aesti... 50 2e-004
gb|CA742833.1|CA742833 wri1s.pk004.c9 wri1s Triticum aestiv... 50 2e-004
gb|CA742853.1|CA742853 wri1s.pk004.m9 wri1s Triticum aestiv... 50 2e-004
gb|CA742854.1|CA742854 wri1s.pk004.o3 wri1s Triticum aestiv... 50 2e-004
gb|CA742932.1|CA742932 wri1s.pk004.g12 wri1s Triticum aesti... 50 2e-004
gb|CA742949.1|CA742949 wri1s.pk004.k16 wri1s Triticum aesti... 50 2e-004
gb|CA743064.1|CA743064 wri1s.pk002.o17 wri1s Triticum aesti... 50 2e-004
gb|CA743087.1|CA743087 wri1s.pk002.l4 wri1s Triticum aestiv... 50 2e-004
gb|CA743097.1|CA743097 wri1s.pk002.i13 wri1s Triticum aesti... 50 2e-004
gb|CA743123.1|CA743123 wri1s.pk004.p2 wri1s Triticum aestiv... 50 2e-004
gb|CA743227.1|CA743227 wri1s.pk002.c4 wri1s Triticum aestiv... 50 2e-004
gb|CA743239.1|CA743239 wri1s.pk002.e10 wri1s Triticum aesti... 50 2e-004
gb|CA743348.1|CA743348 wri1s.pk005.m3 wri1s Triticum aestiv... 50 2e-004
gb|CA743439.1|CA743439 wri1s.pk003.g10 wri1s Triticum aesti... 50 2e-004
gb|CA743479.1|CA743479 wri1s.pk002.j7 wri1s Triticum aestiv... 50 2e-004
gb|CA743603.1|CA743603 wri1s.pk003.j11 wri1s Triticum aesti... 50 2e-004
gb|CA743613.1|CA743613 wri1s.pk003.f9 wri1s Triticum aestiv... 50 2e-004
gb|CA743711.1|CA743711 wri1s.pk005.j20 wri1s Triticum aesti... 50 2e-004
gb|CA743749.1|CA743749 wri1s.pk005.f10 wri1s Triticum aesti... 50 2e-004
gb|CA743769.1|CA743769 wri1s.pk005.l15 wri1s Triticum aesti... 50 2e-004
gb|CA743770.1|CA743770 wri1s.pk005.l17 wri1s Triticum aesti... 50 2e-004
gb|CA743792.1|CA743792 wri1s.pk005.p15 wri1s Triticum aesti... 50 2e-004
gb|CA743894.1|CA743894 wri1s.pk006.a16 wri1s Triticum aesti... 50 2e-004
gb|CA743914.1|CA743914 wri1s.pk006.e23 wri1s Triticum aesti... 50 2e-004
gb|CA744007.1|CA744007 wri1s.pk006.k20 wri1s Triticum aesti... 50 2e-004
gb|CA744016.1|CA744016 wri1s.pk006.a22 wri1s Triticum aesti... 50 2e-004
gb|CA744146.1|CA744146 wri1s.pk006.d18 wri1s Triticum aesti... 50 2e-004
gb|CA744412.1|CA744412 wri1s.pk007.p9 wri1s Triticum aestiv... 50 2e-004
gb|CA744430.1|CA744430 wri1s.pk007.f9 wri1s Triticum aestiv... 50 2e-004
gb|CA744459.1|CA744459 wri1s.pk007.d12 wri1s Triticum aesti... 50 2e-004
gb|CA744542.1|CA744542 wri1s.pk008.d3 wri1s Triticum aestiv... 50 2e-004
gb|CA744555.1|CA744555 wri1s.pk008.n21 wri1s Triticum aesti... 50 2e-004
gb|CA744591.1|CA744591 wri1s.pk008.p5 wri1s Triticum aestiv... 50 2e-004
gb|CA744827.1|CA744827 wri1s.pk009.b19 wri1s Triticum aesti... 50 2e-004
gb|CA744849.1|CA744849 wri1s.pk009.g16 wri1s Triticum aesti... 50 2e-004
gb|CA744936.1|CA744936 wri1s.pk009.n13 wri1s Triticum aesti... 50 2e-004
gb|CA745035.1|CA745035 wri1s.pk008.i7 wri1s Triticum aestiv... 50 2e-004
gb|CA745117.1|CA745117 wri1s.pk008.g8 wri1s Triticum aestiv... 50 2e-004
gb|CA745134.1|CA745134 wri1s.pk008.e4 wri1s Triticum aestiv... 50 2e-004
gb|CA745196.1|CA745196 wri1s.pk003.j4 wri1s Triticum aestiv... 50 2e-004
gb|CA745206.1|CA745206 wri1s.pk003.p2 wri1s Triticum aestiv... 50 2e-004
gb|CA745269.1|CA745269 wri1s.pk003.m11 wri1s Triticum aesti... 50 2e-004
gb|CA745271.1|CA745271 wri1s.pk003.m15 wri1s Triticum aesti... 50 2e-004
gb|CA745314.1|CA745314 wri1s.pk003.o13 wri1s Triticum aesti... 50 2e-004
gb|CA745351.1|CA745351 wri2s.pk001.e9 wri2s Triticum aestiv... 50 2e-004
gb|CA745470.1|CA745470 wri2s.pk001.f7 wri2s Triticum aestiv... 50 2e-004
gb|CA745504.1|CA745504 wri2s.pk001.n21 wri2s Triticum aesti... 50 2e-004
gb|CA745603.1|CA745603 wri2s.pk002.i14 wri2s Triticum aesti... 50 2e-004
gb|CA745728.1|CA745728 wri2s.pk002.k8 wri2s Triticum aestiv... 50 2e-004
gb|CA745772.1|CA745772 wri2s.pk002.p10 wri2s Triticum aesti... 50 2e-004
gb|CA745839.1|CA745839 wri2s.pk002.n24 wri2s Triticum aesti... 50 2e-004
gb|CA745889.1|CA745889 wri2s.pk003.j21 wri2s Triticum aesti... 50 2e-004
gb|CA746019.1|CA746019 wri2s.pk003.c5 wri2s Triticum aestiv... 50 2e-004
gb|CA746023.1|CA746023 wri2s.pk003.k5 wri2s Triticum aestiv... 50 2e-004
gb|CA746078.1|CA746078 wri2s.pk003.g8 wri2s Triticum aestiv... 50 2e-004
gb|CA746149.1|CA746149 wri2s.pk005.m11 wri2s Triticum aesti... 50 2e-004
gb|CA746159.1|CA746159 wri2s.pk005.o10 wri2s Triticum aesti... 50 2e-004
gb|CA746163.1|CA746163 wri2s.pk005.a5 wri2s Triticum aestiv... 50 2e-004
gb|CA746418.1|CA746418 wri2s.pk007.g17 wri2s Triticum aesti... 50 2e-004
gb|CA746463.1|CA746463 wri2s.pk007.m16 wri2s Triticum aesti... 50 2e-004
gb|CA746511.1|CA746511 wri2s.pk007.i10 wri2s Triticum aesti... 50 2e-004
gb|CA746581.1|CA746581 wri2s.pk004.m6 wri2s Triticum aestiv... 50 2e-004
gb|CA746618.1|CA746618 wri2s.pk004.e6 wri2s Triticum aestiv... 50 2e-004
gb|CA746822.1|CA746822 wri2s.pk006.i2 wri2s Triticum aestiv... 50 2e-004
gb|CA746880.1|CA746880 wri2s.pk006.c9 wri2s Triticum aestiv... 50 2e-004
gb|CA746884.1|CA746884 wri2s.pk006.a8 wri2s Triticum aestiv... 50 2e-004
gb|CA746905.1|CA746905 wri2s.pk006.h17 wri2s Triticum aesti... 50 2e-004
gb|CA746934.1|CA746934 wri2s.pk006.j1 wri2s Triticum aestiv... 50 2e-004
gb|CA746936.1|CA746936 wri2s.pk006.j2 wri2s Triticum aestiv... 50 2e-004
gb|CA746997.1|CA746997 wri2s.pk006.p7 wri2s Triticum aestiv... 50 2e-004
gb|CA747178.1|CA747178 wri2s.pk008.g21.f wri2s Triticum aes... 50 2e-004
gb|CA747332.1|CA747332 wri2s.pk008.f19.f wri2s Triticum aes... 50 2e-004
gb|CA747358.1|CA747358 wri2s.pk008.h12.f wri2s Triticum aes... 50 2e-004
gb|CA747371.1|CA747371 wri2s.pk008.f18.f wri2s Triticum aes... 50 2e-004
gb|AJ603002.1|AJ603002 AJ603002 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ603038.1|AJ603038 AJ603038 T06 Triticum aestivum cDNA ... 50 2e-004
gb|DV799680.1|DV799680 09A09 AAFC_CRC Fusarium graminearum ... 50 2e-004
gb|CA667151.1|CA667151 wlsu1.pk0013.a4 wlsu1 Triticum aesti... 48 7e-004
gb|CA675309.1|CA675309 wlsu2.pk026.j4 wlsu2 Triticum aestiv... 48 7e-004
gb|CA725700.1|CA725700 wet1s.pk001.o14 wet1s Triticum aesti... 48 7e-004
gb|CA725774.1|CA725774 wet1s.pk001.k21 wet1s Triticum aesti... 48 7e-004
gb|CA725810.1|CA725810 wet1s.pk001.o3 wet1s Triticum aestiv... 48 7e-004
gb|CA725881.1|CA725881 wet1s.pk001.i15 wet1s Triticum aesti... 48 7e-004
gb|CA725887.1|CA725887 wet1s.pk001.e13 wet1s Triticum aesti... 48 7e-004
gb|CA725956.1|CA725956 wet1s.pk001.l3 wet1s Triticum aestiv... 48 7e-004
gb|CA725975.1|CA725975 wet1s.pk001.h10 wet1s Triticum aesti... 48 7e-004
gb|CA725982.1|CA725982 wet1s.pk001.h22 wet1s Triticum aesti... 48 7e-004
gb|CA726013.1|CA726013 wet1s.pk002.k17 wet1s Triticum aesti... 48 7e-004
gb|CA726056.1|CA726056 wet1s.pk002.o23 wet1s Triticum aesti... 48 7e-004
gb|CA726122.1|CA726122 wet1s.pk002.c22 wet1s Triticum aesti... 48 7e-004
gb|CA726128.1|CA726128 wet1s.pk002.k2 wet1s Triticum aestiv... 48 7e-004
gb|CA726142.1|CA726142 wet1s.pk002.a8 wet1s Triticum aestiv... 48 7e-004
gb|CA726154.1|CA726154 wet1s.pk002.i6 wet1s Triticum aestiv... 48 7e-004
gb|CA726196.1|CA726196 wet1s.pk002.f23 wet1s Triticum aesti... 48 7e-004
gb|CA726206.1|CA726206 wet1s.pk002.n23 wet1s Triticum aesti... 48 7e-004
gb|CA726226.1|CA726226 wet1s.pk002.l19 wet1s Triticum aesti... 48 7e-004
gb|CA726227.1|CA726227 wet1s.pk002.l21 wet1s Triticum aesti... 48 7e-004
gb|CA726233.1|CA726233 wet1s.pk002.b20 wet1s Triticum aesti... 48 7e-004
gb|CA726273.1|CA726273 wet1s.pk003.a14 wet1s Triticum aesti... 48 7e-004
gb|CA726297.1|CA726297 wet1s.pk002.j24 wet1s Triticum aesti... 48 7e-004
gb|CA726307.1|CA726307 wet1s.pk002.l10 wet1s Triticum aesti... 48 7e-004
gb|CA726322.1|CA726322 wet1s.pk003.e6 wet1s Triticum aestiv... 48 7e-004
gb|CA726326.1|CA726326 wet1s.pk003.a4 wet1s Triticum aestiv... 48 7e-004
gb|CA726340.1|CA726340 wet1s.pk003.a20 wet1s Triticum aesti... 48 7e-004
gb|CA726414.1|CA726414 wet1s.pk003.n21 wet1s Triticum aesti... 48 7e-004
gb|CA726526.1|CA726526 wet1s.pk003.f14 wet1s Triticum aesti... 48 7e-004
gb|CA726533.1|CA726533 wet1s.pk003.c23 wet1s Triticum aesti... 48 7e-004
gb|CA726574.1|CA726574 wet1s.pk003.l14 wet1s Triticum aesti... 48 7e-004
gb|CA726583.1|CA726583 wet1s.pk003.n10 wet1s Triticum aesti... 48 7e-004
gb|CA726611.1|CA726611 wet1s.pk003.e13 wet1s Triticum aesti... 48 7e-004
gb|CA726615.1|CA726615 wet1s.pk003.c5 wet1s Triticum aestiv... 48 7e-004
gb|CA734777.1|CA734777 wpi1s.pk002.c5 wpi1s Triticum aestiv... 48 7e-004
gb|CA734793.1|CA734793 wpi1s.pk002.a9 wpi1s Triticum aestiv... 48 7e-004
gb|CA734822.1|CA734822 wpi1s.pk002.c9 wpi1s Triticum aestiv... 48 7e-004
gb|CA734825.1|CA734825 wpi1s.pk002.e5 wpi1s Triticum aestiv... 48 7e-004
gb|CA734838.1|CA734838 wpi1s.pk002.c1 wpi1s Triticum aestiv... 48 7e-004
gb|CA734868.1|CA734868 wpi1s.pk002.g22 wpi1s Triticum aesti... 48 7e-004
gb|CA734902.1|CA734902 wpi1s.pk002.e8 wpi1s Triticum aestiv... 48 7e-004
gb|CA734903.1|CA734903 wpi1s.pk002.o22 wpi1s Triticum aesti... 48 7e-004
gb|CA734911.1|CA734911 wpi1s.pk002.k14 wpi1s Triticum aesti... 48 7e-004
gb|CA734983.1|CA734983 wpi1s.pk002.p2 wpi1s Triticum aestiv... 48 7e-004
gb|CA735002.1|CA735002 wpi1s.pk003.i7 wpi1s Triticum aestiv... 48 7e-004
gb|CA735027.1|CA735027 wpi1s.pk003.e7 wpi1s Triticum aestiv... 48 7e-004
gb|CA735052.1|CA735052 wpi1s.pk003.d15 wpi1s Triticum aesti... 48 7e-004
gb|CA735137.1|CA735137 wpi1s.pk002.j6 wpi1s Triticum aestiv... 48 7e-004
gb|CA735141.1|CA735141 wpi1s.pk002.b6 wpi1s Triticum aestiv... 48 7e-004
gb|CA735155.1|CA735155 wpi1s.pk003.b24 wpi1s Triticum aesti... 48 7e-004
gb|CA735156.1|CA735156 wpi1s.pk003.b4 wpi1s Triticum aestiv... 48 7e-004
gb|CA735160.1|CA735160 wpi1s.pk004.e16 wpi1s Triticum aesti... 48 7e-004
gb|CA735165.1|CA735165 wpi1s.pk004.d23 wpi1s Triticum aesti... 48 7e-004
gb|CA735210.1|CA735210 wpi1s.pk003.n2 wpi1s Triticum aestiv... 48 7e-004
gb|CA735245.1|CA735245 wpi1s.pk004.a22 wpi1s Triticum aesti... 48 7e-004
gb|CA735271.1|CA735271 wpi1s.pk004.d11 wpi1s Triticum aesti... 48 7e-004
gb|CA735317.1|CA735317 wpi1s.pk004.i16 wpi1s Triticum aesti... 48 7e-004
gb|CA735329.1|CA735329 wpi1s.pk004.k22 wpi1s Triticum aesti... 48 7e-004
gb|CA735356.1|CA735356 wpi1s.pk004.h9 wpi1s Triticum aestiv... 48 7e-004
gb|CA735367.1|CA735367 wpi1s.pk002.h5 wpi1s Triticum aestiv... 48 7e-004
gb|CA735375.1|CA735375 wpi1s.pk002.l5 wpi1s Triticum aestiv... 48 7e-004
gb|CA735385.1|CA735385 wpi1s.pk003.i2 wpi1s Triticum aestiv... 48 7e-004
gb|CA735405.1|CA735405 wpi1s.pk004.e9 wpi1s Triticum aestiv... 48 7e-004
gb|CA735445.1|CA735445 wpi1s.pk003.m14 wpi1s Triticum aesti... 48 7e-004
gb|CA735471.1|CA735471 wpi1s.pk003.c12 wpi1s Triticum aesti... 48 7e-004
gb|CA735484.1|CA735484 wpi1s.pk004.g3 wpi1s Triticum aestiv... 48 7e-004
gb|CA735498.1|CA735498 wpi1s.pk004.i7 wpi1s Triticum aestiv... 48 7e-004
gb|CA735522.1|CA735522 wpi1s.pk002.d21 wpi1s Triticum aesti... 48 7e-004
gb|CA735528.1|CA735528 wpi1s.pk002.f11 wpi1s Triticum aesti... 48 7e-004
gb|CA735536.1|CA735536 wpi1s.pk002.j21 wpi1s Triticum aesti... 48 7e-004
gb|CA735568.1|CA735568 wpi1s.pk004.n22 wpi1s Triticum aesti... 48 7e-004
gb|CA735586.1|CA735586 wpi1s.pk004.j4 wpi1s Triticum aestiv... 48 7e-004
gb|CA735591.1|CA735591 wpi1s.pk004.j16 wpi1s Triticum aesti... 48 7e-004
gb|CA735592.1|CA735592 wpi1s.pk004.j18 wpi1s Triticum aesti... 48 7e-004
gb|CA735602.1|CA735602 wpi1s.pk005.i1 wpi1s Triticum aestiv... 48 7e-004
gb|CA735614.1|CA735614 wpi1s.pk004.d10 wpi1s Triticum aesti... 48 7e-004
gb|CA735623.1|CA735623 wpi1s.pk004.l10 wpi1s Triticum aesti... 48 7e-004
gb|CA735631.1|CA735631 wpi1s.pk004.f20 wpi1s Triticum aesti... 48 7e-004
gb|CA735638.1|CA735638 wpi1s.pk004.b8 wpi1s Triticum aestiv... 48 7e-004
gb|CA735641.1|CA735641 wpi1s.pk004.i17 wpi1s Triticum aesti... 48 7e-004
gb|CA735651.1|CA735651 wpi1s.pk005.c9 wpi1s Triticum aestiv... 48 7e-004
gb|CA735712.1|CA735712 wpi1s.pk004.l6 wpi1s Triticum aestiv... 48 7e-004
gb|CA735725.1|CA735725 wpi1s.pk005.m11 wpi1s Triticum aesti... 48 7e-004
gb|CA735780.1|CA735780 wpi1s.pk005.h19 wpi1s Triticum aesti... 48 7e-004
gb|CA735788.1|CA735788 wpi1s.pk005.h2 wpi1s Triticum aestiv... 48 7e-004
gb|CA735815.1|CA735815 wpi1s.pk005.d17 wpi1s Triticum aesti... 48 7e-004
gb|CA735827.1|CA735827 wpi1s.pk005.a12 wpi1s Triticum aesti... 48 7e-004
gb|CA735869.1|CA735869 wpi1s.pk005.l16 wpi1s Triticum aesti... 48 7e-004
gb|CA735891.1|CA735891 wpi1s.pk005.n17 wpi1s Triticum aesti... 48 7e-004
gb|CA735903.1|CA735903 wpi1s.pk005.e16 wpi1s Triticum aesti... 48 7e-004
gb|CA735918.1|CA735918 wpi1s.pk006.o23 wpi1s Triticum aesti... 48 7e-004
gb|CA735962.1|CA735962 wpi1s.pk006.a23 wpi1s Triticum aesti... 48 7e-004
gb|CA735975.1|CA735975 wpi1s.pk006.h13 wpi1s Triticum aesti... 48 7e-004
gb|CA735982.1|CA735982 wpi1s.pk006.o4 wpi1s Triticum aestiv... 48 7e-004
gb|CA735985.1|CA735985 wpi1s.pk006.o20 wpi1s Triticum aesti... 48 7e-004
gb|CA736000.1|CA736000 wpi1s.pk006.e24 wpi1s Triticum aesti... 48 7e-004
gb|CA736009.1|CA736009 wpi1s.pk006.c20 wpi1s Triticum aesti... 48 7e-004
gb|CA736045.1|CA736045 wpi1s.pk006.i20 wpi1s Triticum aesti... 48 7e-004
gb|CA736046.1|CA736046 wpi1s.pk006.i2 wpi1s Triticum aestiv... 48 7e-004
gb|CA736067.1|CA736067 wpi1s.pk006.l17 wpi1s Triticum aesti... 48 7e-004
gb|CA736083.1|CA736083 wpi1s.pk006.b17 wpi1s Triticum aesti... 48 7e-004
gb|CA736092.1|CA736092 wpi1s.pk006.g14 wpi1s Triticum aesti... 48 7e-004
gb|CA736121.1|CA736121 wpi1s.pk006.j7 wpi1s Triticum aestiv... 48 7e-004
gb|CA736133.1|CA736133 wpi1s.pk006.d1 wpi1s Triticum aestiv... 48 7e-004
gb|CA736134.1|CA736134 wpi1s.pk006.c6 wpi1s Triticum aestiv... 48 7e-004
gb|CA736147.1|CA736147 wpi1s.pk006.n1 wpi1s Triticum aestiv... 48 7e-004
gb|CA736166.1|CA736166 wpi1s.pk006.l10 wpi1s Triticum aesti... 48 7e-004
gb|CA736188.1|CA736188 wpi1s.pk006.p10 wpi1s Triticum aesti... 48 7e-004
gb|CA736193.1|CA736193 wpi1s.pk006.l12 wpi1s Triticum aesti... 48 7e-004
gb|CA736214.1|CA736214 wpi1s.pk006.b16 wpi1s Triticum aesti... 48 7e-004
gb|CA736245.1|CA736245 wpi1s.pk006.b7 wpi1s Triticum aestiv... 48 7e-004
gb|CA736266.1|CA736266 wpi1s.pk007.a15 wpi1s Triticum aesti... 48 7e-004
gb|CA736336.1|CA736336 wpi1s.pk007.o19 wpi1s Triticum aesti... 48 7e-004
gb|CA736338.1|CA736338 wpi1s.pk007.k1 wpi1s Triticum aestiv... 48 7e-004
gb|CA736342.1|CA736342 wpi1s.pk007.e13 wpi1s Triticum aesti... 48 7e-004
gb|CA736343.1|CA736343 wpi1s.pk007.e1 wpi1s Triticum aestiv... 48 7e-004
gb|CA736353.1|CA736353 wpi1s.pk006.f16 wpi1s Triticum aesti... 48 7e-004
gb|CA736358.1|CA736358 wpi1s.pk007.o1 wpi1s Triticum aestiv... 48 7e-004
gb|CA736371.1|CA736371 wpi1s.pk007.l12 wpi1s Triticum aesti... 48 7e-004
gb|CA736418.1|CA736418 wpi1s.pk007.n17 wpi1s Triticum aesti... 48 7e-004
gb|CA736470.1|CA736470 wpi1s.pk007.k2 wpi1s Triticum aestiv... 48 7e-004
gb|CA736477.1|CA736477 wpi1s.pk007.e18 wpi1s Triticum aesti... 48 7e-004
gb|CA736480.1|CA736480 wpi1s.pk007.i24 wpi1s Triticum aesti... 48 7e-004
gb|CA736518.1|CA736518 wpi1s.pk007.b3 wpi1s Triticum aestiv... 48 7e-004
gb|CA736527.1|CA736527 wpi1s.pk007.k12 wpi1s Triticum aesti... 48 7e-004
gb|CA736548.1|CA736548 wpi1s.pk007.l7 wpi1s Triticum aestiv... 48 7e-004
gb|CA736589.1|CA736589 wpi1s.pk008.a11 wpi1s Triticum aesti... 48 7e-004
gb|CA736603.1|CA736603 wpi1s.pk008.k4 wpi1s Triticum aestiv... 48 7e-004
gb|CA736640.1|CA736640 wpi1s.pk008.i17 wpi1s Triticum aesti... 48 7e-004
gb|CA736644.1|CA736644 wpi1s.pk008.m9 wpi1s Triticum aestiv... 48 7e-004
gb|CA736660.1|CA736660 wpi1s.pk008.j11 wpi1s Triticum aesti... 48 7e-004
gb|CA736668.1|CA736668 wpi1s.pk008.m5 wpi1s Triticum aestiv... 48 7e-004
gb|CA736685.1|CA736685 wpi1s.pk008.c12 wpi1s Triticum aesti... 48 7e-004
gb|CA736694.1|CA736694 wpi1s.pk008.h11 wpi1s Triticum aesti... 48 7e-004
gb|CA736695.1|CA736695 wpi1s.pk008.h13 wpi1s Triticum aesti... 48 7e-004
gb|CA736720.1|CA736720 wpi1s.pk008.k15 wpi1s Triticum aesti... 48 7e-004
gb|CA736728.1|CA736728 wpi1s.pk008.p1 wpi1s Triticum aestiv... 48 7e-004
gb|CA736757.1|CA736757 wpi1s.pk008.d19 wpi1s Triticum aesti... 48 7e-004
gb|CA736848.1|CA736848 wpi1s.pk009.a19 wpi1s Triticum aesti... 48 7e-004
gb|CA736849.1|CA736849 wpi1s.pk009.a20 wpi1s Triticum aesti... 48 7e-004
gb|CA736861.1|CA736861 wpi1s.pk009.c23 wpi1s Triticum aesti... 48 7e-004
gb|CA736871.1|CA736871 wpi1s.pk009.g3 wpi1s Triticum aestiv... 48 7e-004
gb|CA736904.1|CA736904 wpi1s.pk009.m21 wpi1s Triticum aesti... 48 7e-004
gb|CA736931.1|CA736931 wpi1s.pk008.n5 wpi1s Triticum aestiv... 48 7e-004
gb|CA736959.1|CA736959 wpi1s.pk009.o24 wpi1s Triticum aesti... 48 7e-004
gb|CA736960.1|CA736960 wpi1s.pk009.o4 wpi1s Triticum aestiv... 48 7e-004
gb|CA736969.1|CA736969 wpi1s.pk009.e2 wpi1s Triticum aestiv... 48 7e-004
gb|CA736980.1|CA736980 wpi1s.pk009.o10 wpi1s Triticum aesti... 48 7e-004
gb|CA736982.1|CA736982 wpi1s.pk009.o16 wpi1s Triticum aesti... 48 7e-004
gb|CA736999.1|CA736999 wpi1s.pk009.e16 wpi1s Triticum aesti... 48 7e-004
gb|CA737019.1|CA737019 wpi1s.pk009.h21 wpi1s Triticum aesti... 48 7e-004
gb|CA737057.1|CA737057 wpi1s.pk009.b6 wpi1s Triticum aestiv... 48 7e-004
gb|CA737071.1|CA737071 wpi1s.pk009.n17 wpi1s Triticum aesti... 48 7e-004
gb|CA737113.1|CA737113 wpi1s.pk009.f10 wpi1s Triticum aesti... 48 7e-004
gb|CA737486.1|CA737486 wpi2s.pk004.g19 wpi2s Triticum aesti... 48 7e-004
gb|CA737489.1|CA737489 wpi2s.pk004.g21 wpi2s Triticum aesti... 48 7e-004
gb|CA737518.1|CA737518 wpi2s.pk004.g1 wpi2s Triticum aestiv... 48 7e-004
gb|CA737536.1|CA737536 wpi2s.pk004.o13 wpi2s Triticum aesti... 48 7e-004
gb|CA737546.1|CA737546 wpi2s.pk004.o23 wpi2s Triticum aesti... 48 7e-004
gb|CA737557.1|CA737557 wpi2s.pk004.c23 wpi2s Triticum aesti... 48 7e-004
gb|CA737565.1|CA737565 wpi2s.pk004.a15 wpi2s Triticum aesti... 48 7e-004
>gb|CA484366.1|CA484366 WHE4305_F06_K11ZS Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4305_F06_K11, mRNA sequence
Length = 470
Score = 589 bits (297), Expect = e-167
Identities = 405/439 (92%), Gaps = 14/439 (3%)
Strand = Plus / Minus
Query: 85 gatgattgtatagctacaagcatcccatagaaaaagggatagacattccacctccgaagt 144
||||||| ||||| |||||| | |||||||||||||||||||||| | ||||||||
Sbjct: 470 gatgattacatagccacaagccccacatagaaaaagggatagacattgc---tccgaagt 414
Query: 145 tatgttgctgtgcaaaagcattagtcaaa-tacaacagggtccactgatatcttttacat 203
||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||
Sbjct: 413 tatgttgctgtgcaaaagcattagtcaaagtacaacagggttcactgatatcatttacat 354
Query: 204 cagttttcacgctgctagtgcta---------aagaacaatgattcactg-tgacctcgc 253
||||||||||||||||||||||| |||||||||||||||||| |||| | ||
Sbjct: 353 cagttttcacgctgctagtgctatatcagcggaagaacaatgattcactgctgacttggc 294
Query: 254 aactggctccagtgcctcgatcattacaacactgtttcccctgataaccaccattccaat 313
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 293 aactggctccagtgcctcgatcatgacaacactgtttcccctgataaccaccattccaat 234
Query: 314 atctgttttgtcatttccattgacctccacagtgttgtccaccaccagattcatgaactg 373
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 233 atctgtcttgtcatttccattgacctccacagtgttgtccaccaccagattcatgaactg 174
Query: 374 gtcgaacccacgaagtgtgccgataacaacacggtttgcattcatcttaatctgaagctt 433
|||||| || ||||||||||| |||||||||||||||||||||| |||||||||||||||
Sbjct: 173 gtcgaatccccgaagtgtgccaataacaacacggtttgcattcagcttaatctgaagctt 114
Query: 434 cttgtccatgtacttcttgagatccggaggctgccccgagcggctcatggtgacggctac 493
||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||
Sbjct: 113 cttgtccatgtacttcttgagatccggaggctgtcccgagcggctcatggcggcggctac 54
Query: 494 ctagcctcgaacgcgagag 512
|||||||||||||||||||
Sbjct: 53 ctagcctcgaacgcgagag 35
>gb|CA485563.1|CA485563 WHE4320_C10_F20ZS Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4320_C10_F20, mRNA sequence
Length = 722
Score = 581 bits (293), Expect = e-164
Identities = 405/441 (91%), Gaps = 16/441 (3%)
Strand = Plus / Minus
Query: 85 gatgattgtatagctacaagcatcccatagaaaaagggatagacattccacctccgaagt 144
||||||| ||||| ||||||| | |||||||||||||||||||||| | ||||||||
Sbjct: 473 gatgattacatagccacaagcaccacatagaaaaagggatagacattgc---tccgaagt 417
Query: 145 tatgttgctgtgcaaaagcattagtcaaa-tacaacagggtccactgatatcttttacat 203
||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||
Sbjct: 416 tatgttgctgtgcaaaagcattagtcaaagtacaacagggttcactgatatcatttacat 357
Query: 204 cagttttcacgctgctagtgcta---------aagaacaatgattcactgt---gacctc 251
||||||||||||||||||||||| |||||||||||||||||| ||| |
Sbjct: 356 cagttttcacgctgctagtgctatatcagcggaagaacaatgattcactgctgggacttg 297
Query: 252 gcaactggctccagtgcctcgatcattacaacactgtttcccctgataaccaccattcca 311
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 296 gcaactggctccagtgcctcgatcatgacaacactgtttcccctgataaccaccattcca 237
Query: 312 atatctgttttgtcatttccattgacctccacagtgttgtccaccaccagattcatgaac 371
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 236 atatctgtcttgtcatttccattgacctccacagtgttgtccaccaccagattcatgaac 177
Query: 372 tggtcgaacccacgaagtgtgccgataacaacacggtttgcattcatcttaatctgaagc 431
|||||||| || ||||||||||| |||||||||||||||||||||| |||||||||||||
Sbjct: 176 tggtcgaatccccgaagtgtgccaataacaacacggtttgcattcagcttaatctgaagc 117
Query: 432 ttcttgtccatgtacttcttgagatccggaggctgccccgagcggctcatggtgacggct 491
||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||
Sbjct: 116 ttcttgtccatgtacttcttgagatccggaggctgtcccgagcggctcatggcggcggct 57
Query: 492 acctagcctcgaacgcgagag 512
|||||||||||||||||||||
Sbjct: 56 acctagcctcgaacgcgagag 36
>gb|CD491027.1|CD491027 WHE3070_G05_N10ZT CS wheat cold-stressed seedling subtracted cDNA
library Triticum aestivum cDNA clone WHE3070_G05_N10,
mRNA sequence
Length = 579
Score = 581 bits (293), Expect = e-164
Identities = 405/441 (91%), Gaps = 16/441 (3%)
Strand = Plus / Plus
Query: 85 gatgattgtatagctacaagcatcccatagaaaaagggatagacattccacctccgaagt 144
||||||| ||||| ||||||| | |||||||||||||||||||||| | ||||||||
Sbjct: 93 gatgattacatagccacaagcaccacatagaaaaagggatagacattgc---tccgaagt 149
Query: 145 tatgttgctgtgcaaaagcattagtcaaa-tacaacagggtccactgatatcttttacat 203
||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||
Sbjct: 150 tatgttgctgtgcaaaagcattagtcaaagtacaacagggttcactgatatcatttacat 209
Query: 204 cagttttcacgctgctagtgcta---------aagaacaatgattcactgt---gacctc 251
||||||||||||||||||||||| |||||||||||||||||| ||| |
Sbjct: 210 cagttttcacgctgctagtgctatatcagcggaagaacaatgattcactgctgggacttg 269
Query: 252 gcaactggctccagtgcctcgatcattacaacactgtttcccctgataaccaccattcca 311
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 270 gcaactggctccagtgcctcgatcatgacaacactgtttcccctgataaccaccattcca 329
Query: 312 atatctgttttgtcatttccattgacctccacagtgttgtccaccaccagattcatgaac 371
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 atatctgtcttgtcatttccattgacctccacagtgttgtccaccaccagattcatgaac 389
Query: 372 tggtcgaacccacgaagtgtgccgataacaacacggtttgcattcatcttaatctgaagc 431
|||||||| || ||||||||||| |||||||||||||||||||||| |||||||||||||
Sbjct: 390 tggtcgaatccccgaagtgtgccaataacaacacggtttgcattcagcttaatctgaagc 449
Query: 432 ttcttgtccatgtacttcttgagatccggaggctgccccgagcggctcatggtgacggct 491
||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||
Sbjct: 450 ttcttgtccatgtacttcttgagatccggaggctgtcccgagcggctcatggcggcggct 509
Query: 492 acctagcctcgaacgcgagag 512
|||||||||||||||||||||
Sbjct: 510 acctagcctcgaacgcgagag 530
>gb|CA485270.1|CA485270 WHE4316_F04_L08ZS Wheat meiotic anther cDNA library Triticum
aestivum cDNA clone WHE4316_F04_L08, mRNA sequence
Length = 177
Score = 240 bits (121), Expect = 9e-062
Identities = 157/169 (92%)
Strand = Plus / Minus
Query: 344 agtgttgtccaccaccagattcatgaactggtcgaacccacgaagtgtgccgataacaac 403
||||||||||||||||||||||| | ||||| ||| || |||||||||| ||||||||
Sbjct: 177 agtgttgtccaccaccagattcacgccctggtggaatccgggaagtgtgccaataacaac 118
Query: 404 acggtttgcattcatcttaatctgaagcttcttgtccatgtacttcttgagatccggagg 463
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 117 acggtttgcattcagcttaatctgaagcttcttgtccatgtacttcttgagatccggagg 58
Query: 464 ctgccccgagcggctcatggtgacggctacctagcctcgaacgcgagag 512
||| |||||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 57 ctgtcccgagcggctcatggcggcggctacctagcctcgaacgcgagag 9
>gb|CA685445.1|CA685445 wlm96.pk029.d7 wlm96 Triticum aestivum cDNA clone wlm96.pk029.d7 5'
end, mRNA sequence
Length = 492
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 352 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 293
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 292 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 233
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 232 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 173
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 172 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 113
Query: 479 catgg 483
|||||
Sbjct: 112 catgg 108
>gb|CD867860.1|CD867860 AZO2.107F22F001113 AZO2 Triticum aestivum cDNA clone AZO2107F22,
mRNA sequence
Length = 637
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 392 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 333
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 332 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 273
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 272 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 213
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 212 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 153
Query: 479 catgg 483
|||||
Sbjct: 152 catgg 148
>gb|CD871701.1|CD871701 AZO2.118N16F010207 AZO2 Triticum aestivum cDNA clone AZO2118N16,
mRNA sequence
Length = 493
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 248 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 189
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 188 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 129
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 128 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 69
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 68 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 9
Query: 479 catgg 483
|||||
Sbjct: 8 catgg 4
>gb|CD913407.1|CD913407 G550.117M03R010920 G550 Triticum aestivum cDNA clone G550117M03,
mRNA sequence
Length = 581
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 248 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 307
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 308 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 367
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 368 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 427
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 428 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 487
Query: 479 catgg 483
|||||
Sbjct: 488 catgg 492
>gb|CD915950.1|CD915950 G550.128K12F010717 G550 Triticum aestivum cDNA clone G550128K12,
mRNA sequence
Length = 520
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 319 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 260
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 259 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 200
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 199 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 140
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 139 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 80
Query: 479 catgg 483
|||||
Sbjct: 79 catgg 75
>gb|CD936182.1|CD936182 OV.103P11F010205 OV Triticum aestivum cDNA clone OV103P11, mRNA
sequence
Length = 560
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 325 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 266
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 265 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 206
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 205 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 146
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 145 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 86
Query: 479 catgg 483
|||||
Sbjct: 85 catgg 81
>gb|CD936379.1|CD936379 OV.104K10F010202 OV Triticum aestivum cDNA clone OV104K10, mRNA
sequence
Length = 614
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 369 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 310
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 309 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 250
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 249 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 190
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 189 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 130
Query: 479 catgg 483
|||||
Sbjct: 129 catgg 125
>gb|CK164785.1|CK164785 FGAS048705 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 887
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 423 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 482
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 483 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 542
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 543 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 602
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 603 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 662
Query: 479 catgg 483
|||||
Sbjct: 663 catgg 667
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 142 acctcggccgcgaccacgcta 122
>gb|CK165179.1|CK165179 FGAS049122 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 891
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 425 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 484
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 485 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 544
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 545 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 604
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 605 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 664
Query: 479 catgg 483
|||||
Sbjct: 665 catgg 669
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 144 acctcggccgcgaccacgcta 124
>gb|CK166433.1|CK166433 FGAS050563 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1062
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 370 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 429
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 430 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 489
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 490 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 549
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 550 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 609
Query: 479 catgg 483
|||||
Sbjct: 610 catgg 614
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 734 acctcggccgcgaccacgcta 754
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 89 acctcggccgcgaccacgcta 69
>gb|CK166856.1|CK166856 FGAS051089 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1156
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 368 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 427
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 428 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 487
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 488 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 547
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 548 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 607
Query: 479 catgg 483
|||||
Sbjct: 608 catgg 612
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 87 acctcggccgcgaccacgcta 67
>gb|CK167379.1|CK167379 FGAS051719 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1106
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 370 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 429
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 430 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 489
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 490 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 549
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 550 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 609
Query: 479 catgg 483
|||||
Sbjct: 610 catgg 614
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 734 acctcggccgcgaccacgcta 754
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 89 acctcggccgcgaccacgcta 69
>gb|CK167665.1|CK167665 FGAS052074 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1224
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 361 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 420
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 421 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 480
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 481 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 540
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 541 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 600
Query: 479 catgg 483
|||||
Sbjct: 601 catgg 605
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 725 acctcggccgcgaccacgcta 745
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 80 acctcggccgcgaccacgcta 60
>gb|CK167677.1|CK167677 FGAS052087 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1245
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 361 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 420
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 421 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 480
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 481 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 540
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 541 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 600
Query: 479 catgg 483
|||||
Sbjct: 601 catgg 605
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 725 acctcggccgcgaccacgcta 745
>gb|CK167943.1|CK167943 FGAS052406 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1150
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 364 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 423
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 424 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 483
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 484 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 543
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 544 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 603
Query: 479 catgg 483
|||||
Sbjct: 604 catgg 608
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 728 acctcggccgcgaccacgcta 748
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 83 acctcggccgcgaccacgcta 63
>gb|CK217444.1|CK217444 FGAS029446 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1023
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 399 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 340
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 339 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 280
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 279 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 220
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 219 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 160
Query: 479 catgg 483
|||||
Sbjct: 159 catgg 155
>gb|CK217555.1|CK217555 FGAS029557 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1027
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 438 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 379
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 378 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 319
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 318 catattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 259
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 258 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 199
Query: 479 catgg 483
|||||
Sbjct: 198 catgg 194
>gb|CV774841.1|CV774841 FGAS069241 Triticum aestivum FGAS: Library 2 Gate 3 Triticum
aestivum cDNA, mRNA sequence
Length = 818
Score = 208 bits (105), Expect = 3e-052
Identities = 210/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 416 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 357
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 356 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 297
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 296 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 237
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 236 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 177
Query: 479 catgg 483
|||||
Sbjct: 176 catgg 172
>gb|CK164537.1|CK164537 FGAS048450 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 878
Score = 204 bits (103), Expect = 5e-051
Identities = 184/211 (87%)
Strand = Plus / Plus
Query: 273 atcattacaacactgtttcccctgataaccaccattccaatatctgttttgtcatttcca 332
||||| |||||||| ||||| || | ||||||||| || || || || || |||| ||||
Sbjct: 459 atcatcacaacactatttcctctcagaaccaccatccctatgtcggtcttctcatctcca 518
Query: 333 ttgacctccacagtgttgtccaccaccagattcatgaactggtcgaacccacgaagtgtg 392
|||||||||||||||||||||||||||| |||||||||||| || || |||||||| |||
Sbjct: 519 ttgacctccacagtgttgtccaccaccaaattcatgaactgatcaaatccacgaagcgtg 578
Query: 393 ccgataacaacacggtttgcattcatcttaatctgaagcttcttgtccatgtacttcttg 452
|| || ||||||||||| ||||||| ||| || || |||||||||||||||||||||||
Sbjct: 579 ccaatgacaacacggttcgcattcagcttgatttggagcttcttgtccatgtacttcttc 638
Query: 453 agatccggaggctgccccgagcggctcatgg 483
|||||||| ||||||||||| ||||||||||
Sbjct: 639 agatccggcggctgccccgatcggctcatgg 669
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 144 acctcggccgcgaccacgcta 124
>gb|CK165828.1|CK165828 FGAS049833 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1051
Score = 204 bits (103), Expect = 5e-051
Identities = 184/211 (87%)
Strand = Plus / Plus
Query: 273 atcattacaacactgtttcccctgataaccaccattccaatatctgttttgtcatttcca 332
||||| |||||||| ||||| || | ||||||||| || || || || || |||| ||||
Sbjct: 404 atcatcacaacactatttcctctcagaaccaccatccctatgtcggtcttctcatctcca 463
Query: 333 ttgacctccacagtgttgtccaccaccagattcatgaactggtcgaacccacgaagtgtg 392
|||||||||||||||||||||||||||| |||||||||||| || || |||||||| |||
Sbjct: 464 ttgacctccacagtgttgtccaccaccaaattcatgaactgatcaaatccacgaagcgtg 523
Query: 393 ccgataacaacacggtttgcattcatcttaatctgaagcttcttgtccatgtacttcttg 452
|| || ||||||||||| ||||||| ||| || || |||||||||||||||||||||||
Sbjct: 524 ccaatgacaacacggttcgcattcagcttgatttggagcttcttgtccatgtacttcttc 583
Query: 453 agatccggaggctgccccgagcggctcatgg 483
|||||||| ||||||||||| ||||||||||
Sbjct: 584 agatccggcggctgccccgatcggctcatgg 614
>gb|CK167366.1|CK167366 FGAS051705 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1185
Score = 204 bits (103), Expect = 5e-051
Identities = 184/211 (87%)
Strand = Plus / Plus
Query: 273 atcattacaacactgtttcccctgataaccaccattccaatatctgttttgtcatttcca 332
||||| |||||||| ||||| || | ||||||||| || || || || || |||| ||||
Sbjct: 397 atcatcacaacactatttcctctcagaaccaccatccctatgtcggtcttctcatctcca 456
Query: 333 ttgacctccacagtgttgtccaccaccagattcatgaactggtcgaacccacgaagtgtg 392
|||||||||||||||||||||||||||| |||||||||||| || || |||||||| |||
Sbjct: 457 ttgacctccacagtgttgtccaccaccaaattcatgaactgatcaaatccacgaagcgtg 516
Query: 393 ccgataacaacacggtttgcattcatcttaatctgaagcttcttgtccatgtacttcttg 452
|| || ||||||||||| ||||||| ||| || || |||||||||||||||||||||||
Sbjct: 517 ccaatgacaacacggttcgcattcagcttgatttggagcttcttgtccatgtacttcttc 576
Query: 453 agatccggaggctgccccgagcggctcatgg 483
|||||||| ||||||||||| ||||||||||
Sbjct: 577 agatccggcggctgccccgatcggctcatgg 607
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 727 acctcggccgcgaccacgcta 747
Score = 42.1 bits (21), Expect = 0.045
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 601 acctcggccgcgaccacgcta 621
|||||||||||||||||||||
Sbjct: 82 acctcggccgcgaccacgcta 62
>gb|CD913406.1|CD913406 G550.117M03F010525 G550 Triticum aestivum cDNA clone G550117M03,
mRNA sequence
Length = 460
Score = 200 bits (101), Expect = 8e-050
Identities = 209/245 (85%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 413 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 354
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| |||| |||||||||||||||||||||||||
Sbjct: 353 aaccaccatccctatgtcggtcttctcatctccagtgacctccacagtgttgtccaccac 294
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 293 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 234
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 233 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 174
Query: 479 catgg 483
|||||
Sbjct: 173 catgg 169
>gb|CK168143.1|CK168143 FGAS052638 Triticum aestivum FGAS: TaLt7 Triticum aestivum cDNA,
mRNA sequence
Length = 1154
Score = 200 bits (101), Expect = 8e-050
Identities = 209/245 (85%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 360 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 419
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 420 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 479
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || |||||| |||| |||||||
Sbjct: 480 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacatggttcgcattcag 539
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 540 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 599
Query: 479 catgg 483
|||||
Sbjct: 600 catgg 604
>gb|BE216975.1|BE216975 EST0518 Triticum aestivum Lambda Zap Triticum aestivum cDNA clone
JA1_5C_F04_T3 5', mRNA sequence
Length = 594
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 353 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 294
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 293 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 234
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 233 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 174
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 173 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 114
Query: 479 catgg 483
|||||
Sbjct: 113 catgg 109
>gb|BE402221.1|BE402221 CSB005F11F990908 ITEC CSB Wheat Endosperm Library Triticum aestivum
cDNA clone CSB005F11, mRNA sequence
Length = 490
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 353 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 294
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 293 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 234
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 233 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 174
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 173 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 114
Query: 479 catgg 483
|||||
Sbjct: 113 catgg 109
>gb|BE445879.1|BE445879 WHE1147_H10_P19ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1147_H10_P19,
mRNA sequence
Length = 465
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 384 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 325
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 324 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 265
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 264 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 205
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 204 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 145
Query: 479 catgg 483
|||||
Sbjct: 144 catgg 140
>gb|BQ483050.1|BQ483050 WHE0425_F10_K19ZY Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0425_F10_K19, mRNA
sequence
Length = 533
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 192 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 251
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 252 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 311
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 312 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 371
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 372 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 431
Query: 479 catgg 483
|||||
Sbjct: 432 catgg 436
>gb|BQ607840.1|BQ607840 BRY_3738 wheat EST endosperm library Triticum aestivum cDNA 5',
mRNA sequence
Length = 490
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 353 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 294
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 293 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 234
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 233 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 174
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 173 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 114
Query: 479 catgg 483
|||||
Sbjct: 113 catgg 109
>gb|AL829364.1|AL829364 AL829364 q:141 Triticum aestivum cDNA clone B08_q141_plate_8, mRNA
sequence
Length = 383
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 251 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 192
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
|||||| || || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 191 aaccactatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 132
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 131 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 72
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||| ||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 71 cttgatttggagcttctggtccatgtacttcttcagatccggcggctgccccgatcggct 12
Query: 479 catgg 483
|||||
Sbjct: 11 catgg 7
>gb|BJ210099.1|BJ210099 BJ210099 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh9d10 5', mRNA sequence
Length = 549
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 344 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 285
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 284 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 225
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 224 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 165
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 164 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 105
Query: 479 catgg 483
|||||
Sbjct: 104 catgg 100
>gb|BJ213472.1|BJ213472 BJ213472 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh22j04 5', mRNA sequence
Length = 574
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 351 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 292
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 291 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 232
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 231 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 172
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 171 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 112
Query: 479 catgg 483
|||||
Sbjct: 111 catgg 107
>gb|BJ214472.1|BJ214472 BJ214472 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh2j19 3', mRNA sequence
Length = 524
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 216 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 275
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 276 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 335
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 336 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 395
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 396 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 455
Query: 479 catgg 483
|||||
Sbjct: 456 catgg 460
>gb|BJ215977.1|BJ215977 BJ215977 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh9d10 3', mRNA sequence
Length = 548
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 210 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 269
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 270 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 329
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 330 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 389
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 390 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 449
Query: 479 catgg 483
|||||
Sbjct: 450 catgg 454
>gb|BJ220972.1|BJ220972 BJ220972 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh22j04 3', mRNA sequence
Length = 528
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 189 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 248
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 249 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 308
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 309 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 368
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 369 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 428
Query: 479 catgg 483
|||||
Sbjct: 429 catgg 433
>gb|BJ223799.1|BJ223799 BJ223799 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl6n13 5', mRNA sequence
Length = 320
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 296 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 237
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 236 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 177
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 176 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 117
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 116 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 57
Query: 479 catgg 483
|||||
Sbjct: 56 catgg 52
>gb|BJ227108.1|BJ227108 BJ227108 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl11p15 3', mRNA sequence
Length = 552
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 217 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 276
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 277 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 336
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 337 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 396
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 397 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 456
Query: 479 catgg 483
|||||
Sbjct: 457 catgg 461
>gb|BJ228536.1|BJ228536 BJ228536 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl6n13 3', mRNA sequence
Length = 472
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 164 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 223
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 224 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 283
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 284 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 343
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 344 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 403
Query: 479 catgg 483
|||||
Sbjct: 404 catgg 408
>gb|BJ237688.1|BJ237688 BJ237688 Y. Ogihara unpublished cDNA library, Wh_e Triticum
aestivum cDNA clone whe10m21 3', mRNA sequence
Length = 550
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 207 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 266
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 267 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 326
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 327 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 386
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 387 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 446
Query: 479 catgg 483
|||||
Sbjct: 447 catgg 451
>gb|BJ251852.1|BJ251852 BJ251852 Y. Ogihara unpublished cDNA library, Wh_f Triticum
aestivum cDNA clone whf20m19 3', mRNA sequence
Length = 537
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 215 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 274
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 275 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 334
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 335 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 394
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 395 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 454
Query: 479 catgg 483
|||||
Sbjct: 455 catgg 459
>gb|BJ256468.1|BJ256468 BJ256468 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh16j15 5', mRNA sequence
Length = 536
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 335 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 276
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 275 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 216
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 215 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 156
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 155 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 96
Query: 479 catgg 483
|||||
Sbjct: 95 catgg 91
>gb|BJ261985.1|BJ261985 BJ261985 Y. Ogihara unpublished cDNA library, Wh_h Triticum
aestivum cDNA clone whh16j15 3', mRNA sequence
Length = 523
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 189 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 248
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 249 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 308
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 309 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 368
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 369 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 428
Query: 479 catgg 483
|||||
Sbjct: 429 catgg 433
>gb|BJ271686.1|BJ271686 BJ271686 Y. Ogihara unpublished cDNA library, Wh_oh Triticum
aestivum cDNA clone whoh27a24 5', mRNA sequence
Length = 552
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 318 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 259
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 258 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 199
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 198 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 139
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 138 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 79
Query: 479 catgg 483
|||||
Sbjct: 78 catgg 74
>gb|BJ276903.1|BJ276903 BJ276903 Y. Ogihara unpublished cDNA library, Wh_oh Triticum
aestivum cDNA clone whoh27a24 3', mRNA sequence
Length = 511
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Plus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 214 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 273
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 274 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 333
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 334 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 393
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 394 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 453
Query: 479 catgg 483
|||||
Sbjct: 454 catgg 458
>gb|BJ281913.1|BJ281913 BJ281913 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr24e19 5', mRNA sequence
Length = 555
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 327 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 268
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 267 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 208
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 207 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 148
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 147 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 88
Query: 479 catgg 483
|||||
Sbjct: 87 catgg 83
>gb|BJ281923.1|BJ281923 BJ281923 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr24f19 5', mRNA sequence
Length = 529
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| |||||||| ||||| || |
Sbjct: 301 tcactgagacctggcaattggttcaagggcttcaatcatcacaacactatttcctctcag 242
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||||||||||||
Sbjct: 241 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttgtccaccac 182
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||| ||||| || ||||
Sbjct: 181 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacgcggttcgcgttcag 122
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 121 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 62
Query: 479 catgg 483
|||||
Sbjct: 61 catgg 57
>gb|BJ282198.1|BJ282198 BJ282198 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr25i15 5', mRNA sequence
Length = 523
Score = 192 bits (97), Expect = 2e-047
Identities = 208/245 (84%)
Strand = Plus / Minus
Query: 239 tcactgtgacctcgcaactggctccagtgcctcgatcattacaacactgtttcccctgat 298
|||||| ||||| |||| ||| || || || || ||||| || ||||| ||||| || |
Sbjct: 311 tcactgagacctggcaattggttcaagggcttcaatcatcaccacactatttcctctcag 252
Query: 299 aaccaccattccaatatctgttttgtcatttccattgacctccacagtgttgtccaccac 358
||||||||| || || || || || |||| ||||||||||||||||||||| ||||||||
Sbjct: 251 aaccaccatccctatgtcggtcttctcatctccattgacctccacagtgttatccaccac 192
Query: 359 cagattcatgaactggtcgaacccacgaagtgtgccgataacaacacggtttgcattcat 418
|| |||||||||||| || || |||||||| ||||| || ||||||||||| |||||||
Sbjct: 191 caaattcatgaactgatcaaatccacgaagcgtgccaatgacaacacggttcgcattcag 132
Query: 419 cttaatctgaagcttcttgtccatgtacttcttgagatccggaggctgccccgagcggct 478
||| || || ||||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 131 cttgatttggagcttcttgtccatgtacttcttcagatccggcggctgccccgatcggct 72
Query: 479 catgg 483
|||||
Sbjct: 71 catgg 67
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 141,154
Number of Sequences: 636343
Number of extensions: 141154
Number of successful extensions: 64018
Number of sequences better than 0.5: 26066
Number of HSP's better than 0.5 without gapping: 26066
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33487
Number of HSP's gapped (non-prelim): 30491
length of query: 621
length of database: 367,240,239
effective HSP length: 19
effective length of query: 602
effective length of database: 355,149,722
effective search space: 213800132644
effective search space used: 213800132644
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)