BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2161272.2.21
(693 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA616540.1|CA616540 wl1n.pk0001.d8 wl1n Triticum aestivu... 105 4e-021
gb|CA624402.1|CA624402 wl1n.pk0114.c9 wl1n Triticum aestivu... 105 4e-021
gb|BE404991.1|BE404991 WHE1208_F10_L20ZS Wheat etiolated se... 101 6e-020
gb|BE426818.1|BE426818 WHE0332_A12_B24ZS Wheat unstressed s... 101 6e-020
gb|BE470562.1|BE470562 WHE0261_C10_C10ZS Wheat drought-stre... 101 6e-020
gb|BE470589.1|BE470589 WHE0261_F02_F02ZS Wheat drought-stre... 101 6e-020
gb|BE470728.1|BE470728 WHE0279_F09_K17ZS Wheat drought-stre... 101 6e-020
gb|BQ294789.1|BQ294789 WHE2854_D06_H12ZS Wheat unstressed r... 101 6e-020
gb|CA628268.1|CA628268 wle1.pk0006.e5 wle1 Triticum aestivu... 101 6e-020
gb|CA633123.1|CA633123 wle1n.pk0066.c10 wle1n Triticum aest... 101 6e-020
gb|CA676432.1|CA676432 wrsu1.pk0005.e4 wrsu1 Triticum aesti... 101 6e-020
gb|CK161203.1|CK161203 FGAS013768 Triticum aestivum FGAS: L... 101 6e-020
gb|CK162235.1|CK162235 FGAS014823 Triticum aestivum FGAS: L... 101 6e-020
gb|CK203565.1|CK203565 FGAS012096 Triticum aestivum FGAS: L... 101 6e-020
gb|CK204347.1|CK204347 FGAS012883 Triticum aestivum FGAS: L... 101 6e-020
gb|BE490453.1|BE490453 WHE0367_C03_E05ZS Wheat cold-stresse... 96 4e-018
gb|CA623637.1|CA623637 wl1n.pk0112.d3 wl1n Triticum aestivu... 96 4e-018
gb|CK204004.1|CK204004 FGAS012539 Triticum aestivum FGAS: L... 96 4e-018
gb|BF292917.1|BF292917 WHE2166_D04_H08ZS Triticum turgidum ... 94 2e-017
gb|BF293059.1|BF293059 WHE2160_B02_C04ZS Triticum turgidum ... 94 2e-017
gb|BQ805345.1|BQ805345 WHE3565_G07_N13ZS Wheat developing g... 94 2e-017
gb|CK203219.1|CK203219 FGAS011746 Triticum aestivum FGAS: L... 94 2e-017
gb|BE405598.1|BE405598 WHE1209_B10_C19ZS Wheat etiolated se... 92 6e-017
gb|BU100357.1|BU100357 WHE3352_C12_E24ZS Chinese Spring alu... 92 6e-017
gb|CA612779.1|CA612779 wr1.pk0143.e6 wr1 Triticum aestivum ... 92 6e-017
gb|CA629102.1|CA629102 wle1n.pk0017.b8 wle1n Triticum aesti... 92 6e-017
gb|CB307758.1|CB307758 HFIG743 Hessian fly infested cDNA li... 92 6e-017
gb|BJ226024.1|BJ226024 BJ226024 Y. Ogihara unpublished cDNA... 90 2e-016
gb|CA601536.1|CA601536 wr1.pk0004.e12 wr1 Triticum aestivum... 90 2e-016
gb|CA700897.1|CA700897 wkm1c.pk006.c24 wkm1c Triticum aesti... 90 2e-016
gb|BE445170.1|BE445170 WHE1132_B04_D08ZS Wheat etiolated se... 88 9e-016
gb|CK157758.1|CK157758 FGAS038920 Triticum aestivum FGAS: T... 88 9e-016
gb|BE403413.1|BE403413 WHE0429_C07_E13ZS Wheat etiolated se... 86 4e-015
gb|BQ483535.1|BQ483535 WHE3509_G06_M11ZS Wheat unstressed r... 86 4e-015
gb|BQ483738.1|BQ483738 WHE3512_A07_B14ZS Wheat unstressed r... 86 4e-015
gb|AL820163.1|AL820163 AL820163 N:130 Triticum aestivum cDN... 86 4e-015
gb|CK196116.1|CK196116 FGAS004563 Triticum aestivum FGAS: L... 86 4e-015
gb|CA632146.1|CA632146 wle1n.pk0049.g9 wle1n Triticum aesti... 84 1e-014
gb|CA625585.1|CA625585 wl1n.pk0143.f8 wl1n Triticum aestivu... 82 6e-014
gb|CK154556.1|CK154556 FGAS033258 Triticum aestivum FGAS: T... 82 6e-014
gb|CK154912.1|CK154912 FGAS033629 Triticum aestivum FGAS: T... 82 6e-014
gb|CA619222.1|CA619222 wl1n.pk0045.c12 wl1n Triticum aestiv... 78 9e-013
gb|CA630599.1|CA630599 wle1n.pk0034.a9 wle1n Triticum aesti... 78 9e-013
gb|CA607489.1|CA607489 wr1.pk0078.f10 wr1 Triticum aestivum... 76 4e-012
gb|BJ225220.1|BJ225220 BJ225220 Y. Ogihara unpublished cDNA... 74 1e-011
gb|CF133449.1|CF133449 WHE4358_B04_D08ZT Wheat meiotic flor... 74 1e-011
gb|CB307317.1|CB307317 HFIG302 Hessian fly infested cDNA li... 74 1e-011
gb|CK155965.1|CK155965 FGAS036855 Triticum aestivum FGAS: T... 68 9e-010
gb|CK157171.1|CK157171 FGAS038260 Triticum aestivum FGAS: T... 68 9e-010
gb|CA676516.1|CA676516 wrsu1.pk0006.d3 wrsu1 Triticum aesti... 66 3e-009
gb|BU101211.1|BU101211 WHE3366_B10_D20ZS Chinese Spring alu... 62 5e-008
gb|BE417069.1|BE417069 MUG016.C07R990620 ITEC MUG Wheat Spi... 60 2e-007
gb|BJ213369.1|BJ213369 BJ213369 Y. Ogihara unpublished cDNA... 60 2e-007
gb|BQ838201.1|BQ838201 WHE2907_F12_L23ZS Wheat aluminum-str... 60 2e-007
gb|CF133171.1|CF133171 WHE4354_H02_P04ZT Wheat meiotic flor... 60 2e-007
gb|CA735913.1|CA735913 wpi1s.pk005.k16 wpi1s Triticum aesti... 58 8e-007
gb|CA736812.1|CA736812 wpi1s.pk008.h8 wpi1s Triticum aestiv... 56 3e-006
gb|CA725718.1|CA725718 wet1s.pk001.m24 wet1s Triticum aesti... 54 1e-005
gb|CA725820.1|CA725820 wet1s.pk001.a7 wet1s Triticum aestiv... 54 1e-005
gb|CA726180.1|CA726180 wet1s.pk002.n7 wet1s Triticum aestiv... 54 1e-005
gb|CA734989.1|CA734989 wpi1s.pk002.f20 wpi1s Triticum aesti... 54 1e-005
gb|CA735435.1|CA735435 wpi1s.pk003.e24 wpi1s Triticum aesti... 54 1e-005
gb|CA735860.1|CA735860 wpi1s.pk005.o2 wpi1s Triticum aestiv... 54 1e-005
gb|CA736332.1|CA736332 wpi1s.pk007.o13 wpi1s Triticum aesti... 54 1e-005
gb|CA736636.1|CA736636 wpi1s.pk008.i18 wpi1s Triticum aesti... 54 1e-005
gb|CA736879.1|CA736879 wpi1s.pk008.j7 wpi1s Triticum aestiv... 54 1e-005
gb|CA737669.1|CA737669 wpi2s.pk004.p11 wpi2s Triticum aesti... 54 1e-005
gb|CA739434.1|CA739434 wpi2s.pk007.c24 wpi2s Triticum aesti... 54 1e-005
gb|CA742795.1|CA742795 wri1s.pk004.f19 wri1s Triticum aesti... 54 1e-005
gb|CA743863.1|CA743863 wri1s.pk006.k14 wri1s Triticum aesti... 54 1e-005
gb|CA744842.1|CA744842 wri1s.pk009.d5 wri1s Triticum aestiv... 54 1e-005
gb|CA744965.1|CA744965 wri1s.pk009.d6 wri1s Triticum aestiv... 54 1e-005
gb|CA744981.1|CA744981 wri1s.pk009.j19 wri1s Triticum aesti... 54 1e-005
gb|CA746457.1|CA746457 wri2s.pk007.m6 wri2s Triticum aestiv... 54 1e-005
gb|BE426377.1|BE426377 WHE0334_E01_I02ZS Wheat unstressed s... 52 5e-005
gb|BJ208888.1|BJ208888 BJ208888 Y. Ogihara unpublished cDNA... 52 5e-005
gb|CA700712.1|CA700712 wkm1c.pk006.b19 wkm1c Triticum aesti... 52 5e-005
gb|CA735419.1|CA735419 wpi1s.pk002.p21 wpi1s Triticum aesti... 52 5e-005
gb|CA735483.1|CA735483 wpi1s.pk004.a9 wpi1s Triticum aestiv... 52 5e-005
gb|CA735643.1|CA735643 wpi1s.pk004.k11 wpi1s Triticum aesti... 52 5e-005
gb|CA735677.1|CA735677 wpi1s.pk004.p6 wpi1s Triticum aestiv... 52 5e-005
gb|CA735915.1|CA735915 wpi1s.pk006.g5 wpi1s Triticum aestiv... 52 5e-005
gb|CA736146.1|CA736146 wpi1s.pk006.m3 wpi1s Triticum aestiv... 52 5e-005
gb|CA736295.1|CA736295 wpi1s.pk007.m17 wpi1s Triticum aesti... 52 5e-005
gb|CA736423.1|CA736423 wpi1s.pk007.j12 wpi1s Triticum aesti... 52 5e-005
gb|CA736593.1|CA736593 wpi1s.pk008.c4 wpi1s Triticum aestiv... 52 5e-005
gb|CA736670.1|CA736670 wpi1s.pk008.m22 wpi1s Triticum aesti... 52 5e-005
gb|CA736858.1|CA736858 wpi1s.pk009.e20 wpi1s Triticum aesti... 52 5e-005
gb|CA737013.1|CA737013 wpi1s.pk009.h22 wpi1s Triticum aesti... 52 5e-005
gb|CA737515.1|CA737515 wpi2s.pk004.i1 wpi2s Triticum aestiv... 52 5e-005
gb|CA737556.1|CA737556 wpi2s.pk004.c15 wpi2s Triticum aesti... 52 5e-005
gb|CA737616.1|CA737616 wpi2s.pk004.h13 wpi2s Triticum aesti... 52 5e-005
gb|CA737634.1|CA737634 wpi2s.pk004.f24 wpi2s Triticum aesti... 52 5e-005
gb|CA737720.1|CA737720 wpi2s.pk004.c18 wpi2s Triticum aesti... 52 5e-005
gb|CA737747.1|CA737747 wpi2s.pk004.b21 wpi2s Triticum aesti... 52 5e-005
gb|CA737777.1|CA737777 wpi2s.pk004.p24 wpi2s Triticum aesti... 52 5e-005
gb|CA737971.1|CA737971 wpi2s.pk005.l19 wpi2s Triticum aesti... 52 5e-005
gb|CA737978.1|CA737978 wpi2s.pk005.b13 wpi2s Triticum aesti... 52 5e-005
gb|CA738138.1|CA738138 wpi2s.pk002.n1 wpi2s Triticum aestiv... 52 5e-005
gb|CA738302.1|CA738302 wpi2s.pk006.n9 wpi2s Triticum aestiv... 52 5e-005
gb|CA738487.1|CA738487 wpi2s.pk008.k18 wpi2s Triticum aesti... 52 5e-005
gb|CA738762.1|CA738762 wpi2s.pk002.c7 wpi2s Triticum aestiv... 52 5e-005
gb|CA738909.1|CA738909 wpi2s.pk009.k6 wpi2s Triticum aestiv... 52 5e-005
gb|CA738966.1|CA738966 wpi2s.pk008.n6 wpi2s Triticum aestiv... 52 5e-005
gb|CA739065.1|CA739065 wpi2s.pk009.j4 wpi2s Triticum aestiv... 52 5e-005
gb|CA739145.1|CA739145 wpi2s.pk009.h13 wpi2s Triticum aesti... 52 5e-005
gb|CA739154.1|CA739154 wpi2s.pk009.j12 wpi2s Triticum aesti... 52 5e-005
gb|CA739269.1|CA739269 wpi2s.pk005.d6 wpi2s Triticum aestiv... 52 5e-005
gb|CA739445.1|CA739445 wpi2s.pk007.i22 wpi2s Triticum aesti... 52 5e-005
gb|CA739507.1|CA739507 wpi2s.pk007.f3 wpi2s Triticum aestiv... 52 5e-005
gb|CA739676.1|CA739676 wpi2s.pk010.b15 wpi2s Triticum aesti... 52 5e-005
gb|CA739698.1|CA739698 wpi2s.pk010.m12 wpi2s Triticum aesti... 52 5e-005
gb|CA739725.1|CA739725 wpi2s.pk010.h11 wpi2s Triticum aesti... 52 5e-005
gb|CA739746.1|CA739746 wpi2s.pk010.i18 wpi2s Triticum aesti... 52 5e-005
gb|CA739771.1|CA739771 wpi2s.pk010.c22 wpi2s Triticum aesti... 52 5e-005
gb|CA739787.1|CA739787 wpi2s.pk010.f19 wpi2s Triticum aesti... 52 5e-005
gb|CA742488.1|CA742488 wri1s.pk001.e24 wri1s Triticum aesti... 52 5e-005
gb|CA742913.1|CA742913 wri1s.pk004.i4 wri1s Triticum aestiv... 52 5e-005
gb|CA743946.1|CA743946 wri1s.pk006.m12 wri1s Triticum aesti... 52 5e-005
gb|CA744025.1|CA744025 wri1s.pk006.i24 wri1s Triticum aesti... 52 5e-005
gb|CA744265.1|CA744265 wri1s.pk007.i11 wri1s Triticum aesti... 52 5e-005
gb|CA744428.1|CA744428 wri1s.pk007.f5 wri1s Triticum aestiv... 52 5e-005
gb|CA744619.1|CA744619 wri1s.pk008.j14 wri1s Triticum aesti... 52 5e-005
gb|CA745141.1|CA745141 wri1s.pk008.m22 wri1s Triticum aesti... 52 5e-005
gb|CA746887.1|CA746887 wri2s.pk006.c13 wri2s Triticum aesti... 52 5e-005
gb|CA746888.1|CA746888 wri2s.pk006.c14 wri2s Triticum aesti... 52 5e-005
gb|AJ602560.1|AJ602560 AJ602560 T06 Triticum aestivum cDNA ... 52 5e-005
gb|AJ602561.1|AJ602561 AJ602561 T06 Triticum aestivum cDNA ... 52 5e-005
gb|BF483955.1|BF483955 WHE2306_E09_I18ZS Wheat pre-anthesis... 50 2e-004
gb|BG605161.1|BG605161 WHE2328_C01_F02ZS Wheat pre-anthesis... 50 2e-004
gb|CA725686.1|CA725686 wet1s.pk001.g20 wet1s Triticum aesti... 50 2e-004
gb|CA725699.1|CA725699 wet1s.pk001.o12 wet1s Triticum aesti... 50 2e-004
gb|CA725729.1|CA725729 wet1s.pk001.o4 wet1s Triticum aestiv... 50 2e-004
gb|CA725730.1|CA725730 wet1s.pk001.o6 wet1s Triticum aestiv... 50 2e-004
gb|CA725763.1|CA725763 wet1s.pk001.c5 wet1s Triticum aestiv... 50 2e-004
gb|CA725764.1|CA725764 wet1s.pk001.c15 wet1s Triticum aesti... 50 2e-004
gb|CA725779.1|CA725779 wet1s.pk001.o19 wet1s Triticum aesti... 50 2e-004
gb|CA725802.1|CA725802 wet1s.pk001.a11 wet1s Triticum aesti... 50 2e-004
gb|CA725843.1|CA725843 wet1s.pk001.p19 wet1s Triticum aesti... 50 2e-004
gb|CA725861.1|CA725861 wet1s.pk001.j9 wet1s Triticum aestiv... 50 2e-004
gb|CA725874.1|CA725874 wet1s.pk001.g7 wet1s Triticum aestiv... 50 2e-004
gb|CA725876.1|CA725876 wet1s.pk001.h13 wet1s Triticum aesti... 50 2e-004
gb|CA725879.1|CA725879 wet1s.pk001.i11 wet1s Triticum aesti... 50 2e-004
gb|CA725896.1|CA725896 wet1s.pk001.d12 wet1s Triticum aesti... 50 2e-004
gb|CA725912.1|CA725912 wet1s.pk001.f2 wet1s Triticum aestiv... 50 2e-004
gb|CA725914.1|CA725914 wet1s.pk001.f12 wet1s Triticum aesti... 50 2e-004
gb|CA725933.1|CA725933 wet1s.pk001.p23 wet1s Triticum aesti... 50 2e-004
gb|CA725952.1|CA725952 wet1s.pk001.j24 wet1s Triticum aesti... 50 2e-004
gb|CA725957.1|CA725957 wet1s.pk001.l5 wet1s Triticum aestiv... 50 2e-004
gb|CA726005.1|CA726005 wet1s.pk002.c13 wet1s Triticum aesti... 50 2e-004
gb|CA726010.1|CA726010 wet1s.pk002.g13 wet1s Triticum aesti... 50 2e-004
gb|CA726035.1|CA726035 wet1s.pk002.m5 wet1s Triticum aestiv... 50 2e-004
gb|CA726067.1|CA726067 wet1s.pk002.i7 wet1s Triticum aestiv... 50 2e-004
gb|CA726072.1|CA726072 wet1s.pk002.c5 wet1s Triticum aestiv... 50 2e-004
gb|CA726150.1|CA726150 wet1s.pk002.i22 wet1s Triticum aesti... 50 2e-004
gb|CA726186.1|CA726186 wet1s.pk002.j7 wet1s Triticum aestiv... 50 2e-004
gb|CA726197.1|CA726197 wet1s.pk002.h9 wet1s Triticum aestiv... 50 2e-004
gb|CA726207.1|CA726207 wet1s.pk002.n19 wet1s Triticum aesti... 50 2e-004
gb|CA726213.1|CA726213 wet1s.pk002.j19 wet1s Triticum aesti... 50 2e-004
gb|CA726254.1|CA726254 wet1s.pk002.h22 wet1s Triticum aesti... 50 2e-004
gb|CA726268.1|CA726268 wet1s.pk002.n8 wet1s Triticum aestiv... 50 2e-004
gb|CA726290.1|CA726290 wet1s.pk002.j16 wet1s Triticum aesti... 50 2e-004
gb|CA726291.1|CA726291 wet1s.pk002.j2 wet1s Triticum aestiv... 50 2e-004
gb|CA726300.1|CA726300 wet1s.pk002.d24 wet1s Triticum aesti... 50 2e-004
gb|CA726301.1|CA726301 wet1s.pk002.d14 wet1s Triticum aesti... 50 2e-004
gb|CA726327.1|CA726327 wet1s.pk003.a6 wet1s Triticum aestiv... 50 2e-004
gb|CA726331.1|CA726331 wet1s.pk003.g20 wet1s Triticum aesti... 50 2e-004
gb|CA726349.1|CA726349 wet1s.pk003.k12 wet1s Triticum aesti... 50 2e-004
gb|CA726355.1|CA726355 wet1s.pk003.i6 wet1s Triticum aestiv... 50 2e-004
gb|CA726360.1|CA726360 wet1s.pk003.o16 wet1s Triticum aesti... 50 2e-004
gb|CA726367.1|CA726367 wet1s.pk003.o22 wet1s Triticum aesti... 50 2e-004
gb|CA726397.1|CA726397 wet1s.pk003.f5 wet1s Triticum aestiv... 50 2e-004
gb|CA726404.1|CA726404 wet1s.pk003.b5 wet1s Triticum aestiv... 50 2e-004
gb|CA726422.1|CA726422 wet1s.pk003.l2 wet1s Triticum aestiv... 50 2e-004
gb|CA726459.1|CA726459 wet1s.pk003.j19 wet1s Triticum aesti... 50 2e-004
gb|CA726469.1|CA726469 wet1s.pk003.h10 wet1s Triticum aesti... 50 2e-004
gb|CA726479.1|CA726479 wet1s.pk003.d19 wet1s Triticum aesti... 50 2e-004
gb|CA726493.1|CA726493 wet1s.pk003.d8 wet1s Triticum aestiv... 50 2e-004
gb|CA726499.1|CA726499 wet1s.pk003.e7 wet1s Triticum aestiv... 50 2e-004
gb|CA726503.1|CA726503 wet1s.pk003.g19 wet1s Triticum aesti... 50 2e-004
gb|CA726505.1|CA726505 wet1s.pk003.g5 wet1s Triticum aestiv... 50 2e-004
gb|CA726515.1|CA726515 wet1s.pk003.g11 wet1s Triticum aesti... 50 2e-004
gb|CA726551.1|CA726551 wet1s.pk003.k13 wet1s Triticum aesti... 50 2e-004
gb|CA726595.1|CA726595 wet1s.pk003.k1 wet1s Triticum aestiv... 50 2e-004
gb|CA726602.1|CA726602 wet1s.pk003.h14 wet1s Triticum aesti... 50 2e-004
gb|CA726608.1|CA726608 wet1s.pk003.d20 wet1s Triticum aesti... 50 2e-004
gb|CA726613.1|CA726613 wet1s.pk003.e1 wet1s Triticum aestiv... 50 2e-004
gb|CA734840.1|CA734840 wpi1s.pk002.e11 wpi1s Triticum aesti... 50 2e-004
gb|CA734859.1|CA734859 wpi1s.pk002.i6 wpi1s Triticum aestiv... 50 2e-004
gb|CA734878.1|CA734878 wpi1s.pk002.m2 wpi1s Triticum aestiv... 50 2e-004
gb|CA734900.1|CA734900 wpi1s.pk002.c8 wpi1s Triticum aestiv... 50 2e-004
gb|CA734905.1|CA734905 wpi1s.pk002.o4 wpi1s Triticum aestiv... 50 2e-004
gb|CA734917.1|CA734917 wpi1s.pk002.n10 wpi1s Triticum aesti... 50 2e-004
gb|CA734920.1|CA734920 wpi1s.pk002.n18 wpi1s Triticum aesti... 50 2e-004
gb|CA734922.1|CA734922 wpi1s.pk002.h18 wpi1s Triticum aesti... 50 2e-004
gb|CA734925.1|CA734925 wpi1s.pk002.n8 wpi1s Triticum aestiv... 50 2e-004
gb|CA734940.1|CA734940 wpi1s.pk002.f14 wpi1s Triticum aesti... 50 2e-004
gb|CA734981.1|CA734981 wpi1s.pk002.b20 wpi1s Triticum aesti... 50 2e-004
gb|CA735005.1|CA735005 wpi1s.pk003.j11 wpi1s Triticum aesti... 50 2e-004
gb|CA735013.1|CA735013 wpi1s.pk003.n21 wpi1s Triticum aesti... 50 2e-004
gb|CA735106.1|CA735106 wpi1s.pk003.c3 wpi1s Triticum aestiv... 50 2e-004
gb|CA735129.1|CA735129 wpi1s.pk003.l9 wpi1s Triticum aestiv... 50 2e-004
gb|CA735131.1|CA735131 wpi1s.pk002.d20 wpi1s Triticum aesti... 50 2e-004
gb|CA735250.1|CA735250 wpi1s.pk004.g6 wpi1s Triticum aestiv... 50 2e-004
gb|CA735254.1|CA735254 wpi1s.pk004.m6 wpi1s Triticum aestiv... 50 2e-004
gb|CA735280.1|CA735280 wpi1s.pk004.j1 wpi1s Triticum aestiv... 50 2e-004
gb|CA735297.1|CA735297 wpi1s.pk004.l21 wpi1s Triticum aesti... 50 2e-004
gb|CA735346.1|CA735346 wpi1s.pk004.m14 wpi1s Triticum aesti... 50 2e-004
gb|CA735367.1|CA735367 wpi1s.pk002.h5 wpi1s Triticum aestiv... 50 2e-004
gb|CA735376.1|CA735376 wpi1s.pk002.l7 wpi1s Triticum aestiv... 50 2e-004
gb|CA735404.1|CA735404 wpi1s.pk004.g21 wpi1s Triticum aesti... 50 2e-004
gb|CA735421.1|CA735421 wpi1s.pk002.f3 wpi1s Triticum aestiv... 50 2e-004
gb|CA735447.1|CA735447 wpi1s.pk003.g8 wpi1s Triticum aestiv... 50 2e-004
gb|CA735475.1|CA735475 wpi1s.pk003.c4 wpi1s Triticum aestiv... 50 2e-004
gb|CA735476.1|CA735476 wpi1s.pk003.c6 wpi1s Triticum aestiv... 50 2e-004
gb|CA735538.1|CA735538 wpi1s.pk002.l11 wpi1s Triticum aesti... 50 2e-004
gb|CA735539.1|CA735539 wpi1s.pk002.l13 wpi1s Triticum aesti... 50 2e-004
gb|CA735640.1|CA735640 wpi1s.pk004.i15 wpi1s Triticum aesti... 50 2e-004
gb|CA735764.1|CA735764 wpi1s.pk005.o12 wpi1s Triticum aesti... 50 2e-004
gb|CA735808.1|CA735808 wpi1s.pk005.j8 wpi1s Triticum aestiv... 50 2e-004
gb|CA735994.1|CA735994 wpi1s.pk006.e8 wpi1s Triticum aestiv... 50 2e-004
gb|CA736002.1|CA736002 wpi1s.pk006.c14 wpi1s Triticum aesti... 50 2e-004
gb|CA736081.1|CA736081 wpi1s.pk006.b13 wpi1s Triticum aesti... 50 2e-004
gb|CA736098.1|CA736098 wpi1s.pk006.n9 wpi1s Triticum aestiv... 50 2e-004
gb|CA736124.1|CA736124 wpi1s.pk006.p7 wpi1s Triticum aestiv... 50 2e-004
gb|CA736139.1|CA736139 wpi1s.pk006.i3 wpi1s Triticum aestiv... 50 2e-004
gb|CA736173.1|CA736173 wpi1s.pk006.d22 wpi1s Triticum aesti... 50 2e-004
gb|CA736183.1|CA736183 wpi1s.pk006.n20 wpi1s Triticum aesti... 50 2e-004
gb|CA736204.1|CA736204 wpi1s.pk006.h20 wpi1s Triticum aesti... 50 2e-004
gb|CA736222.1|CA736222 wpi1s.pk006.d4 wpi1s Triticum aestiv... 50 2e-004
gb|CA736245.1|CA736245 wpi1s.pk006.b7 wpi1s Triticum aestiv... 50 2e-004
gb|CA736276.1|CA736276 wpi1s.pk007.a7 wpi1s Triticum aestiv... 50 2e-004
gb|CA736381.1|CA736381 wpi1s.pk007.b13 wpi1s Triticum aesti... 50 2e-004
gb|CA736426.1|CA736426 wpi1s.pk007.j15 wpi1s Triticum aesti... 50 2e-004
gb|CA736430.1|CA736430 wpi1s.pk007.j17 wpi1s Triticum aesti... 50 2e-004
gb|CA736476.1|CA736476 wpi1s.pk007.e16 wpi1s Triticum aesti... 50 2e-004
gb|CA736540.1|CA736540 wpi1s.pk007.l6 wpi1s Triticum aestiv... 50 2e-004
gb|CA736543.1|CA736543 wpi1s.pk007.l19 wpi1s Triticum aesti... 50 2e-004
gb|CA736555.1|CA736555 wpi1s.pk007.n5 wpi1s Triticum aestiv... 50 2e-004
gb|CA736570.1|CA736570 wpi1s.pk007.j2 wpi1s Triticum aestiv... 50 2e-004
gb|CA736644.1|CA736644 wpi1s.pk008.m9 wpi1s Triticum aestiv... 50 2e-004
gb|CA736669.1|CA736669 wpi1s.pk008.m20 wpi1s Triticum aesti... 50 2e-004
gb|CA736671.1|CA736671 wpi1s.pk008.m21 wpi1s Triticum aesti... 50 2e-004
gb|CA736685.1|CA736685 wpi1s.pk008.c12 wpi1s Triticum aesti... 50 2e-004
gb|CA736690.1|CA736690 wpi1s.pk008.c11 wpi1s Triticum aesti... 50 2e-004
gb|CA736705.1|CA736705 wpi1s.pk008.m10 wpi1s Triticum aesti... 50 2e-004
gb|CA736742.1|CA736742 wpi1s.pk008.b3 wpi1s Triticum aestiv... 50 2e-004
gb|CA736764.1|CA736764 wpi1s.pk008.l11 wpi1s Triticum aesti... 50 2e-004
gb|CA736796.1|CA736796 wpi1s.pk008.p12 wpi1s Triticum aesti... 50 2e-004
gb|CA736802.1|CA736802 wpi1s.pk008.b14 wpi1s Triticum aesti... 50 2e-004
gb|CA736806.1|CA736806 wpi1s.pk008.b8 wpi1s Triticum aestiv... 50 2e-004
gb|CA736831.1|CA736831 wpi1s.pk008.d16 wpi1s Triticum aesti... 50 2e-004
gb|CA736850.1|CA736850 wpi1s.pk009.a22 wpi1s Triticum aesti... 50 2e-004
gb|CA736864.1|CA736864 wpi1s.pk009.c24 wpi1s Triticum aesti... 50 2e-004
gb|CA736890.1|CA736890 wpi1s.pk009.c11 wpi1s Triticum aesti... 50 2e-004
gb|CA736908.1|CA736908 wpi1s.pk009.e15 wpi1s Triticum aesti... 50 2e-004
gb|CA736933.1|CA736933 wpi1s.pk008.n8 wpi1s Triticum aestiv... 50 2e-004
gb|CA736939.1|CA736939 wpi1s.pk008.p6 wpi1s Triticum aestiv... 50 2e-004
gb|CA736942.1|CA736942 wpi1s.pk009.a24 wpi1s Triticum aesti... 50 2e-004
gb|CA736952.1|CA736952 wpi1s.pk009.c7 wpi1s Triticum aestiv... 50 2e-004
gb|CA736958.1|CA736958 wpi1s.pk009.g7 wpi1s Triticum aestiv... 50 2e-004
gb|CA736966.1|CA736966 wpi1s.pk009.a18 wpi1s Triticum aesti... 50 2e-004
gb|CA736978.1|CA736978 wpi1s.pk009.k24 wpi1s Triticum aesti... 50 2e-004
gb|CA736995.1|CA736995 wpi1s.pk009.m12 wpi1s Triticum aesti... 50 2e-004
gb|CA737004.1|CA737004 wpi1s.pk009.d22 wpi1s Triticum aesti... 50 2e-004
gb|CA737084.1|CA737084 wpi1s.pk009.p22 wpi1s Triticum aesti... 50 2e-004
gb|CA737109.1|CA737109 wpi1s.pk009.f18 wpi1s Triticum aesti... 50 2e-004
gb|CA737152.1|CA737152 wpi1s.pk009.h11 wpi1s Triticum aesti... 50 2e-004
gb|CA737530.1|CA737530 wpi2s.pk004.m19 wpi2s Triticum aesti... 50 2e-004
gb|CA737543.1|CA737543 wpi2s.pk004.m7 wpi2s Triticum aestiv... 50 2e-004
gb|CA737551.1|CA737551 wpi2s.pk004.c4 wpi2s Triticum aestiv... 50 2e-004
gb|CA737581.1|CA737581 wpi2s.pk004.e2 wpi2s Triticum aestiv... 50 2e-004
gb|CA737626.1|CA737626 wpi2s.pk004.j19 wpi2s Triticum aesti... 50 2e-004
gb|CA737636.1|CA737636 wpi2s.pk004.f3 wpi2s Triticum aestiv... 50 2e-004
gb|CA737677.1|CA737677 wpi2s.pk004.m14 wpi2s Triticum aesti... 50 2e-004
gb|CA737687.1|CA737687 wpi2s.pk004.l11 wpi2s Triticum aesti... 50 2e-004
gb|CA737696.1|CA737696 wpi2s.pk004.n11 wpi2s Triticum aesti... 50 2e-004
gb|CA737742.1|CA737742 wpi2s.pk004.b13 wpi2s Triticum aesti... 50 2e-004
gb|CA737767.1|CA737767 wpi2s.pk004.j4 wpi2s Triticum aestiv... 50 2e-004
gb|CA737821.1|CA737821 wpi2s.pk005.c15 wpi2s Triticum aesti... 50 2e-004
gb|CA737831.1|CA737831 wpi2s.pk005.i8 wpi2s Triticum aestiv... 50 2e-004
gb|CA737833.1|CA737833 wpi2s.pk005.o13 wpi2s Triticum aesti... 50 2e-004
gb|CA737837.1|CA737837 wpi2s.pk005.o14 wpi2s Triticum aesti... 50 2e-004
gb|CA737840.1|CA737840 wpi2s.pk005.o19 wpi2s Triticum aesti... 50 2e-004
gb|CA737862.1|CA737862 wpi2s.pk005.g18 wpi2s Triticum aesti... 50 2e-004
gb|CA737872.1|CA737872 wpi2s.pk005.g8 wpi2s Triticum aestiv... 50 2e-004
gb|CA737904.1|CA737904 wpi2s.pk005.i2 wpi2s Triticum aestiv... 50 2e-004
gb|CA737922.1|CA737922 wpi2s.pk005.k19 wpi2s Triticum aesti... 50 2e-004
gb|CA737934.1|CA737934 wpi2s.pk005.o2 wpi2s Triticum aestiv... 50 2e-004
gb|CA737943.1|CA737943 wpi2s.pk005.e1 wpi2s Triticum aestiv... 50 2e-004
gb|CA737982.1|CA737982 wpi2s.pk005.h1 wpi2s Triticum aestiv... 50 2e-004
gb|CA738002.1|CA738002 wpi2s.pk005.p21 wpi2s Triticum aesti... 50 2e-004
gb|CA738037.1|CA738037 wpi2s.pk002.j15 wpi2s Triticum aesti... 50 2e-004
gb|CA738082.1|CA738082 wpi2s.pk002.f2 wpi2s Triticum aestiv... 50 2e-004
gb|CA738146.1|CA738146 wpi2s.pk002.h1 wpi2s Triticum aestiv... 50 2e-004
gb|CA738150.1|CA738150 wpi2s.pk002.p11 wpi2s Triticum aesti... 50 2e-004
gb|CA738152.1|CA738152 wpi2s.pk002.p13 wpi2s Triticum aesti... 50 2e-004
gb|CA738154.1|CA738154 wpi2s.pk002.p12 wpi2s Triticum aesti... 50 2e-004
gb|CA738205.1|CA738205 wpi2s.pk002.j5 wpi2s Triticum aestiv... 50 2e-004
gb|CA738263.1|CA738263 wpi2s.pk006.m24 wpi2s Triticum aesti... 50 2e-004
gb|CA738275.1|CA738275 wpi2s.pk006.o21 wpi2s Triticum aesti... 50 2e-004
gb|CA738286.1|CA738286 wpi2s.pk006.n1 wpi2s Triticum aestiv... 50 2e-004
gb|CA738361.1|CA738361 wpi2s.pk006.i16 wpi2s Triticum aesti... 50 2e-004
gb|CA738379.1|CA738379 wpi2s.pk006.h3 wpi2s Triticum aestiv... 50 2e-004
gb|CA738448.1|CA738448 wpi2s.pk006.n4 wpi2s Triticum aestiv... 50 2e-004
gb|CA738517.1|CA738517 wpi2s.pk008.i23 wpi2s Triticum aesti... 50 2e-004
gb|CA738547.1|CA738547 wpi2s.pk006.f16 wpi2s Triticum aesti... 50 2e-004
gb|CA738581.1|CA738581 wpi2s.pk008.c5 wpi2s Triticum aestiv... 50 2e-004
gb|CA738595.1|CA738595 wpi2s.pk008.g7 wpi2s Triticum aestiv... 50 2e-004
gb|CA738602.1|CA738602 wpi2s.pk008.k13 wpi2s Triticum aesti... 50 2e-004
gb|CA738657.1|CA738657 wpi2s.pk002.m9 wpi2s Triticum aestiv... 50 2e-004
gb|CA738701.1|CA738701 wpi2s.pk002.g15 wpi2s Triticum aesti... 50 2e-004
gb|CA738744.1|CA738744 wpi2s.pk008.h19 wpi2s Triticum aesti... 50 2e-004
gb|CA738801.1|CA738801 wpi2s.pk008.n23 wpi2s Triticum aesti... 50 2e-004
gb|CA738823.1|CA738823 wpi2s.pk002.e2 wpi2s Triticum aestiv... 50 2e-004
gb|CA738841.1|CA738841 wpi2s.pk002.k6 wpi2s Triticum aestiv... 50 2e-004
gb|CA738968.1|CA738968 wpi2s.pk009.e5 wpi2s Triticum aestiv... 50 2e-004
gb|CA738990.1|CA738990 wpi2s.pk009.o6 wpi2s Triticum aestiv... 50 2e-004
gb|CA739079.1|CA739079 wpi2s.pk009.n21 wpi2s Triticum aesti... 50 2e-004
gb|CA739091.1|CA739091 wpi2s.pk009.l1 wpi2s Triticum aestiv... 50 2e-004
gb|CA739137.1|CA739137 wpi2s.pk009.f10 wpi2s Triticum aesti... 50 2e-004
gb|CA739148.1|CA739148 wpi2s.pk009.h15 wpi2s Triticum aesti... 50 2e-004
gb|CA739176.1|CA739176 wpi2s.pk009.l8 wpi2s Triticum aestiv... 50 2e-004
gb|CA739223.1|CA739223 wpi2s.pk005.p2 wpi2s Triticum aestiv... 50 2e-004
gb|CA739332.1|CA739332 wpi2s.pk007.i19 wpi2s Triticum aesti... 50 2e-004
gb|CA739395.1|CA739395 wpi2s.pk007.g14 wpi2s Triticum aesti... 50 2e-004
gb|CA739431.1|CA739431 wpi2s.pk007.g24 wpi2s Triticum aesti... 50 2e-004
gb|CA739443.1|CA739443 wpi2s.pk007.i18 wpi2s Triticum aesti... 50 2e-004
gb|CA739533.1|CA739533 wpi2s.pk007.l23 wpi2s Triticum aesti... 50 2e-004
gb|CA739582.1|CA739582 wpi2s.pk007.j22 wpi2s Triticum aesti... 50 2e-004
gb|CA739588.1|CA739588 wpi2s.pk007.b24 wpi2s Triticum aesti... 50 2e-004
gb|CA739681.1|CA739681 wpi2s.pk010.k4 wpi2s Triticum aestiv... 50 2e-004
gb|CA739691.1|CA739691 wpi2s.pk010.m6 wpi2s Triticum aestiv... 50 2e-004
gb|CA739695.1|CA739695 wpi2s.pk010.o24 wpi2s Triticum aesti... 50 2e-004
gb|CA739700.1|CA739700 wpi2s.pk010.m19 wpi2s Triticum aesti... 50 2e-004
gb|CA739703.1|CA739703 wpi2s.pk010.m18 wpi2s Triticum aesti... 50 2e-004
gb|CA739720.1|CA739720 wpi2s.pk010.l17 wpi2s Triticum aesti... 50 2e-004
gb|CA739727.1|CA739727 wpi2s.pk010.g8 wpi2s Triticum aestiv... 50 2e-004
gb|CA739737.1|CA739737 wpi2s.pk010.g22 wpi2s Triticum aesti... 50 2e-004
gb|CA739822.1|CA739822 wpi2s.pk010.p20 wpi2s Triticum aesti... 50 2e-004
gb|CA739858.1|CA739858 wpi2s.pk010.d8 wpi2s Triticum aestiv... 50 2e-004
gb|CA739865.1|CA739865 wpi2s.pk010.f16 wpi2s Triticum aesti... 50 2e-004
gb|CA739881.1|CA739881 wpi2s.pk010.j6 wpi2s Triticum aestiv... 50 2e-004
gb|CA739910.1|CA739910 wpi2s.pk010.l20 wpi2s Triticum aesti... 50 2e-004
gb|CA742408.1|CA742408 wri1s.pk001.a11 wri1s Triticum aesti... 50 2e-004
gb|CA742415.1|CA742415 wri1s.pk001.e17 wri1s Triticum aesti... 50 2e-004
gb|CA742417.1|CA742417 wri1s.pk001.e13 wri1s Triticum aesti... 50 2e-004
gb|CA742455.1|CA742455 wri1s.pk001.m7 wri1s Triticum aestiv... 50 2e-004
gb|CA742463.1|CA742463 wri1s.pk001.i1 wri1s Triticum aestiv... 50 2e-004
gb|CA742477.1|CA742477 wri1s.pk001.m13 wri1s Triticum aesti... 50 2e-004
gb|CA742573.1|CA742573 wri1s.pk001.h20 wri1s Triticum aesti... 50 2e-004
gb|CA742576.1|CA742576 wri1s.pk001.h10 wri1s Triticum aesti... 50 2e-004
gb|CA742621.1|CA742621 wri1s.pk001.f18 wri1s Triticum aesti... 50 2e-004
gb|CA742764.1|CA742764 wri1s.pk004.n1 wri1s Triticum aestiv... 50 2e-004
gb|CA742778.1|CA742778 wri1s.pk004.d11 wri1s Triticum aesti... 50 2e-004
gb|CA742829.1|CA742829 wri1s.pk004.c23 wri1s Triticum aesti... 50 2e-004
gb|CA742852.1|CA742852 wri1s.pk004.m3 wri1s Triticum aestiv... 50 2e-004
gb|CA742887.1|CA742887 wri1s.pk004.c11 wri1s Triticum aesti... 50 2e-004
gb|CA742902.1|CA742902 wri1s.pk004.a21 wri1s Triticum aesti... 50 2e-004
gb|CA742918.1|CA742918 wri1s.pk004.i24 wri1s Triticum aesti... 50 2e-004
gb|CA742923.1|CA742923 wri1s.pk004.m22 wri1s Triticum aesti... 50 2e-004
gb|CA742946.1|CA742946 wri1s.pk004.k10 wri1s Triticum aesti... 50 2e-004
gb|CA742969.1|CA742969 wri1s.pk004.a22 wri1s Triticum aesti... 50 2e-004
gb|CA743002.1|CA743002 wri1s.pk002.e17 wri1s Triticum aesti... 50 2e-004
gb|CA743006.1|CA743006 wri1s.pk002.c13 wri1s Triticum aesti... 50 2e-004
gb|CA743094.1|CA743094 wri1s.pk002.h6 wri1s Triticum aestiv... 50 2e-004
gb|CA743100.1|CA743100 wri1s.pk002.i23 wri1s Triticum aesti... 50 2e-004
gb|CA743121.1|CA743121 wri1s.pk004.j16 wri1s Triticum aesti... 50 2e-004
gb|CA743136.1|CA743136 wri1s.pk002.d14 wri1s Triticum aesti... 50 2e-004
gb|CA743172.1|CA743172 wri1s.pk004.h20 wri1s Triticum aesti... 50 2e-004
gb|CA743232.1|CA743232 wri1s.pk002.g18 wri1s Triticum aesti... 50 2e-004
gb|CA743245.1|CA743245 wri1s.pk002.g22 wri1s Triticum aesti... 50 2e-004
gb|CA743344.1|CA743344 wri1s.pk005.c11 wri1s Triticum aesti... 50 2e-004
gb|CA743362.1|CA743362 wri1s.pk005.i11 wri1s Triticum aesti... 50 2e-004
gb|CA743402.1|CA743402 wri1s.pk002.m2 wri1s Triticum aestiv... 50 2e-004
gb|CA743430.1|CA743430 wri1s.pk003.i14 wri1s Triticum aesti... 50 2e-004
gb|CA743486.1|CA743486 wri1s.pk002.n23 wri1s Triticum aesti... 50 2e-004
gb|CA743517.1|CA743517 wri1s.pk003.p23 wri1s Triticum aesti... 50 2e-004
gb|CA743548.1|CA743548 wri1s.pk003.l9 wri1s Triticum aestiv... 50 2e-004
gb|CA743552.1|CA743552 wri1s.pk002.f11 wri1s Triticum aesti... 50 2e-004
gb|CA743604.1|CA743604 wri1s.pk002.l15 wri1s Triticum aesti... 50 2e-004
gb|CA743611.1|CA743611 wri1s.pk002.j19 wri1s Triticum aesti... 50 2e-004
gb|CA743628.1|CA743628 wri1s.pk003.n23 wri1s Triticum aesti... 50 2e-004
gb|CA743639.1|CA743639 wri1s.pk005.g18 wri1s Triticum aesti... 50 2e-004
gb|CA743685.1|CA743685 wri1s.pk005.g6 wri1s Triticum aestiv... 50 2e-004
gb|CA743687.1|CA743687 wri1s.pk005.g4 wri1s Triticum aestiv... 50 2e-004
gb|CA743778.1|CA743778 wri1s.pk005.b17 wri1s Triticum aesti... 50 2e-004
gb|CA743790.1|CA743790 wri1s.pk005.h5 wri1s Triticum aestiv... 50 2e-004
gb|CA743836.1|CA743836 wri1s.pk005.n23 wri1s Triticum aesti... 50 2e-004
gb|CA743861.1|CA743861 wri1s.pk006.c8 wri1s Triticum aestiv... 50 2e-004
gb|CA743874.1|CA743874 wri1s.pk006.g2 wri1s Triticum aestiv... 50 2e-004
gb|CA743950.1|CA743950 wri1s.pk006.m15 wri1s Triticum aesti... 50 2e-004
gb|CA744035.1|CA744035 wri1s.pk006.e8 wri1s Triticum aestiv... 50 2e-004
gb|CA744140.1|CA744140 wri1s.pk006.f19 wri1s Triticum aesti... 50 2e-004
gb|CA744168.1|CA744168 wri1s.pk006.b12 wri1s Triticum aesti... 50 2e-004
gb|CA744202.1|CA744202 wri1s.pk007.c5 wri1s Triticum aestiv... 50 2e-004
gb|CA744227.1|CA744227 wri1s.pk007.o19 wri1s Triticum aesti... 50 2e-004
gb|CA744241.1|CA744241 wri1s.pk007.m3 wri1s Triticum aestiv... 50 2e-004
gb|CA744249.1|CA744249 wri1s.pk007.o8 wri1s Triticum aestiv... 50 2e-004
gb|CA744253.1|CA744253 wri1s.pk007.c9 wri1s Triticum aestiv... 50 2e-004
gb|CA744277.1|CA744277 wri1s.pk006.f4 wri1s Triticum aestiv... 50 2e-004
gb|CA744311.1|CA744311 wri1s.pk007.m18 wri1s Triticum aesti... 50 2e-004
gb|CA744324.1|CA744324 wri1s.pk007.o16 wri1s Triticum aesti... 50 2e-004
gb|CA744387.1|CA744387 wri1s.pk007.p21 wri1s Triticum aesti... 50 2e-004
gb|CA744396.1|CA744396 wri1s.pk007.h3 wri1s Triticum aestiv... 50 2e-004
gb|CA744398.1|CA744398 wri1s.pk007.h7 wri1s Triticum aestiv... 50 2e-004
gb|CA744527.1|CA744527 wri1s.pk008.d17 wri1s Triticum aesti... 50 2e-004
gb|CA744559.1|CA744559 wri1s.pk008.h15 wri1s Triticum aesti... 50 2e-004
gb|CA744592.1|CA744592 wri1s.pk008.p7 wri1s Triticum aestiv... 50 2e-004
gb|CA744611.1|CA744611 wri1s.pk008.d22 wri1s Triticum aesti... 50 2e-004
gb|CA744614.1|CA744614 wri1s.pk008.d4 wri1s Triticum aestiv... 50 2e-004
gb|CA744635.1|CA744635 wri1s.pk008.h18 wri1s Triticum aesti... 50 2e-004
gb|CA744641.1|CA744641 wri1s.pk008.p14 wri1s Triticum aesti... 50 2e-004
gb|CA744649.1|CA744649 wri1s.pk008.d14 wri1s Triticum aesti... 50 2e-004
gb|CA744657.1|CA744657 wri1s.pk008.j12 wri1s Triticum aesti... 50 2e-004
gb|CA744737.1|CA744737 wri1s.pk009.m11 wri1s Triticum aesti... 50 2e-004
gb|CA744861.1|CA744861 wri1s.pk009.f15 wri1s Triticum aesti... 50 2e-004
gb|CA744879.1|CA744879 wri1s.pk009.m12 wri1s Triticum aesti... 50 2e-004
gb|CA744925.1|CA744925 wri1s.pk009.h2 wri1s Triticum aestiv... 50 2e-004
gb|CA744967.1|CA744967 wri1s.pk009.f8 wri1s Triticum aestiv... 50 2e-004
gb|CA744993.1|CA744993 wri1s.pk009.p24 wri1s Triticum aesti... 50 2e-004
gb|CA745040.1|CA745040 wri1s.pk008.o13 wri1s Triticum aesti... 50 2e-004
gb|CA745095.1|CA745095 wri1s.pk008.i18 wri1s Triticum aesti... 50 2e-004
gb|CA745155.1|CA745155 wri1s.pk008.m14 wri1s Triticum aesti... 50 2e-004
gb|CA745167.1|CA745167 wri1s.pk008.a20 wri1s Triticum aesti... 50 2e-004
gb|CA745278.1|CA745278 wri1s.pk003.e15 wri1s Triticum aesti... 50 2e-004
gb|CA745301.1|CA745301 wri1s.pk003.e5 wri1s Triticum aestiv... 50 2e-004
gb|CA745333.1|CA745333 wri1s.pk003.i21 wri1s Triticum aesti... 50 2e-004
gb|CA745359.1|CA745359 wri2s.pk001.k5 wri2s Triticum aestiv... 50 2e-004
gb|CA745379.1|CA745379 wri2s.pk001.o5 wri2s Triticum aestiv... 50 2e-004
gb|CA745380.1|CA745380 wri2s.pk001.o7 wri2s Triticum aestiv... 50 2e-004
gb|CA745413.1|CA745413 wri2s.pk001.k6 wri2s Triticum aestiv... 50 2e-004
gb|CA745543.1|CA745543 wri2s.pk001.l8 wri2s Triticum aestiv... 50 2e-004
gb|CA745598.1|CA745598 wri2s.pk002.e16 wri2s Triticum aesti... 50 2e-004
gb|CA745722.1|CA745722 wri2s.pk002.l8 wri2s Triticum aestiv... 50 2e-004
gb|CA745739.1|CA745739 wri2s.pk002.j3 wri2s Triticum aestiv... 50 2e-004
gb|CA745846.1|CA745846 wri2s.pk003.n15 wri2s Triticum aesti... 50 2e-004
gb|CA745923.1|CA745923 wri2s.pk003.h10 wri2s Triticum aesti... 50 2e-004
gb|CA745926.1|CA745926 wri2s.pk003.j12 wri2s Triticum aesti... 50 2e-004
gb|CA745999.1|CA745999 wri2s.pk003.o19 wri2s Triticum aesti... 50 2e-004
gb|CA746124.1|CA746124 wri2s.pk005.c15 wri2s Triticum aesti... 50 2e-004
gb|CA746186.1|CA746186 wri2s.pk005.e20 wri2s Triticum aesti... 50 2e-004
gb|CA746226.1|CA746226 wri2s.pk005.o24 wri2s Triticum aesti... 50 2e-004
gb|CA746242.1|CA746242 wri2s.pk005.i23 wri2s Triticum aesti... 50 2e-004
gb|CA746299.1|CA746299 wri2s.pk005.p23 wri2s Triticum aesti... 50 2e-004
gb|CA746352.1|CA746352 wri2s.pk005.j16 wri2s Triticum aesti... 50 2e-004
gb|CA746357.1|CA746357 wri2s.pk005.f13 wri2s Triticum aesti... 50 2e-004
gb|CA746361.1|CA746361 wri2s.pk005.f23 wri2s Triticum aesti... 50 2e-004
gb|CA746413.1|CA746413 wri2s.pk007.c11 wri2s Triticum aesti... 50 2e-004
gb|CA746442.1|CA746442 wri2s.pk007.a13 wri2s Triticum aesti... 50 2e-004
gb|CA746445.1|CA746445 wri2s.pk007.i11 wri2s Triticum aesti... 50 2e-004
gb|CA746475.1|CA746475 wri2s.pk007.c12 wri2s Triticum aesti... 50 2e-004
gb|CA746518.1|CA746518 wri2s.pk004.c5 wri2s Triticum aestiv... 50 2e-004
gb|CA746763.1|CA746763 wri2s.pk004.p8 wri2s Triticum aestiv... 50 2e-004
gb|CA746965.1|CA746965 wri2s.pk006.d12 wri2s Triticum aesti... 50 2e-004
gb|CA747150.1|CA747150 wri2s.pk007.p6 wri2s Triticum aestiv... 50 2e-004
gb|CA747184.1|CA747184 wri2s.pk008.o22.f wri2s Triticum aes... 50 2e-004
gb|CA747236.1|CA747236 wri2s.pk008.e13.f wri2s Triticum aes... 50 2e-004
gb|CA747328.1|CA747328 wri2s.pk008.d7.f wri2s Triticum aest... 50 2e-004
gb|CD911937.1|CD911937 G550.112L03F010522 G550 Triticum aes... 50 2e-004
gb|AJ602468.1|AJ602468 AJ602468 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602524.1|AJ602524 AJ602524 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602592.1|AJ602592 AJ602592 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602646.1|AJ602646 AJ602646 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602728.1|AJ602728 AJ602728 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602749.1|AJ602749 AJ602749 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602755.1|AJ602755 AJ602755 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602917.1|AJ602917 AJ602917 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ602976.1|AJ602976 AJ602976 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ603026.1|AJ603026 AJ603026 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ603048.1|AJ603048 AJ603048 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ603103.1|AJ603103 AJ603103 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ603428.1|AJ603428 AJ603428 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ603440.1|AJ603440 AJ603440 T06 Triticum aestivum cDNA ... 50 2e-004
gb|AJ603446.1|AJ603446 AJ603446 T06 Triticum aestivum cDNA ... 50 2e-004
gb|CK152210.1|CK152210 FGAS035196 Triticum aestivum FGAS: T... 50 2e-004
gb|CK153174.1|CK153174 FGAS031746 Triticum aestivum FGAS: T... 50 2e-004
gb|CK156665.1|CK156665 FGAS037671 Triticum aestivum FGAS: T... 50 2e-004
gb|CK157154.1|CK157154 FGAS038242 Triticum aestivum FGAS: T... 50 2e-004
gb|DR732950.1|DR732950 FGAS078870 Triticum aestivum FGAS: T... 50 2e-004
gb|DV799679.1|DV799679 09A02 AAFC_CRC Fusarium graminearum ... 50 2e-004
gb|DV799695.1|DV799695 10J05 AAFC_CRC Fusarium graminearum ... 50 2e-004
gb|DV799750.1|DV799750 15H13 AAFC_CRC Fusarium graminearum ... 50 2e-004
gb|CA667107.1|CA667107 wlsu1.pk0012.b4 wlsu1 Triticum aesti... 48 8e-004
gb|CA667146.1|CA667146 wlsu1.pk0013.f4 wlsu1 Triticum aesti... 48 8e-004
gb|CA668244.1|CA668244 wlsu1.pk019.c21 wlsu1 Triticum aesti... 48 8e-004
gb|CA668362.1|CA668362 wlsu1.pk019.l8 wlsu1 Triticum aestiv... 48 8e-004
gb|CA668514.1|CA668514 wlsu1.pk018.g4 wlsu1 Triticum aestiv... 48 8e-004
gb|CA668957.1|CA668957 wlsu1.pk023.g14 wlsu1 Triticum aesti... 48 8e-004
gb|CA669264.1|CA669264 wlsu1.pk021.o21 wlsu1 Triticum aesti... 48 8e-004
gb|CA669333.1|CA669333 wlsu1.pk023.j16 wlsu1 Triticum aesti... 48 8e-004
gb|CA669335.1|CA669335 wlsu1.pk023.j14 wlsu1 Triticum aesti... 48 8e-004
gb|CA669432.1|CA669432 wlsu1.pk022.f3 wlsu1 Triticum aestiv... 48 8e-004
gb|CA669826.1|CA669826 wlsu1.pk018.h15 wlsu1 Triticum aesti... 48 8e-004
gb|CA725684.1|CA725684 wet1s.pk001.g18 wet1s Triticum aesti... 48 8e-004
gb|CA725687.1|CA725687 wet1s.pk001.g22 wet1s Triticum aesti... 48 8e-004
gb|CA725692.1|CA725692 wet1s.pk001.k4 wet1s Triticum aestiv... 48 8e-004
gb|CA725708.1|CA725708 wet1s.pk001.e24 wet1s Triticum aesti... 48 8e-004
gb|CA725711.1|CA725711 wet1s.pk001.i22 wet1s Triticum aesti... 48 8e-004
gb|CA725715.1|CA725715 wet1s.pk001.m18 wet1s Triticum aesti... 48 8e-004
>gb|CA616540.1|CA616540 wl1n.pk0001.d8 wl1n Triticum aestivum cDNA clone wl1n.pk0001.d8 5'
end, mRNA sequence
Length = 517
Score = 105 bits (53), Expect = 4e-021
Identities = 152/185 (82%)
Strand = Plus / Plus
Query: 486 aacctaggatggttcatggagccggtagttcgcggcgactaccctttctccatgagatca 545
||||||||||||||| | ||||| || ||||| || |||||||| |||||||||||||||
Sbjct: 22 aacctaggatggttcttagagccagtggttcgtggtgactaccccttctccatgagatca 81
Query: 546 ttgatcaaggatcggctaccctacttcaccgacgacgagaaagagaagctagtgggttct 605
||| | ||| || ||||||| ||||| ||||| |||| |||||||| | |||||
Sbjct: 82 ttggctagggaacgactacccttcttcaaggacgagcagaaggagaagctcgccggttcc 141
Query: 606 tatgacataatggggataaactactacacctcgaggttttccaagcacatcgacatctcg 665
||| |||| ||||| |||||||||||||||| |||| ||||| |||||||||||||
Sbjct: 142 tataacatgttggggttaaactactacacctcacggttctccaaaaacatcgacatctca 201
Query: 666 ccaaa 670
|||||
Sbjct: 202 ccaaa 206
>gb|CA624402.1|CA624402 wl1n.pk0114.c9 wl1n Triticum aestivum cDNA clone wl1n.pk0114.c9 5'
end, mRNA sequence
Length = 619
Score = 105 bits (53), Expect = 4e-021
Identities = 152/185 (82%)
Strand = Plus / Plus
Query: 486 aacctaggatggttcatggagccggtagttcgcggcgactaccctttctccatgagatca 545
||||||||||||||| | ||||| || ||||| || |||||||| |||||||||||||||
Sbjct: 137 aacctaggatggttcttagagccagtggttcgtggtgactaccccttctccatgagatca 196
Query: 546 ttgatcaaggatcggctaccctacttcaccgacgacgagaaagagaagctagtgggttct 605
||| | ||| || ||||||| ||||| ||||| |||| |||||||| | |||||
Sbjct: 197 ttggctagggaacgactacccttcttcaaggacgagcagaaggagaagctcgccggttcc 256
Query: 606 tatgacataatggggataaactactacacctcgaggttttccaagcacatcgacatctcg 665
||| |||| ||||| |||||||||||||||| |||| ||||| |||||||||||||
Sbjct: 257 tataacatgttggggttaaactactacacctcacggttctccaaaaacatcgacatctca 316
Query: 666 ccaaa 670
|||||
Sbjct: 317 ccaaa 321
>gb|BE404991.1|BE404991 WHE1208_F10_L20ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE1208_F10_L20, mRNA
sequence
Length = 580
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 312 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 371
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 372 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 431
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 432 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 491
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 492 tacacctccagattctccaagca 514
Score = 61.9 bits (31), Expect = 5e-008
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 150 gtgtgctttgtgcacttcggcgacgtcgtgaagaactggttcaccttcaacgagccaca 208
||||||||| | ||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 12 gtgtgctttaagaacttcggcgacagggtgaagaactggttcacctttaacgagccaca 70
>gb|BE426818.1|BE426818 WHE0332_A12_B24ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0332_A12_B24, mRNA
sequence
Length = 632
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 173 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 232
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 233 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 292
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 293 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 352
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 353 tacacctccagattctccaagca 375
>gb|BE470562.1|BE470562 WHE0261_C10_C10ZS Wheat drought-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0261_C10_C10, mRNA
sequence
Length = 638
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 141 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 200
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 201 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 260
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 261 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 320
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 321 tacacctccagattctccaagca 343
>gb|BE470589.1|BE470589 WHE0261_F02_F02ZS Wheat drought-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0261_F02_F02, mRNA
sequence
Length = 470
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 138 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 197
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 198 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 257
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 258 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 317
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 318 tacacctccagattctccaagca 340
>gb|BE470728.1|BE470728 WHE0279_F09_K17ZS Wheat drought-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0279_F09_K17, mRNA
sequence
Length = 597
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 138 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 197
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 198 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 257
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 258 ttcactaaggaggagcaagagaagctagcgtcctcctgtgacatcatggggctcaactat 317
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 318 tacacctccagattctccaagca 340
>gb|BQ294789.1|BQ294789 WHE2854_D06_H12ZS Wheat unstressed root tip cDNA library Triticum
aestivum cDNA clone WHE2854_D06_H12, mRNA sequence
Length = 564
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 105 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 164
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 165 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 224
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 225 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 284
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 285 tacacctccagattctccaagca 307
>gb|CA628268.1|CA628268 wle1.pk0006.e5 wle1 Triticum aestivum cDNA clone wle1.pk0006.e5 5'
end, mRNA sequence
Length = 555
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 143 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 202
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 203 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 262
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 263 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 322
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 323 tacacctccagattctccaagca 345
>gb|CA633123.1|CA633123 wle1n.pk0066.c10 wle1n Triticum aestivum cDNA clone
wle1n.pk0066.c10 5' end, mRNA sequence
Length = 621
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 29 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 88
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 89 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 148
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 149 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 208
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 209 tacacctccagattctccaagca 231
>gb|CA676432.1|CA676432 wrsu1.pk0005.e4 wrsu1 Triticum aestivum cDNA clone wrsu1.pk0005.e4
5' end, mRNA sequence
Length = 564
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 21 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 80
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 81 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 140
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 141 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 200
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 201 tacacctccagattctccaagca 223
>gb|CK161203.1|CK161203 FGAS013768 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1147
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 166 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 225
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 226 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 285
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 286 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 345
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 346 tacacctccagattctccaagca 368
>gb|CK162235.1|CK162235 FGAS014823 Triticum aestivum FGAS: Library 4 Gate 8 Triticum
aestivum cDNA, mRNA sequence
Length = 1160
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 442 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 501
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 502 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 561
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 562 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 621
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 622 tacacctccagattctccaagca 644
Score = 67.9 bits (34), Expect = 9e-010
Identities = 117/142 (82%), Gaps = 2/142 (1%)
Strand = Plus / Plus
Query: 68 ggacacacctcaagcgctggtggacagctacggtggcttcttagat-gacaggattgtaa 126
|||||| |||||||| |||| ||||| ||||| ||||||||| || | ||| ||||||
Sbjct: 60 ggacactcctcaagcactggaggacaagtacggcggcttcttaaataggcag-attgtag 118
Query: 127 aagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtgaagaact 186
| ||||||| | || ||| ||||||||||| | ||||||||||| ||||||||||
Sbjct: 119 atgattacaaacaattcgccgaggtgtgctttaagaacttcggcgacagggtgaagaact 178
Query: 187 ggttcaccttcaacgagccaca 208
|||||||||| |||||||||||
Sbjct: 179 ggttcacctttaacgagccaca 200
>gb|CK203565.1|CK203565 FGAS012096 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 836
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 319 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 378
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 379 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 438
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 439 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 498
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 499 tacacctccagattctccaagca 521
>gb|CK204347.1|CK204347 FGAS012883 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 858
Score = 101 bits (51), Expect = 6e-020
Identities = 165/203 (81%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 322 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 381
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 382 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 441
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 442 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 501
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 502 tacacctccagattctccaagca 524
>gb|BE490453.1|BE490453 WHE0367_C03_E05ZS Wheat cold-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0367_C03_E05, mRNA
sequence
Length = 388
Score = 95.6 bits (48), Expect = 4e-018
Identities = 123/148 (83%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 141 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 200
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 201 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 260
Query: 570 ttcaccgacgacgagaaagagaagctag 597
||||| | || ||| ||||||||||||
Sbjct: 261 ttcactaaggaggagcaagagaagctag 288
>gb|CA623637.1|CA623637 wl1n.pk0112.d3 wl1n Triticum aestivum cDNA clone wl1n.pk0112.d3 5'
end, mRNA sequence
Length = 489
Score = 95.6 bits (48), Expect = 4e-018
Identities = 135/160 (84%), Gaps = 3/160 (1%)
Strand = Plus / Plus
Query: 485 taacctaggatggttcatggagccggtagttcgcggcgactaccctttctccatgagatc 544
|||||||||||||||| |||||||||| ||||| || ||||| || ||||||||||||||
Sbjct: 67 taacctaggatggttcttggagccggttgttcgtggtgactatcccttctccatgagatc 126
Query: 545 attgatcaa-ggatcggctaccctacttcaccgacgacgagaaagagaagct-agtgggt 602
|||| ||| ||| || ||||||| |||||| ||| | ||| |||||||||| ||||||
Sbjct: 127 attgggcaagggaacgactacccttcttcactgacaaagagcaagagaagctaagtggg- 185
Query: 603 tcttatgacataatggggataaactactacacctcgaggt 642
|| |||||||| ||||| ||||||| || ||||| ||||
Sbjct: 186 tcctatgacatgttggggttaaactattatacctcaaggt 225
>gb|CK204004.1|CK204004 FGAS012539 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 848
Score = 95.6 bits (48), Expect = 4e-018
Identities = 123/148 (83%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 321 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 380
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 381 gtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaag 440
Query: 570 ttcaccgacgacgagaaagagaagctag 597
||||| | || ||| ||||||||||||
Sbjct: 441 ttcactaaggaggagcaagagaagctag 468
>gb|BF292917.1|BF292917 WHE2166_D04_H08ZS Triticum turgidum L. var. durum (durum wheat)
whole plant cDNA library Triticum turgidum cDNA clone
WHE2166_D04_H08, mRNA sequence
Length = 391
Score = 93.7 bits (47), Expect = 2e-017
Identities = 83/95 (87%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 267 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 326
Query: 510 gtagttcgcggcgactaccctttctccatgagatc 544
|| ||||| || |||||||| ||||||||||||||
Sbjct: 327 gtggttcgtggtgactaccccttctccatgagatc 361
Score = 42.1 bits (21), Expect = 0.050
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 184 actggttcaccttcaacgagccaca 208
||||||||||||| |||||||||||
Sbjct: 1 actggttcacctttaacgagccaca 25
>gb|BF293059.1|BF293059 WHE2160_B02_C04ZS Triticum turgidum L. var. durum (durum wheat)
whole plant cDNA library Triticum turgidum cDNA clone
WHE2160_B02_C04, mRNA sequence
Length = 600
Score = 93.7 bits (47), Expect = 2e-017
Identities = 83/95 (87%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 476 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 535
Query: 510 gtagttcgcggcgactaccctttctccatgagatc 544
|| ||||| || |||||||| ||||||||||||||
Sbjct: 536 gtggttcgtggtgactaccccttctccatgagatc 570
Score = 89.7 bits (45), Expect = 2e-016
Identities = 170/209 (81%), Gaps = 2/209 (0%)
Strand = Plus / Plus
Query: 1 actacaaaaggctcatcaacttgttgaaagagaacggcatagaaccatatgtgacacttt 60
||||||| | ||| ||||||| | ||| ||| |||| ||||| |||||||| ||| |||
Sbjct: 27 actacaataagctgatcaactcgctgatagataacgacatagtgccatatgttacaattt 86
Query: 61 tccactgggacacacctcaagcgctggtggacagctacggtggcttcttagat-gacagg 119
||||||||||| |||||||| |||| ||||| ||||| ||||||||| || | |||
Sbjct: 87 ggcactgggacactcctcaagcactggaggacaagtacggcggcttcttaaataggcag- 145
Query: 120 attgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtg 179
|||||| | ||||||| | || ||| ||||||||||| | ||||||||||| |||
Sbjct: 146 attgtagatgattacaaacaattcgccgaggtgtgctttaagaacttcggcgacagggtg 205
Query: 180 aagaactggttcaccttcaacgagccaca 208
||||||||||||||||| |||||||||||
Sbjct: 206 aagaactggttcacctttaacgagccaca 234
>gb|BQ805345.1|BQ805345 WHE3565_G07_N13ZS Wheat developing grains cDNA library Triticum
aestivum cDNA clone WHE3565_G07_N13, mRNA sequence
Length = 772
Score = 93.7 bits (47), Expect = 2e-017
Identities = 164/203 (80%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 40 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 99
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| ||||| |||||||| ||||| ||||| |||||| |
Sbjct: 100 gtggttcgtggtgactaccccttctctatgagatcgctgatcggagatcgtctacccaag 159
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 160 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 219
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 220 tacacctccagattctccaagca 242
>gb|CK203219.1|CK203219 FGAS011746 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 869
Score = 93.7 bits (47), Expect = 2e-017
Identities = 83/95 (87%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 317 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 376
Query: 510 gtagttcgcggcgactaccctttctccatgagatc 544
|| ||||| || |||||||| ||||||||||||||
Sbjct: 377 gtggttcgtggtgactaccccttctccatgagatc 411
>gb|BE405598.1|BE405598 WHE1209_B10_C19ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE1209_B10_C19, mRNA
sequence
Length = 591
Score = 91.7 bits (46), Expect = 6e-017
Identities = 88/102 (86%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||| ||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 328 ctcgacgatcaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 387
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatc 551
|| ||||| || |||||||| ||||||||||||||| |||||
Sbjct: 388 gtggttcgtggtgactaccccttctccatgagatcactgatc 429
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 164 cttcggcgacgtcgtgaagaactggttcaccttcaacgagccacagacgt 213
|||||||||| |||||||||||||||||||| ||||||||||| ||||
Sbjct: 42 cttcggcgacagggtgaagaactggttcacctttaacgagccacatacgt 91
>gb|BU100357.1|BU100357 WHE3352_C12_E24ZS Chinese Spring aluminum-stressed root tip cDNA
library Triticum aestivum cDNA clone WHE3352_C12_E24,
mRNA sequence
Length = 765
Score = 91.7 bits (46), Expect = 6e-017
Identities = 88/102 (86%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||| ||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 116 ctcgacgatcaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 175
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatc 551
|| ||||| || |||||||| ||||||||||||||| |||||
Sbjct: 176 gtggttcgtggtgactaccccttctccatgagatcactgatc 217
>gb|CA612779.1|CA612779 wr1.pk0143.e6 wr1 Triticum aestivum cDNA clone wr1.pk0143.e6 5'
end, mRNA sequence
Length = 502
Score = 91.7 bits (46), Expect = 6e-017
Identities = 144/174 (82%), Gaps = 2/174 (1%)
Strand = Plus / Plus
Query: 36 ggcatagaaccatatgtgacacttttccactgggacacacctcaagcgctggtggacagc 95
||||||| |||||||| ||| ||| ||||||||||| |||||||| |||| ||||
Sbjct: 61 ggcatagtgccatatgttacaatttggcactgggacacccctcaagcactggaagacaag 120
Query: 96 tacggtggcttcttagat-gacaggattgtaaaagattacacggactttgccaaggtgtg 154
||||| || |||||| || | || ||||||||| ||||||| |||| |||||||||||
Sbjct: 121 tacggcggtttcttaaatcggca-gattgtaaatgattacaaacacttcgccaaggtgtg 179
Query: 155 ctttgtgcacttcggcgacgtcgtgaagaactggttcaccttcaacgagccaca 208
||||| | |||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 180 ctttgagagcttcggcgacagggtgaagaactggttcacctttaacgagccaca 233
>gb|CA629102.1|CA629102 wle1n.pk0017.b8 wle1n Triticum aestivum cDNA clone wle1n.pk0017.b8
5' end, mRNA sequence
Length = 431
Score = 91.7 bits (46), Expect = 6e-017
Identities = 88/102 (86%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||| ||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 164 ctcgacgatcaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 223
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatc 551
|| ||||| || |||||||| ||||||||||||||| |||||
Sbjct: 224 gtggttcggggtgactaccccttctccatgagatcactgatc 265
>gb|CB307758.1|CB307758 HFIG743 Hessian fly infested cDNA library Triticum aestivum cDNA,
mRNA sequence
Length = 645
Score = 91.7 bits (46), Expect = 6e-017
Identities = 144/174 (82%), Gaps = 2/174 (1%)
Strand = Plus / Plus
Query: 36 ggcatagaaccatatgtgacacttttccactgggacacacctcaagcgctggtggacagc 95
||||||| |||||||| ||| ||| ||||||||||| |||||||| |||| ||||
Sbjct: 329 ggcatagtgccatatgttacaatttggcactgggacacccctcaagcactggaagacaag 388
Query: 96 tacggtggcttcttagat-gacaggattgtaaaagattacacggactttgccaaggtgtg 154
||||| || |||||| || | || ||||||||| ||||||| |||| |||||||||||
Sbjct: 389 tacggcggtttcttaaatcggca-gattgtaaatgattacaaacacttcgccaaggtgtg 447
Query: 155 ctttgtgcacttcggcgacgtcgtgaagaactggttcaccttcaacgagccaca 208
||||| | |||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 448 ctttgagagcttcggcgacagggtgaagaactggttcacctttaacgagccaca 501
>gb|BJ226024.1|BJ226024 BJ226024 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl24m14 5', mRNA sequence
Length = 527
Score = 89.7 bits (45), Expect = 2e-016
Identities = 167/208 (80%)
Strand = Plus / Plus
Query: 1 actacaaaaggctcatcaacttgttgaaagagaacggcatagaaccatatgtgacacttt 60
||||||| | ||| || |||| | ||| ||| |||| ||||| |||||||| ||| |||
Sbjct: 20 actacaataagctgatnaactcgctgatagataacgacatagtgccatatgttacaattt 79
Query: 61 tccactgggacacacctcaagcgctggtggacagctacggtggcttcttagatgacagga 120
||||||||||| |||||||| |||| ||||| ||||| ||||||||| || | ||
Sbjct: 80 ggcactgggacactcctcaagcactggaggacaagtacggcggcttcttaaataggaaga 139
Query: 121 ttgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtga 180
||||| | ||||||| | || ||| ||||||||||| | ||||||||||| ||||
Sbjct: 140 ttgtagatgattacaaacaattcgccgaggtgtgctttaagaacttcggcgacagggtga 199
Query: 181 agaactggttcaccttcaacgagccaca 208
|||||||||||||||| |||||||||||
Sbjct: 200 agaactggttcacctttaacgagccaca 227
Score = 61.9 bits (31), Expect = 5e-008
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagcc 508
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 468 ctcgacgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcc 526
>gb|CA601536.1|CA601536 wr1.pk0004.e12 wr1 Triticum aestivum cDNA clone wr1.pk0004.e12 5'
end, mRNA sequence
Length = 547
Score = 89.7 bits (45), Expect = 2e-016
Identities = 170/209 (81%), Gaps = 2/209 (0%)
Strand = Plus / Plus
Query: 1 actacaaaaggctcatcaacttgttgaaagagaacggcatagaaccatatgtgacacttt 60
||||||| | ||| ||||||| | ||| ||| |||| ||||| |||||||| ||| |||
Sbjct: 42 actacaataagctgatcaactcgctgatagataacgacatagtgccatatgttacaattt 101
Query: 61 tccactgggacacacctcaagcgctggtggacagctacggtggcttcttagat-gacagg 119
||||||||||| |||||||| |||| ||||| ||||| ||||||||| || | |||
Sbjct: 102 ggcactgggacactcctcaagcactggaggacaagtacggcggcttcttaaataggcag- 160
Query: 120 attgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtg 179
|||||| | ||||||| | || ||| ||||||||||| | ||||||||||| |||
Sbjct: 161 attgtagatgattacaaacaattcgccgaggtgtgctttaagaacttcggcgacagggtg 220
Query: 180 aagaactggttcaccttcaacgagccaca 208
||||||||||||||||| |||||||||||
Sbjct: 221 aagaactggttcacctttaacgagccaca 249
Score = 58.0 bits (29), Expect = 8e-007
Identities = 50/57 (87%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggag 506
|||||||||||||||| ||||| |||||||| || ||||| ||||||||| |||||
Sbjct: 491 ctcgacgaccaggccccggaaagatccatcgactacaacctcggatggttcctggag 547
>gb|CA700897.1|CA700897 wkm1c.pk006.c24 wkm1c Triticum aestivum cDNA clone wkm1c.pk006.c24
5' end, mRNA sequence
Length = 528
Score = 89.7 bits (45), Expect = 2e-016
Identities = 99/117 (84%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||| ||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 34 ctcgacgatcaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 93
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccc 566
|| |||| || |||||||| ||||||||||||||| ||||| ||||||||||||
Sbjct: 94 gtggttcatggtgactaccccttctccatgagatcactgatcggagatcggctaccc 150
>gb|BE445170.1|BE445170 WHE1132_B04_D08ZS Wheat etiolated seedling root normalized cDNA
library Triticum aestivum cDNA clone WHE1132_B04_D08,
mRNA sequence
Length = 594
Score = 87.7 bits (44), Expect = 9e-016
Identities = 165/204 (80%), Gaps = 1/204 (0%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaag-aaaggtccatcgattataacctaggatggttcatggagcc 508
|||||||||||||||| | |||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 19 ctcgacgaccaggcccgggnaaagatccatcgactacaacctcggatggttcctggagcc 78
Query: 509 ggtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctacccta 568
|| ||||| || |||||||| |||||||||||||| ||||| ||||| |||||| |
Sbjct: 79 agtggttcgtggtgactaccccttctccatgagatcgctgatcggagatcgtctacccaa 138
Query: 569 cttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaacta 628
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 139 gttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaacta 198
Query: 629 ctacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 199 ttacacctccagattctccaagca 222
>gb|CK157758.1|CK157758 FGAS038920 Triticum aestivum FGAS: TaLt4 Triticum aestivum cDNA,
mRNA sequence
Length = 862
Score = 87.7 bits (44), Expect = 9e-016
Identities = 163/203 (80%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
||||| |||||||||| ||||| |||||||| || ||||| ||||||||| |||||||
Sbjct: 473 ctcgatgaccaggcccgggaaagatccatcgactacaacctcggatggttcctggagcca 532
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| ||||| |||||||| ||||| ||||| |||||| |
Sbjct: 533 gtggttcgtggtgactaccccttctctatgagatcgctgatcggagatcgtctacccnag 592
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
||||| | || ||| |||||||||||| | || | |||||| |||||| | |||||
Sbjct: 593 ttcactaaggaggagcaagagaagctagcgtcctcatgtgacatcatggggctcaactat 652
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 653 tacacctccagattctccaagca 675
Score = 65.9 bits (33), Expect = 3e-009
Identities = 54/61 (88%)
Strand = Plus / Plus
Query: 148 aggtgtgctttgtgcacttcggcgacgtcgtgaagaactggttcaccttcaacgagccac 207
||||||||||| | ||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 171 aggtgtgctttaagaacttcggcgacagggtgaagaactggttcacctttaacgagccac 230
Query: 208 a 208
|
Sbjct: 231 a 231
>gb|BE403413.1|BE403413 WHE0429_C07_E13ZS Wheat etiolated seedling root cDNA library
Triticum aestivum cDNA clone WHE0429_C07_E13, mRNA
sequence
Length = 445
Score = 85.7 bits (43), Expect = 4e-015
Identities = 163/203 (80%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| ||||| || || ||| | ||||||||| |||||||
Sbjct: 114 ctcgacgaccaggcccgggaaagatccattgactacaacatgggatggttcctggagcca 173
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| ||||||||||||||| ||||| ||||| ||||||
Sbjct: 174 gtggttcgtggtgactaccccttctccatgagatcactgatcggagatcgtctacccatg 233
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
|||||| | || ||| ||||||| |||| | || | |||||| |||||| | |||||
Sbjct: 234 ttcaccaaggaggagcaagagaaactagcgtcgtcatgtgacatcatggggctcaactat 293
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 294 tacacctccagattctccaagca 316
>gb|BQ483535.1|BQ483535 WHE3509_G06_M11ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3509_G06_M11, mRNA sequence
Length = 702
Score = 85.7 bits (43), Expect = 4e-015
Identities = 163/203 (80%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| ||||| || || ||| | ||||||||| |||||||
Sbjct: 77 ctcgacgaccaggcccgggaaagatccattgactacaacatgggatggttcctggagcca 136
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| ||||||||||||||| ||||| ||||| ||||||
Sbjct: 137 gtggttcgtggtgactaccccttctccatgagatcactgatcggagatcgtctacccatg 196
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
|||||| | || ||| ||||||| |||| | || | |||||| |||||| | |||||
Sbjct: 197 ttcaccaaggaggagcaagagaaactagcgtcgtcatgtgacatcatggggctcaactat 256
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 257 tacacctccagattctccaagca 279
>gb|BQ483738.1|BQ483738 WHE3512_A07_B14ZS Wheat unstressed root cDNA library Triticum
aestivum cDNA clone WHE3512_A07_B14, mRNA sequence
Length = 687
Score = 85.7 bits (43), Expect = 4e-015
Identities = 163/203 (80%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| ||||| || || ||| | ||||||||| |||||||
Sbjct: 325 ctcgacgaccaggcccgggaaagatccattgactacaacatgggatggttcctggagcca 384
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| ||||||||||||||| ||||| ||||| ||||||
Sbjct: 385 gtggttcgtggtgactaccccttctccatgagatcactgatcggagatcgtctacccatg 444
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
|||||| | || ||| ||||||| |||| | || | |||||| |||||| | |||||
Sbjct: 445 ttcaccaaggaggagcaagagaaactagcgtcgtcatgtgacatcatggggctcaactat 504
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 505 tacacctccagattctccaagca 527
Score = 58.0 bits (29), Expect = 8e-007
Identities = 53/61 (86%)
Strand = Plus / Plus
Query: 148 aggtgtgctttgtgcacttcggcgacgtcgtgaagaactggttcaccttcaacgagccac 207
||||||||||| | ||||||| ||| |||||||||||||||||||| ||||||||||
Sbjct: 23 aggtgtgctttaagaacttcggtgacagggtgaagaactggttcacctttaacgagccac 82
Query: 208 a 208
|
Sbjct: 83 a 83
>gb|AL820163.1|AL820163 AL820163 N:130 Triticum aestivum cDNA clone F12_N130_plate_28, mRNA
sequence
Length = 649
Score = 85.7 bits (43), Expect = 4e-015
Identities = 163/203 (80%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| ||||| || || ||| | ||||||||| |||||||
Sbjct: 207 ctcgacgaccaggcccgggaaagatccattgactacaacatgggatggttcctggagcca 266
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| ||||||||||||||| ||||| ||||| ||||||
Sbjct: 267 gtggttcgtggtgactaccccttctccatgagatcactgatcggagatcgtctacccatg 326
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
|||||| | || ||| ||||||| |||| | || | |||||| |||||| | |||||
Sbjct: 327 ttcaccaaggaggagcaagagaaactagcgtcgtcatgtgacatcatggggctcaactat 386
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 387 tacacctccagattctccaagca 409
>gb|CK196116.1|CK196116 FGAS004563 Triticum aestivum FGAS: Library 3 Gate 6 Triticum
aestivum cDNA, mRNA sequence
Length = 854
Score = 85.7 bits (43), Expect = 4e-015
Identities = 163/203 (80%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| ||||| ||||| || || ||| | ||||||||| |||||||
Sbjct: 149 ctcgacgaccaggcccgggaaagatccattgactacaacatgggatggttcctggagcca 208
Query: 510 gtagttcgcggcgactaccctttctccatgagatcattgatcaaggatcggctaccctac 569
|| ||||| || |||||||| ||||||||||||||| ||||| ||||| ||||||
Sbjct: 209 gtggttcgtggtgactaccccttctccatgagatcactgatcggagatcgtctacccatg 268
Query: 570 ttcaccgacgacgagaaagagaagctagtgggttcttatgacataatggggataaactac 629
|||||| | || ||| ||||||| |||| | || | |||||| |||||| | |||||
Sbjct: 269 ttcaccaaggaggagcaagagaaactagcgtcgtcatgtgacatcatggggctcaactat 328
Query: 630 tacacctcgaggttttccaagca 652
|||||||| || || ||||||||
Sbjct: 329 tacacctccagattctccaagca 351
>gb|CA632146.1|CA632146 wle1n.pk0049.g9 wle1n Triticum aestivum cDNA clone wle1n.pk0049.g9
5' end, mRNA sequence
Length = 574
Score = 83.8 bits (42), Expect = 1e-014
Identities = 78/90 (86%)
Strand = Plus / Plus
Query: 119 gattgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgt 178
||||||||| ||||||| |||| |||||||||||||||| | |||||||||| ||
Sbjct: 54 gattgtaaatgattacaaacacttcgccaaggtgtgctttgagagcttcggcgacagggt 113
Query: 179 gaagaactggttcaccttcaacgagccaca 208
|||||||||||||||||| |||||||||||
Sbjct: 114 gaagaactggttcacctttaacgagccaca 143
Score = 73.8 bits (37), Expect = 1e-011
Identities = 83/97 (85%), Gaps = 1/97 (1%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatgg-agcc 508
|||||||| ||||||| ||||| |||||||| || ||||| ||||||||| ||| ||||
Sbjct: 385 ctcgacgatcaggcccgggaaagatccatcgactacaacctcggatggttcctgggagcc 444
Query: 509 ggtagttcgcggcgactaccctttctccatgagatca 545
|| ||||| || |||||||| |||||||||||||||
Sbjct: 445 agtggttcggggtgactaccccttctccatgagatca 481
>gb|CA625585.1|CA625585 wl1n.pk0143.f8 wl1n Triticum aestivum cDNA clone wl1n.pk0143.f8 5'
end, mRNA sequence
Length = 550
Score = 81.8 bits (41), Expect = 6e-014
Identities = 122/149 (81%)
Strand = Plus / Plus
Query: 522 gactaccctttctccatgagatcattgatcaaggatcggctaccctacttcaccgacgac 581
|||||||| |||||||||||||||||| | ||| || ||||||| ||||| |||||
Sbjct: 9 gactaccccttctccatgagatcattggctagggaacgactacccttcttcaaggacgag 68
Query: 582 gagaaagagaagctagtgggttcttatgacataatggggataaactactacacctcgagg 641
|||| |||||||| | ||||| ||| |||| ||||| |||||||||||||||| ||
Sbjct: 69 cagaaggagaagctcgccggttcctataacatgttggggttaaactactacacctcacgg 128
Query: 642 ttttccaagcacatcgacatctcgccaaa 670
|| ||||| ||||||||||||| |||||
Sbjct: 129 ttctccaaaaacatcgacatctcaccaaa 157
>gb|CK154556.1|CK154556 FGAS033258 Triticum aestivum FGAS: TaLt2 Triticum aestivum cDNA,
mRNA sequence
Length = 875
Score = 81.8 bits (41), Expect = 6e-014
Identities = 149/185 (80%)
Strand = Plus / Plus
Query: 468 gaaaggtccatcgattataacctaggatggttcatggagccggtagttcgcggcgactac 527
||||| |||||||| || ||||| ||||||||| ||||||| || ||||| || ||||||
Sbjct: 147 gaaagatccatcgactacaacctcggatggttcctggagccagtggttcgtggtgactac 206
Query: 528 cctttctccatgagatcattgatcaaggatcggctaccctacttcaccgacgacgagaaa 587
|| |||||||||||||| ||||| ||||| |||||| | ||||| | || ||| ||
Sbjct: 207 cccttctccatgagatcgctgatcggagatcgtctacccaagttcactaaggaggagcaa 266
Query: 588 gagaagctagtgggttcttatgacataatggggataaactactacacctcgaggttttcc 647
|||||||||| | || | |||||| |||||| | ||||| |||||||| || || |||
Sbjct: 267 gagaagctagcgtcctcatgtgacatcatggggctcaactattacacctccagattctcc 326
Query: 648 aagca 652
|||||
Sbjct: 327 aagca 331
Score = 42.1 bits (21), Expect = 0.050
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 673 acctcggccgcgaccacgcta 693
|||||||||||||||||||||
Sbjct: 144 acctcggccgcgaccacgcta 124
>gb|CK154912.1|CK154912 FGAS033629 Triticum aestivum FGAS: TaLt2 Triticum aestivum cDNA,
mRNA sequence
Length = 901
Score = 81.8 bits (41), Expect = 6e-014
Identities = 149/185 (80%)
Strand = Plus / Plus
Query: 468 gaaaggtccatcgattataacctaggatggttcatggagccggtagttcgcggcgactac 527
||||| |||||||| || ||||| ||||||||| ||||||| || ||||| || ||||||
Sbjct: 148 gaaagatccatcgactacaacctcggatggttcctggagccagtggttcgtggtgactac 207
Query: 528 cctttctccatgagatcattgatcaaggatcggctaccctacttcaccgacgacgagaaa 587
|| |||||||||||||| ||||| ||||| |||||| | ||||| | || ||| ||
Sbjct: 208 cccttctccatgagatcgctgatcggagatcgtctacccaagttcactaaggaggagcaa 267
Query: 588 gagaagctagtgggttcttatgacataatggggataaactactacacctcgaggttttcc 647
|||||||||| | || | |||||| |||||| | ||||| |||||||| || || |||
Sbjct: 268 gagaagctagcgtcctcatgtgacatcatggggctcaactattacacctccagattctcc 327
Query: 648 aagca 652
|||||
Sbjct: 328 aagca 332
Score = 42.1 bits (21), Expect = 0.050
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 673 acctcggccgcgaccacgcta 693
|||||||||||||||||||||
Sbjct: 145 acctcggccgcgaccacgcta 125
>gb|CA619222.1|CA619222 wl1n.pk0045.c12 wl1n Triticum aestivum cDNA clone wl1n.pk0045.c12
5' end, mRNA sequence
Length = 660
Score = 77.8 bits (39), Expect = 9e-013
Identities = 155/191 (81%), Gaps = 2/191 (1%)
Strand = Plus / Plus
Query: 486 aacctaggatggttcatggagccggtagttcgcggcgactaccctttctccatgagatca 545
||||||||||||||| | ||||| || ||||| || |||||||| |||||||||||||||
Sbjct: 101 aacctaggatggttcttagagccagtggttcgtggtgactaccccttctccatgagatca 160
Query: 546 ttgatcaaggatcggctaccctacttcaccgacgacgagaaagagaagctagtgggttct 605
||| | ||| || ||||||| ||||| ||||| |||| ||||| || | |||||
Sbjct: 161 ttggctagggaacgactacccttcttcaaggacgagcagaaggagaa-ctcgccggttcc 219
Query: 606 tatgacataatggggataaactactacacctcgaggtt-ttccaagcacatcgacatctc 664
||| |||| ||||| |||||||||||||||| |||| | |||| |||||||||||||
Sbjct: 220 tataacatgttggggttaaactactacacctcacggttctcccaaaaacatcgacatctc 279
Query: 665 gccaaagtacc 675
||||| ||||
Sbjct: 280 accaaactacc 290
>gb|CA630599.1|CA630599 wle1n.pk0034.a9 wle1n Triticum aestivum cDNA clone wle1n.pk0034.a9
5' end, mRNA sequence
Length = 555
Score = 77.8 bits (39), Expect = 9e-013
Identities = 83/95 (87%), Gaps = 2/95 (2%)
Strand = Plus / Plus
Query: 450 ctcgacgaccaggcccaagaaaggtccatcgattataacctaggatggttcatggagccg 509
|||||||||||||||| |||| ||||||||| || ||||| ||||||||| |||||||
Sbjct: 215 ctcgacgaccaggcccgggaaa-gtccatcgactacaacctcggatggttcctggagcca 273
Query: 510 gtagttcgcggcgactaccctttctccatgagatc 544
|| ||||| || |||||||| ||||||||||||||
Sbjct: 274 gtggttcgtggtgactaccc-ttctccatgagatc 307
>gb|CA607489.1|CA607489 wr1.pk0078.f10 wr1 Triticum aestivum cDNA clone wr1.pk0078.f10 5'
end, mRNA sequence
Length = 514
Score = 75.8 bits (38), Expect = 4e-012
Identities = 62/70 (88%)
Strand = Plus / Plus
Query: 144 gccaaggtgtgctttgtgcacttcggcgacgtcgtgaagaactggttcaccttcaacgag 203
|||||||||||||||| | |||||||||| |||||||||||||||||||| ||||||
Sbjct: 292 gccaaggtgtgctttgagagcttcggcgacagggtgaagaactggttcacctttaacgag 351
Query: 204 ccacagacgt 213
||||| ||||
Sbjct: 352 ccacatacgt 361
>gb|BJ225220.1|BJ225220 BJ225220 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl21b19 5', mRNA sequence
Length = 673
Score = 73.8 bits (37), Expect = 1e-011
Identities = 168/209 (80%), Gaps = 2/209 (0%)
Strand = Plus / Plus
Query: 1 actacaaaaggctcatcaacttgttgaaagagaacggcatagaaccatatgtgacacttt 60
||||||| | ||| ||||||| | ||| ||| |||| ||||| |||||||| ||| |||
Sbjct: 460 actacaataagctgatcaactcgctgatagataacgacatagtgccatatgttacaattt 519
Query: 61 tccactgggacacacctcaagcgctggtggacagctacggtggcttcttagat-gacagg 119
||||||||||| |||||||| |||| |||| ||||| ||||||||| || | |||
Sbjct: 520 ggcactgggacacccctcaagcactggaagacaagtacggcggcttcttaaataggcag- 578
Query: 120 attgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtg 179
|||||| | ||||||| | || ||| ||||||||||| | ||||||| ||| |||
Sbjct: 579 attgtagatgattacaaacaattcgccgaggtgtgctttaagaacttcggtgacagggtg 638
Query: 180 aagaactggttcaccttcaacgagccaca 208
||||||||||||||||| |||||||||||
Sbjct: 639 aagaactggttcacctttaacgagccaca 667
>gb|CF133449.1|CF133449 WHE4358_B04_D08ZT Wheat meiotic floret cDNA library Triticum
aestivum cDNA clone WHE4358_B04_D08, mRNA sequence
Length = 730
Score = 73.8 bits (37), Expect = 1e-011
Identities = 160/201 (79%)
Strand = Plus / Plus
Query: 1 actacaaaaggctcatcaacttgttgaaagagaacggcatagaaccatatgtgacacttt 60
||||||| | ||| ||||||| | ||| ||| |||| ||||| |||||||| ||| |||
Sbjct: 530 actacaataagctgatcaactcgctgatagataacgacatagtgccatatgttacaattt 589
Query: 61 tccactgggacacacctcaagcgctggtggacagctacggtggcttcttagatgacagga 120
||||||||||| |||||| | |||| ||||| ||||| ||||||||| || | ||
Sbjct: 590 ggcactgggacactcctcaaccactggaggacaagtacggcggcttcttaaataggaaga 649
Query: 121 ttgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtga 180
||||| | ||||||| | || ||| ||||||||||| | ||||||||||| ||||
Sbjct: 650 ttgtagatgattacaaacaattcgccgaggtgtgctttaagaacttcggcgacagggtga 709
Query: 181 agaactggttcaccttcaacg 201
|||||||||||||||| ||||
Sbjct: 710 agaactggttcacctttaacg 730
>gb|CB307317.1|CB307317 HFIG302 Hessian fly infested cDNA library Triticum aestivum cDNA,
mRNA sequence
Length = 506
Score = 73.8 bits (37), Expect = 1e-011
Identities = 168/209 (80%), Gaps = 2/209 (0%)
Strand = Plus / Plus
Query: 1 actacaaaaggctcatcaacttgttgaaagagaacggcatagaaccatatgtgacacttt 60
||||||| | ||| ||||||| | ||| ||| |||| ||||| |||||||| ||| |||
Sbjct: 11 actacaataagctgatcaactcgctgatagataacgacatagtgccatatgttacaattt 70
Query: 61 tccactgggacacacctcaagcgctggtggacagctacggtggcttcttagat-gacagg 119
||||||||||| |||||||| |||| |||| ||||| ||||||||| || | |||
Sbjct: 71 ggcactgggacacccctcaagcactggaagacaagtacggcggcttcttaaataggcag- 129
Query: 120 attgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtg 179
|||||| | ||||||| | || ||| ||||||||||| | ||||||| ||| |||
Sbjct: 130 attgtagatgattacaaacaattcgccgaggtgtgctttaagaacttcggtgacagggtg 189
Query: 180 aagaactggttcaccttcaacgagccaca 208
||||||||||||||||| |||||||||||
Sbjct: 190 aagaactggttcacctttaacgagccaca 218
>gb|CK155965.1|CK155965 FGAS036855 Triticum aestivum FGAS: TaLt4 Triticum aestivum cDNA,
mRNA sequence
Length = 850
Score = 67.9 bits (34), Expect = 9e-010
Identities = 167/209 (79%), Gaps = 2/209 (0%)
Strand = Plus / Plus
Query: 1 actacaaaaggctcatcaacttgttgaaagagaacggcatagaaccatatgtgacacttt 60
||||||| | ||| ||||||| | ||| ||| |||| ||||| |||||||| ||| |||
Sbjct: 502 actacaataagctgatcaactcgctgatagataacgacatagtgccatatgttacaattt 561
Query: 61 tccactgggacacacctcaagcgctggtggacagctacggtggcttcttagat-gacagg 119
||||||||||| |||||||| || | ||||| ||||| ||||||||| || | || |
Sbjct: 562 ggcactgggacactcctcaagcactcgaggacaagtacggcggcttcttaaataggca-g 620
Query: 120 attgtaaaagattacacggactttgccaaggtgtgctttgtgcacttcggcgacgtcgtg 179
|||||| | ||||||| | || ||| ||||||||||| | ||||||||||| |||
Sbjct: 621 attgtagatgattacaaacaattcgccgaggtgtgctttaagaacttcggcgacagggtg 680
Query: 180 aagaactggttcaccttcaacgagccaca 208
||||||||||||| | || ||||||||||
Sbjct: 681 aagaactggttcancctctacgagccaca 709
>gb|CK157171.1|CK157171 FGAS038260 Triticum aestivum FGAS: TaLt4 Triticum aestivum cDNA,
mRNA sequence
Length = 884
Score = 67.9 bits (34), Expect = 9e-010
Identities = 61/70 (87%)
Strand = Plus / Minus
Query: 144 gccaaggtgtgctttgtgcacttcggcgacgtcgtgaagaactggttcaccttcaacgag 203
|||||||||||||||| | ||||| |||| |||||||||||||||||||| ||||||
Sbjct: 823 gccaaggtgtgctttgagagcttcgccgacagggtgaagaactggttcacctttaacgag 764
Query: 204 ccacagacgt 213
||||| ||||
Sbjct: 763 ccacatacgt 754
>gb|CA676516.1|CA676516 wrsu1.pk0006.d3 wrsu1 Triticum aestivum cDNA clone wrsu1.pk0006.d3
5' end, mRNA sequence
Length = 514
Score = 65.9 bits (33), Expect = 3e-009
Identities = 129/161 (80%)
Strand = Plus / Plus
Query: 492 ggatggttcatggagccggtagttcgcggcgactaccctttctccatgagatcattgatc 551
||||||||| ||||||| || ||||| || |||||||| ||||||||||||||| |||||
Sbjct: 18 ggatggttcctggagccagtggttcgtggtgactaccccttctccatgagatcactgatc 77
Query: 552 aaggatcggctaccctacttcaccgacgacgagaaagagaagctagtgggttcttatgac 611
||||| |||||| |||||| | || ||| ||||||| |||| | || | ||||
Sbjct: 78 ggagatcgtctacccatgttcaccaaggaggagcaagagaaactagcgtcgtcatgtgac 137
Query: 612 ataatggggataaactactacacctcgaggttttccaagca 652
|| |||||| | ||||| |||||||| || || ||||||||
Sbjct: 138 atcatggggctcaactattacacctccagattctccaagca 178
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 154,057
Number of Sequences: 636343
Number of extensions: 154057
Number of successful extensions: 64606
Number of sequences better than 0.5: 26021
Number of HSP's better than 0.5 without gapping: 26020
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 34779
Number of HSP's gapped (non-prelim): 29819
length of query: 693
length of database: 367,240,239
effective HSP length: 19
effective length of query: 674
effective length of database: 355,149,722
effective search space: 239370912628
effective search space used: 239370912628
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)