BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.203
(959 letters)
Database: Triticum_nucl_with_EST.fasta
636,343 sequences; 367,240,239 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA632791.1|CA632791 wle1n.pk0057.f4 wle1n Triticum aesti... 220 1e-055
gb|BF474170.1|BF474170 WHE0838_H10_O20ZS Wheat vernalized c... 210 1e-052
gb|BQ166189.1|BQ166189 WHE0821-0824_J05_J05ZT Wheat vernali... 210 1e-052
gb|CK205741.1|CK205741 FGAS017274 Triticum aestivum FGAS: L... 210 1e-052
gb|CK205755.1|CK205755 FGAS017293 Triticum aestivum FGAS: L... 210 1e-052
gb|CK211638.1|CK211638 FGAS023490 Triticum aestivum FGAS: L... 210 1e-052
gb|CK215255.1|CK215255 FGAS027210 Triticum aestivum FGAS: L... 210 1e-052
gb|AJ612274.1|AJ612274 AJ612274 Triticum turgidum subsp. du... 210 1e-052
gb|DN828829.1|DN828829 KUCD01_12_C12_T3 WSWR cDNA library T... 210 1e-052
gb|CA632990.1|CA632990 wle1n.pk0064.h8 wle1n Triticum aesti... 206 2e-051
gb|CK216334.1|CK216334 FGAS028322 Triticum aestivum FGAS: L... 206 2e-051
gb|CA632470.1|CA632470 wle1n.pk0059.d5 wle1n Triticum aesti... 204 8e-051
gb|BE426495.1|BE426495 WHE0335_A07_B13ZS Wheat unstressed s... 202 3e-050
gb|CD927124.1|CD927124 GR45.100P10R010607 GR45 Triticum aes... 202 3e-050
gb|BJ212732.1|BJ212732 BJ212732 Y. Ogihara unpublished cDNA... 200 1e-049
gb|CA635983.1|CA635983 wle1n.pk0100.b8 wle1n Triticum aesti... 200 1e-049
gb|CK212819.1|CK212819 FGAS024708 Triticum aestivum FGAS: L... 200 1e-049
gb|CK213960.1|CK213960 FGAS025875 Triticum aestivum FGAS: L... 200 1e-049
gb|BE425565.1|BE425565 WHE0317_G12_G12ZS Wheat unstressed s... 196 2e-048
gb|CA633207.1|CA633207 wle1n.pk0068.d9 wle1n Triticum aesti... 192 3e-047
gb|CA632661.1|CA632661 wle1n.pk0060.b5 wle1n Triticum aesti... 190 1e-046
gb|CK211601.1|CK211601 FGAS023453 Triticum aestivum FGAS: L... 190 1e-046
gb|BF201756.1|BF201756 WHE1765_C04_F07ZS Wheat pre-anthesis... 188 5e-046
gb|CK205414.1|CK205414 FGAS016898 Triticum aestivum FGAS: L... 188 5e-046
gb|AJ716838.1|AJ716838 AJ716838 Triticum turgidum subsp. du... 184 8e-045
gb|CA635692.1|CA635692 wle1n.pk0103.f1 wle1n Triticum aesti... 180 1e-043
gb|CA631750.1|CA631750 wle1n.pk0047.a10 wle1n Triticum aest... 178 5e-043
gb|BE489943.1|BE489943 WHE0363_F03_K05ZS Wheat cold-stresse... 170 1e-040
gb|CA632419.1|CA632419 wle1n.pk0056.f11 wle1n Triticum aest... 167 2e-039
gb|CA630109.1|CA630109 wle1n.pk0014.f12 wle1n Triticum aest... 165 7e-039
gb|CA636678.1|CA636678 wle1n.pk0111.b3 wle1n Triticum aesti... 165 7e-039
gb|CA635089.1|CA635089 wle1n.pk0092.f6 wle1n Triticum aesti... 157 2e-036
gb|CA630582.1|CA630582 wle1n.pk0034.g9 wle1n Triticum aesti... 155 7e-036
gb|CA631586.1|CA631586 wle1n.pk0046.h11 wle1n Triticum aest... 147 2e-033
gb|CA635487.1|CA635487 wle1n.pk0101.c1 wle1n Triticum aesti... 119 4e-025
gb|BE425792.1|BE425792 WHE0337_C06_C06ZS Wheat unstressed s... 113 2e-023
gb|CA633956.1|CA633956 wle1n.pk0079.b4 wle1n Triticum aesti... 111 9e-023
gb|CA645675.1|CA645675 wre1n.pk0099.f9 wre1n Triticum aesti... 103 2e-020
gb|CA632351.1|CA632351 wle1n.pk0056.d3 wle1n Triticum aesti... 92 8e-017
gb|BJ227584.1|BJ227584 BJ227584 Y. Ogihara unpublished cDNA... 82 8e-014
gb|BJ225024.1|BJ225024 BJ225024 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ229823.1|BJ229823 BJ229823 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ278952.1|BJ278952 BJ278952 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ280435.1|BJ280435 BJ280435 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ282124.1|BJ282124 BJ282124 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ284004.1|BJ284004 BJ284004 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ285422.1|BJ285422 BJ285422 Y. Ogihara unpublished cDNA... 60 3e-007
gb|BJ287247.1|BJ287247 BJ287247 Y. Ogihara unpublished cDNA... 60 3e-007
gb|AL826234.1|AL826234 AL826234 p:436 Triticum aestivum cDN... 60 3e-007
gb|AL828240.1|AL828240 AL828240 p:436 Triticum aestivum cDN... 60 3e-007
gb|BQ838076.1|BQ838076 WHE2906_C07_E14ZS Wheat aluminum-str... 60 3e-007
gb|CA611217.1|CA611217 wr1.pk0096.e3 wr1 Triticum aestivum ... 60 3e-007
gb|CA650438.1|CA650438 wre1n.pk0152.h9 wre1n Triticum aesti... 60 3e-007
gb|CD867623.1|CD867623 AZO2.106M12F001124 AZO2 Triticum aes... 60 3e-007
gb|CD868124.1|CD868124 AZO2.108B14R010329 AZO2 Triticum aes... 60 3e-007
gb|CD870295.1|CD870295 AZO2.113P15F001128 AZO2 Triticum aes... 60 3e-007
gb|CD878751.1|CD878751 AZO4.103I22F010929 AZO4 Triticum aes... 60 3e-007
gb|BQ838467.1|BQ838467 WHE2910_G09_M18ZS Wheat aluminum-str... 56 5e-006
gb|BU100450.1|BU100450 WHE3353_D12_H23ZS Chinese Spring alu... 56 5e-006
gb|BU100812.1|BU100812 WHE3358_A04_B08ZS Chinese Spring alu... 56 5e-006
gb|CA647873.1|CA647873 wre1n.pk0122.c12 wre1n Triticum aest... 56 5e-006
gb|CV771209.1|CV771209 FGAS065602 Triticum aestivum FGAS: L... 54 2e-005
gb|AL821684.1|AL821684 AL821684 N:130 Triticum aestivum cDN... 52 7e-005
gb|CA483818.1|CA483818 WHE3205_F09_K17ZS Wheat meiotic anth... 52 7e-005
gb|CA499836.1|CA499836 WHE4012_C02_F04ZT Wheat meiotic anth... 52 7e-005
gb|CA594453.1|CA594453 wpa1c.pk007.c12 wpa1c Triticum aesti... 52 7e-005
gb|CA729180.1|CA729180 wdi1c.pk007.c14 wdi1c Triticum aesti... 52 7e-005
gb|CK216147.1|CK216147 FGAS028131 Triticum aestivum FGAS: L... 52 7e-005
gb|DR739167.1|DR739167 FGAS084384 Triticum aestivum FGAS: L... 52 7e-005
gb|BE213305.1|BE213305 EST0062 Triticum aestivum Lambda Zap... 48 0.001
gb|BJ226206.1|BJ226206 BJ226206 Y. Ogihara unpublished cDNA... 48 0.001
gb|BJ231109.1|BJ231109 BJ231109 Y. Ogihara unpublished cDNA... 48 0.001
gb|BJ278663.1|BJ278663 BJ278663 Y. Ogihara unpublished cDNA... 48 0.001
gb|BJ283716.1|BJ283716 BJ283716 Y. Ogihara unpublished cDNA... 48 0.001
gb|BJ286482.1|BJ286482 BJ286482 Y. Ogihara unpublished cDNA... 48 0.001
gb|AL820348.1|AL820348 AL820348 N:130 Triticum aestivum cDN... 48 0.001
gb|CA607122.1|CA607122 wr1.pk0074.c7 wr1 Triticum aestivum ... 48 0.001
gb|CA609658.1|CA609658 wr1.pk0108.b7 wr1 Triticum aestivum ... 48 0.001
gb|CA614519.1|CA614519 wr1.pk162.h3 wr1 Triticum aestivum c... 48 0.001
gb|CA614588.1|CA614588 wr1.pk163.h3 wr1 Triticum aestivum c... 48 0.001
gb|CA615781.1|CA615781 wr1.pk167.b10 wr1 Triticum aestivum ... 48 0.001
gb|CA616450.1|CA616450 wl1n.pk0003.a10 wl1n Triticum aestiv... 48 0.001
gb|CA619084.1|CA619084 wl1n.pk0040.a9 wl1n Triticum aestivu... 48 0.001
gb|CA619129.1|CA619129 wl1n.pk0040.b2 wl1n Triticum aestivu... 48 0.001
gb|CA630706.1|CA630706 wle1n.pk0037.d2 wle1n Triticum aesti... 48 0.001
gb|CA639367.1|CA639367 wre1n.pk0021.a3 wre1n Triticum aesti... 48 0.001
gb|CA640232.1|CA640232 wre1n.pk0033.d2 wre1n Triticum aesti... 48 0.001
gb|CA641446.1|CA641446 wre1n.pk0044.e6 wre1n Triticum aesti... 48 0.001
gb|CA641548.1|CA641548 wre1n.pk0046.b5 wre1n Triticum aesti... 48 0.001
gb|CA643183.1|CA643183 wre1n.pk0067.d4 wre1n Triticum aesti... 48 0.001
gb|CA643221.1|CA643221 wre1n.pk0064.c1 wre1n Triticum aesti... 48 0.001
gb|CA645683.1|CA645683 wre1n.pk0099.c12 wre1n Triticum aest... 48 0.001
gb|CA648568.1|CA648568 wre1n.pk0135.g5 wre1n Triticum aesti... 48 0.001
gb|CA649449.1|CA649449 wre1n.pk0142.c2 wre1n Triticum aesti... 48 0.001
gb|CA698267.1|CA698267 wlk8.pk0001.d3 wlk8 Triticum aestivu... 48 0.001
gb|CA700493.1|CA700493 wkm1c.pk005.g1 wkm1c Triticum aestiv... 48 0.001
gb|CA700865.1|CA700865 wkm1c.pk006.g20 wkm1c Triticum aesti... 48 0.001
gb|CA720256.1|CA720256 wkm2n.pk006.g22 wkm2n Triticum aesti... 48 0.001
gb|CK202416.1|CK202416 FGAS010940 Triticum aestivum FGAS: L... 48 0.001
gb|CK214353.1|CK214353 FGAS026276 Triticum aestivum FGAS: L... 48 0.001
gb|AJ612799.1|AJ612799 AJ612799 Triticum turgidum subsp. du... 48 0.001
gb|AJ615657.1|AJ615657 AJ615657 Triticum turgidum subsp. du... 48 0.001
gb|CV762285.1|CV762285 FGAS056674 Triticum aestivum FGAS: L... 48 0.001
gb|CV765775.1|CV765775 FGAS060162 Triticum aestivum FGAS: L... 48 0.001
gb|CV770564.1|CV770564 FGAS064957 Triticum aestivum FGAS: L... 48 0.001
gb|CV772950.1|CV772950 FGAS067345 Triticum aestivum FGAS: L... 48 0.001
gb|CV776965.1|CV776965 FGAS071369 Triticum aestivum FGAS: L... 48 0.001
gb|CV778640.1|CV778640 FGAS073049 Triticum aestivum FGAS: L... 48 0.001
gb|DR739533.1|DR739533 FGAS084750 Triticum aestivum FGAS: L... 48 0.001
gb|DR740945.1|DR740945 FGAS000878 Triticum aestivum FGAS: L... 48 0.001
gb|BQ807201.1|BQ807201 WHE3588_A06_A12ZS Wheat developing g... 46 0.004
gb|CA601700.1|CA601700 wr1.pk0003.f7 wr1 Triticum aestivum ... 46 0.004
gb|CA605783.1|CA605783 wr1.pk0060.d3 wr1 Triticum aestivum ... 46 0.004
gb|CA607791.1|CA607791 wr1.pk0082.a3 wr1 Triticum aestivum ... 46 0.004
gb|CA615276.1|CA615276 wr1.pk165.c11 wr1 Triticum aestivum ... 46 0.004
gb|CA615999.1|CA615999 wr1.pk173.a12 wr1 Triticum aestivum ... 46 0.004
gb|CA625953.1|CA625953 wl1n.pk0144.a6 wl1n Triticum aestivu... 46 0.004
gb|CA631007.1|CA631007 wle1n.pk0040.d11 wle1n Triticum aest... 46 0.004
gb|CA640349.1|CA640349 wre1n.pk0032.f3 wre1n Triticum aesti... 46 0.004
gb|CA646573.1|CA646573 wre1n.pk0108.e7 wre1n Triticum aesti... 46 0.004
gb|CA646778.1|CA646778 wre1n.pk0115.h9 wre1n Triticum aesti... 46 0.004
gb|CA700745.1|CA700745 wkm1c.pk006.a9 wkm1c Triticum aestiv... 46 0.004
gb|CA700789.1|CA700789 wkm1c.pk006.g3 wkm1c Triticum aestiv... 46 0.004
gb|CA701087.1|CA701087 wkm2c.pk0002.h3 wkm2c Triticum aesti... 46 0.004
gb|CA719370.1|CA719370 wkm2n.pk005.d4 wkm2n Triticum aestiv... 46 0.004
gb|CA720574.1|CA720574 wkm2n.pk007.h5 wkm2n Triticum aestiv... 46 0.004
gb|CA720581.1|CA720581 wkm2n.pk007.j5 wkm2n Triticum aestiv... 46 0.004
gb|CA727902.1|CA727902 wdi1c.pk003.f19 wdi1c Triticum aesti... 46 0.004
gb|CD864953.1|CD864953 AZO2.001P18F000630 AZO2 Triticum aes... 46 0.004
gb|CD867991.1|CD867991 AZO2.107L20F001113 AZO2 Triticum aes... 46 0.004
gb|CK196743.1|CK196743 FGAS005203 Triticum aestivum FGAS: L... 46 0.004
gb|CK211414.1|CK211414 FGAS023257 Triticum aestivum FGAS: L... 46 0.004
gb|AL809573.1|AL809573 AL809573 a:11 Triticum aestivum cDNA... 46 0.004
gb|CV773867.1|CV773867 FGAS068264 Triticum aestivum FGAS: L... 46 0.004
gb|CV777248.1|CV777248 FGAS071653 Triticum aestivum FGAS: L... 46 0.004
gb|CK216492.1|CK216492 FGAS028486 Triticum aestivum FGAS: L... 44 0.018
gb|BF200508.1|BF200508 WHE0825-0828_B03_B03ZS Wheat vernali... 42 0.070
gb|BJ314183.1|BJ314183 BJ314183 Y. Ogihara unpublished cDNA... 42 0.070
gb|BJ319653.1|BJ319653 BJ319653 Y. Ogihara unpublished cDNA... 42 0.070
gb|AL820853.1|AL820853 AL820853 O:232 Triticum aestivum cDN... 42 0.070
gb|CA608717.1|CA608717 wr1.pk0093.g8 wr1 Triticum aestivum ... 42 0.070
gb|CA618422.1|CA618422 wl1n.pk0033.b9 wl1n Triticum aestivu... 42 0.070
gb|CA619748.1|CA619748 wl1n.pk0063.f11 wl1n Triticum aestiv... 42 0.070
gb|CA620374.1|CA620374 wl1n.pk0055.b10 wl1n Triticum aestiv... 42 0.070
gb|CA622455.1|CA622455 wl1n.pk0093.e9 wl1n Triticum aestivu... 42 0.070
gb|CA741621.1|CA741621 wia1c.pk003.e22 wia1c Triticum aesti... 42 0.070
gb|CK152983.1|CK152983 FGAS036062 Triticum aestivum FGAS: T... 42 0.070
gb|CK160772.1|CK160772 FGAS042404 Triticum aestivum FGAS: T... 42 0.070
gb|CK166116.1|CK166116 FGAS050175 Triticum aestivum FGAS: T... 42 0.070
gb|CK196448.1|CK196448 FGAS004906 Triticum aestivum FGAS: L... 42 0.070
gb|CK207619.1|CK207619 FGAS019264 Triticum aestivum FGAS: L... 42 0.070
gb|CV780372.1|CV780372 FGAS074781 Triticum aestivum FGAS: L... 42 0.070
gb|BE404998.1|BE404998 WHE1208_F02_L04ZS Wheat etiolated se... 40 0.27
gb|BE406568.1|BE406568 WHE0418_e03_i06zB Wheat etiolated se... 40 0.27
gb|BG608047.1|BG608047 WHE2496_B12_C24ZS Triticum monococcu... 40 0.27
gb|BJ278436.1|BJ278436 BJ278436 Y. Ogihara unpublished cDNA... 40 0.27
gb|BJ278440.1|BJ278440 BJ278440 Y. Ogihara unpublished cDNA... 40 0.27
gb|BJ279331.1|BJ279331 BJ279331 Y. Ogihara unpublished cDNA... 40 0.27
gb|BJ283483.1|BJ283483 BJ283483 Y. Ogihara unpublished cDNA... 40 0.27
gb|BJ283487.1|BJ283487 BJ283487 Y. Ogihara unpublished cDNA... 40 0.27
gb|BJ284353.1|BJ284353 BJ284353 Y. Ogihara unpublished cDNA... 40 0.27
gb|BQ295167.1|BQ295167 WHE2858_H12_P24ZS Wheat unstressed r... 40 0.27
gb|AL821523.1|AL821523 AL821523 p:133 Triticum aestivum cDN... 40 0.27
gb|AL822372.1|AL822372 AL822372 p:234 Triticum aestivum cDN... 40 0.27
gb|BQ801718.1|BQ801718 WHE2817_G03_M05ZS Triticum monococcu... 40 0.27
gb|BU100824.1|BU100824 WHE3358_B05_D10ZS Chinese Spring alu... 40 0.27
gb|BJ286069.1|BJ286069 BJ286069 Y. Ogihara unpublished cDNA... 40 0.27
gb|CA601774.1|CA601774 wr1.pk0005.f3 wr1 Triticum aestivum ... 40 0.27
gb|CA601931.1|CA601931 wr1.pk0012.a3 wr1 Triticum aestivum ... 40 0.27
gb|CA602144.1|CA602144 wr1.pk0018.c11 wr1 Triticum aestivum... 40 0.27
gb|CA603338.1|CA603338 wr1.pk0027.a6 wr1 Triticum aestivum ... 40 0.27
gb|CA604487.1|CA604487 wr1.pk0038.e7 wr1 Triticum aestivum ... 40 0.27
gb|CA605745.1|CA605745 wr1.pk0055.a6 wr1 Triticum aestivum ... 40 0.27
gb|CA606098.1|CA606098 wr1.pk0058.g8 wr1 Triticum aestivum ... 40 0.27
gb|CA609070.1|CA609070 wr1.pk0101.b4 wr1 Triticum aestivum ... 40 0.27
gb|CA609468.1|CA609468 wr1.pk0106.b9 wr1 Triticum aestivum ... 40 0.27
gb|CA609941.1|CA609941 wr1.pk0110.d12 wr1 Triticum aestivum... 40 0.27
gb|CA613534.1|CA613534 wr1.pk0152.b6 wr1 Triticum aestivum ... 40 0.27
gb|CA614362.1|CA614362 wr1.pk175.g3 wr1 Triticum aestivum c... 40 0.27
gb|CA615007.1|CA615007 wr1.pk149.b4 wr1 Triticum aestivum c... 40 0.27
gb|CA618662.1|CA618662 wl1n.pk0036.d11 wl1n Triticum aestiv... 40 0.27
gb|CA618733.1|CA618733 wl1n.pk0037.b1 wl1n Triticum aestivu... 40 0.27
gb|CA618843.1|CA618843 wl1n.pk0046.c2 wl1n Triticum aestivu... 40 0.27
gb|CA620548.1|CA620548 wl1n.pk0057.f9 wl1n Triticum aestivu... 40 0.27
gb|CA621509.1|CA621509 wl1n.pk0078.a2 wl1n Triticum aestivu... 40 0.27
gb|CA621968.1|CA621968 wl1n.pk0080.f7 wl1n Triticum aestivu... 40 0.27
gb|CA622251.1|CA622251 wl1n.pk0089.a3 wl1n Triticum aestivu... 40 0.27
gb|CA622368.1|CA622368 wl1n.pk0091.a12 wl1n Triticum aestiv... 40 0.27
gb|CA625175.1|CA625175 wl1n.pk0128.h2 wl1n Triticum aestivu... 40 0.27
gb|CA625370.1|CA625370 wl1n.pk0132.b12 wl1n Triticum aestiv... 40 0.27
gb|CA625400.1|CA625400 wl1n.pk0139.c7 wl1n Triticum aestivu... 40 0.27
gb|CA625420.1|CA625420 wl1n.pk0139.b12 wl1n Triticum aestiv... 40 0.27
gb|CA625762.1|CA625762 wl1n.pk0141.c9 wl1n Triticum aestivu... 40 0.27
gb|CA626097.1|CA626097 wl1n.pk0138.g9 wl1n Triticum aestivu... 40 0.27
gb|CA629349.1|CA629349 wle1n.pk0022.g3 wle1n Triticum aesti... 40 0.27
gb|CA629383.1|CA629383 wle1n.pk0025.d7 wle1n Triticum aesti... 40 0.27
gb|CA631065.1|CA631065 wle1n.pk0043.b9 wle1n Triticum aesti... 40 0.27
gb|CA631558.1|CA631558 wle1n.pk0046.d2 wle1n Triticum aesti... 40 0.27
gb|CA641939.1|CA641939 wre1n.pk0051.a5 wre1n Triticum aesti... 40 0.27
gb|CA646720.1|CA646720 wre1n.pk0114.a10 wre1n Triticum aest... 40 0.27
gb|CA677717.1|CA677717 wlm12.pk0019.b2 wlm12 Triticum aesti... 40 0.27
gb|CA678086.1|CA678086 wlm12.pk0022.b1 wlm12 Triticum aesti... 40 0.27
gb|CA685600.1|CA685600 wlm96.pk030.n24 wlm96 Triticum aesti... 40 0.27
gb|CA722750.1|CA722750 wds1c.pk004.e14.f wds1c Triticum mon... 40 0.27
gb|CA733378.1|CA733378 wlp1c.pk008.o18 wlp1c Triticum aesti... 40 0.27
gb|CA742300.1|CA742300 wfl1c.pk001.l20 wfl1c Triticum aesti... 40 0.27
gb|CD490344.1|CD490344 WHE2496_B12_C24ZT Triticum monococcu... 40 0.27
gb|CD864770.1|CD864770 AZO2.001K09F000630 AZO2 Triticum aes... 40 0.27
gb|CD864771.1|CD864771 AZO2.001K09R000711 AZO2 Triticum aes... 40 0.27
gb|CD866168.1|CD866168 AZO2.102L23F001123 AZO2 Triticum aes... 40 0.27
gb|CD867341.1|CD867341 AZO2.106A13F001108 AZO2 Triticum aes... 40 0.27
gb|CD867504.1|CD867504 AZO2.106H14F001109 AZO2 Triticum aes... 40 0.27
gb|CD867505.1|CD867505 AZO2.106H14R010329 AZO2 Triticum aes... 40 0.27
gb|CD867691.1|CD867691 AZO2.106P05F001110 AZO2 Triticum aes... 40 0.27
gb|CD867692.1|CD867692 AZO2.106P05R010328 AZO2 Triticum aes... 40 0.27
gb|CD867780.1|CD867780 AZO2.107C18F001110 AZO2 Triticum aes... 40 0.27
gb|CD868484.1|CD868484 AZO2.109A07F001114 AZO2 Triticum aes... 40 0.27
gb|CD870693.1|CD870693 AZO2.115D17F010115 AZO2 Triticum aes... 40 0.27
gb|CD877770.1|CD877770 AZO4.101B03F011002 AZO4 Triticum aes... 40 0.27
gb|CK163846.1|CK163846 FGAS016482 Triticum aestivum FGAS: L... 40 0.27
gb|CK166067.1|CK166067 FGAS050119 Triticum aestivum FGAS: T... 40 0.27
gb|CK199596.1|CK199596 FGAS008099 Triticum aestivum FGAS: L... 40 0.27
gb|CK199941.1|CK199941 FGAS008448 Triticum aestivum FGAS: L... 40 0.27
gb|CK200679.1|CK200679 FGAS009195 Triticum aestivum FGAS: L... 40 0.27
gb|CK214889.1|CK214889 FGAS026830 Triticum aestivum FGAS: L... 40 0.27
gb|CK216244.1|CK216244 FGAS028231 Triticum aestivum FGAS: L... 40 0.27
gb|CV759339.1|CV759339 FGAS053722 Triticum aestivum FGAS: L... 40 0.27
gb|CV761700.1|CV761700 FGAS056088 Triticum aestivum FGAS: L... 40 0.27
gb|CV766608.1|CV766608 FGAS060995 Triticum aestivum FGAS: L... 40 0.27
gb|CV771150.1|CV771150 FGAS065543 Triticum aestivum FGAS: L... 40 0.27
gb|CV774076.1|CV774076 FGAS068473 Triticum aestivum FGAS: L... 40 0.27
gb|DR740023.1|DR740023 FGAS000290 Triticum aestivum FGAS: L... 40 0.27
>gb|CA632791.1|CA632791 wle1n.pk0057.f4 wle1n Triticum aestivum cDNA clone wle1n.pk0057.f4
5' end, mRNA sequence
Length = 585
Score = 220 bits (111), Expect = 1e-055
Identities = 227/265 (85%), Gaps = 3/265 (1%)
Strand = Plus / Minus
Query: 330 acggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacggagatg 386
|||||||||||||||| ||||||||| || ||| |||| |||||||||| || || |
Sbjct: 346 acggcgcagccgcagtcgttgacgagcagctggagggcgagcggcacgtagagggcgagg 287
Query: 387 tcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccggcgatg 446
| ||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||
Sbjct: 286 ttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccggcgatg 227
Query: 447 cccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgaga 506
|||| ||||||||||||||||| |||| |||||||||||| ||||| |||||| |||||
Sbjct: 226 ccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgcagctcgttgccgagc 167
Query: 507 acgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgtg 566
| ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||| ||||||
Sbjct: 166 aggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggagggcgtg 107
Query: 567 ggcgtgggtgtcggcgtcgggggag 591
|| | || || |||||||||||||
Sbjct: 106 gggctcggcgtgggcgtcgggggag 82
>gb|BF474170.1|BF474170 WHE0838_H10_O20ZS Wheat vernalized crown cDNA library Triticum
aestivum cDNA clone WHE0838_H10_O20, mRNA sequence
Length = 478
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 310 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 251
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||| ||||| ||||||||||| ||||
Sbjct: 250 cgtagagggcgaggttgagcaccttggccttgatggccgtgcagaggcacgccgcggcgg 191
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 190 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgca 131
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 130 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 71
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 70 cggaggagggcgtggg 55
>gb|BQ166189.1|BQ166189 WHE0821-0824_J05_J05ZT Wheat vernalized crown cDNA library Triticum
aestivum cDNA clone WHE0821-0824_J05_J05, mRNA sequence
Length = 441
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 170 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 229
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||| | ||||
Sbjct: 230 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccacggcgg 289
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 290 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 349
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| ||||||||||
Sbjct: 350 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacttgt 409
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 410 cggaggagggcgtggg 425
>gb|CK205741.1|CK205741 FGAS017274 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1077
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 260 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 319
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 320 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 379
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 380 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 439
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| || || | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 440 gctcgttgcccagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 499
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 500 cggaggagggcgtggg 515
>gb|CK205755.1|CK205755 FGAS017293 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1065
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 288 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 347
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||| ||||| ||||||||||| ||||
Sbjct: 348 cgtagagggcgaggttgagcaccttggccttgatggccgtgcagaggcacgccgcggcgg 407
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 408 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgca 467
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 468 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 527
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 528 cggaggagggcgtggg 543
>gb|CK211638.1|CK211638 FGAS023490 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1162
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 297 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 356
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 357 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 416
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 417 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 476
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| || || | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 477 gctcgttgcccagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 536
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 537 cggaggagggcgtggg 552
>gb|CK215255.1|CK215255 FGAS027210 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 746
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 309 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 368
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||| ||||| ||||||||||| ||||
Sbjct: 369 cgtagagggcgaggttgagcaccttggccttgatggccgtgcagaggcacgccgcggcgg 428
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 429 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgca 488
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 489 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 548
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 549 cggaggagggcgtggg 564
>gb|AJ612274.1|AJ612274 AJ612274 Triticum turgidum subsp. durum etiolated seedling 20 day
Triticum turgidum subsp. durum cDNA clone 06483R, mRNA
sequence
Length = 722
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 325 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 266
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 265 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 206
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 205 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 146
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 145 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 86
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 85 cggaggagggcgtggg 70
>gb|DN828829.1|DN828829 KUCD01_12_C12_T3 WSWR cDNA library Triticum aestivum cDNA, mRNA
sequence
Length = 635
Score = 210 bits (106), Expect = 1e-052
Identities = 219/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 467 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 408
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 407 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 348
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 347 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 288
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 287 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 228
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 227 cggaggagggcgtggg 212
>gb|CA632990.1|CA632990 wle1n.pk0064.h8 wle1n Triticum aestivum cDNA clone wle1n.pk0064.h8
5' end, mRNA sequence
Length = 544
Score = 206 bits (104), Expect = 2e-051
Identities = 227/266 (85%), Gaps = 4/266 (1%)
Strand = Plus / Minus
Query: 330 acggcgcagccgcagt---tgacg-agcacctcgagcgcgatgggcacgtagacggagat 385
|||||||||||||||| ||||| |||| || ||| |||| |||||||||| || ||
Sbjct: 270 acggcgcagccgcagtcgttgacggagcagctggagggcgagcggcacgtagagggcgag 211
Query: 386 gtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccggcgat 445
|| ||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||
Sbjct: 210 gttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtgagcccggcgat 151
Query: 446 gcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgag 505
||||| ||||||||||||||||| |||| |||||||||||| ||||| |||||| |||||
Sbjct: 150 gccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgcagctcgttgccgag 91
Query: 506 aacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgt 565
| ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||| |||||
Sbjct: 90 caggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggagggcgt 31
Query: 566 gggcgtgggtgtcggcgtcgggggag 591
||| | || || |||||||||||||
Sbjct: 30 ggggctcggcgtgggcgtcgggggag 5
>gb|CK216334.1|CK216334 FGAS028322 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1075
Score = 206 bits (104), Expect = 2e-051
Identities = 208/242 (85%), Gaps = 3/242 (1%)
Strand = Plus / Plus
Query: 330 acggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacgtagacggagatg 386
|||||||||||||||| ||||||||| || ||| |||| |||||||||| || || |
Sbjct: 292 acggcgcagccgcagtcgttgacgagcagctggagggcgagcggcacgtagagggcgagg 351
Query: 387 tcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccggcgatg 446
| ||||||||||||||||||||| ||||| ||||||||||| |||| |||||||||||||
Sbjct: 352 ttgagcaccttggccttgatggccgtgcagaggcacgccgcggcggtgagcccggcgatg 411
Query: 447 cccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgaga 506
|||| ||||||||||||||||| |||| |||||||||||| ||||| |||||| |||||
Sbjct: 412 ccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgcagctcgttgccgagc 471
Query: 507 acgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgtg 566
| ||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||| ||||||
Sbjct: 472 aggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggagggcgtg 531
Query: 567 gg 568
||
Sbjct: 532 gg 533
>gb|CA632470.1|CA632470 wle1n.pk0059.d5 wle1n Triticum aestivum cDNA clone wle1n.pk0059.d5
5' end, mRNA sequence
Length = 610
Score = 204 bits (103), Expect = 8e-051
Identities = 218/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| || |
Sbjct: 367 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggna 308
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 307 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 248
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 247 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 188
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 187 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 128
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 127 cggaggagggcgtggg 112
>gb|BE426495.1|BE426495 WHE0335_A07_B13ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0335_A07_B13, mRNA
sequence
Length = 534
Score = 202 bits (102), Expect = 3e-050
Identities = 218/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 353 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 294
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||| | ||||
Sbjct: 293 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccacggcgg 234
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 233 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 174
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 173 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 114
Query: 553 ccgaggacggcgtggg 568
| ||||| ||||||||
Sbjct: 113 cggaggagggcgtggg 98
>gb|CD927124.1|CD927124 GR45.100P10R010607 GR45 Triticum aestivum cDNA clone GR45100P10,
mRNA sequence
Length = 530
Score = 202 bits (102), Expect = 3e-050
Identities = 218/256 (85%), Gaps = 3/256 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 262 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 321
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 322 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 381
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 382 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 441
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| || || | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 442 gctcgttgcccagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 501
Query: 553 ccgaggacggcgtggg 568
| || |||||||||||
Sbjct: 502 cggatgacggcgtggg 517
>gb|BJ212732.1|BJ212732 BJ212732 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum
cDNA clone wh18n13 5', mRNA sequence
Length = 451
Score = 200 bits (101), Expect = 1e-049
Identities = 211/247 (85%), Gaps = 3/247 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 272 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 213
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||| ||||| ||||||||||| ||||
Sbjct: 212 cgtagagggcgaggttgagcaccttggccttgatggccgtgcagaggcacgccgcggcgg 153
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 152 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgca 93
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 92 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 33
Query: 553 ccgagga 559
| |||||
Sbjct: 32 cggagga 26
>gb|CA635983.1|CA635983 wle1n.pk0100.b8 wle1n Triticum aestivum cDNA clone wle1n.pk0100.b8
5' end, mRNA sequence
Length = 519
Score = 200 bits (101), Expect = 1e-049
Identities = 194/225 (86%)
Strand = Plus / Minus
Query: 344 gttgacgagcacctcgagcgcgatgggcacgtagacggagatgtcgagcaccttggcctt 403
||||||||||| || ||| |||| |||||||||| | || || |||||||||||||||
Sbjct: 367 gttgacgagcagctggagggcgagcggcacgtagagcgcgaggttgagcaccttggcctt 308
Query: 404 gatggcggtgcaaaggcacgccgccgcggagagcccggcgatgcccttcacgagcgggca 463
|||||||||||| ||||||||||| |||| ||||||||||||||||| ||||||||||||
Sbjct: 307 gatggcggtgcagaggcacgccgcggcggtgagcccggcgatgccctgcacgagcgggca 248
Query: 464 gcactggacgttggcgtcgccgacgtgcacctcgttcccgagaacgtccacgcaggcgcc 523
||||| |||| |||||||||||| ||||| |||||| ||||| | ||||| ||| ||||
Sbjct: 247 gcacttgacgctggcgtcgccgatgtgcagctcgttgccgagcaggtccaggcacacgcc 188
Query: 524 gagcttgagcgcgtcgatggggcacttgtccgaggacggcgtggg 568
||||| |||| |||||| |||||| |||| ||||| ||||||||
Sbjct: 187 cagcttcagcgtgtcgatcgggcacgtgtcggaggagggcgtggg 143
>gb|CK212819.1|CK212819 FGAS024708 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1036
Score = 200 bits (101), Expect = 1e-049
Identities = 235/279 (84%), Gaps = 3/279 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 362 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 421
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||| ||||| ||||
Sbjct: 422 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcaggccgcggcgg 481
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||| ||||||||||||| |||| |||||||||||| |||||
Sbjct: 482 tgagcccggcgatgccctgcaccagcgggcagcacttgacgctggcgtcgccgatgtgca 541
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 542 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 601
Query: 553 ccgaggacggcgtgggcgtgggtgtcggcgtcgggggag 591
| || || |||||||| | || || |||||||||||||
Sbjct: 602 cggatgagggcgtggggctcggcgtgggcgtcgggggag 640
>gb|CK213960.1|CK213960 FGAS025875 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1021
Score = 200 bits (101), Expect = 1e-049
Identities = 235/279 (84%), Gaps = 3/279 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 353 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 412
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||| | || || || ||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 413 cgtaaagggcgaggttgagcaccttggccttgatggcggtgcaaaggcaggccgcggcgg 472
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||| ||||||||||||| |||| |||||||||||| |||||
Sbjct: 473 tgagcccggcgatgccctgcaccagcgggcagcacttgacgctggcgtcgccgatgtgca 532
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 533 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 592
Query: 553 ccgaggacggcgtgggcgtgggtgtcggcgtcgggggag 591
| || || |||||||| | || || |||||||||||||
Sbjct: 593 cggatgagggcgtggggctcggcgtgggcgtcgggggag 631
>gb|BE425565.1|BE425565 WHE0317_G12_G12ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0317_G12_G12, mRNA
sequence
Length = 485
Score = 196 bits (99), Expect = 2e-048
Identities = 206/241 (85%), Gaps = 3/241 (1%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 245 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 304
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||| | || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 305 cgtaaagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 364
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 365 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgca 424
Query: 493 cctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgt 552
|||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| |||
Sbjct: 425 gctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgt 484
Query: 553 c 553
|
Sbjct: 485 c 485
>gb|CA633207.1|CA633207 wle1n.pk0068.d9 wle1n Triticum aestivum cDNA clone wle1n.pk0068.d9
5' end, mRNA sequence
Length = 630
Score = 192 bits (97), Expect = 3e-047
Identities = 233/277 (84%), Gaps = 4/277 (1%)
Strand = Plus / Minus
Query: 318 tagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggcacg 374
||||| || || |||||||||||||||| ||||||||| | ||| |||| |||||
Sbjct: 432 tagcccgggggnacggcgcagccgcagtngttgacgagcagttggagggcgagcggcacn 373
Query: 375 tagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcggag 434
|||| || || || ||||||||||||||||||||||||||| ||||||||||| |||| |
Sbjct: 372 tagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcggtg 313
Query: 435 agcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacc 494
||||||||||| |||| ||||||||||||||||| |||| |||||||||||| ||||| |
Sbjct: 312 agcccggcgat-ccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgcagc 254
Query: 495 tcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtcc 554
||||| ||||| | ||||| ||| |||| ||||| |||| |||||| |||||| ||||
Sbjct: 253 tcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcg 194
Query: 555 gaggacggcgtgggcgtgggtgtcggcgtcgggggag 591
||||| |||||||| | || || |||||||||||||
Sbjct: 193 gaggagggcgtggggctcggcgtgggcgtcgggggag 157
>gb|CA632661.1|CA632661 wle1n.pk0060.b5 wle1n Triticum aestivum cDNA clone wle1n.pk0060.b5
5' end, mRNA sequence
Length = 582
Score = 190 bits (96), Expect = 1e-046
Identities = 174/200 (87%)
Strand = Plus / Minus
Query: 369 ggcacgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgcc 428
|||||||||| || || || ||||||||||||||||||||| ||||| |||||||||||
Sbjct: 304 ggcacgtagagggcgaggttgagcaccttggccttgatggccgtgcagaggcacgccgcg 245
Query: 429 gcggagagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacg 488
|||| ||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |
Sbjct: 244 gcggtgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatg 185
Query: 489 tgcacctcgttcccgagaacgtccacgcaggcgccgagcttgagcgcgtcgatggggcac 548
|||| |||||| ||||| | ||||| ||| |||| ||||| |||| |||||| ||||||
Sbjct: 184 tgcagctcgttgccgagcaggtccaggcacacgcccagcttcagcgtgtcgatcgggcac 125
Query: 549 ttgtccgaggacggcgtggg 568
|||| ||||| ||||||||
Sbjct: 124 gtgtcggaggagggcgtggg 105
>gb|CK211601.1|CK211601 FGAS023453 Triticum aestivum FGAS: Library 6 CAP GATE 1 Triticum
aestivum cDNA, mRNA sequence
Length = 1178
Score = 190 bits (96), Expect = 1e-046
Identities = 210/248 (84%)
Strand = Plus / Plus
Query: 344 gttgacgagcacctcgagcgcgatgggcacgtagacggagatgtcgagcaccttggcctt 403
||||||||||| || ||| |||| |||||||||| || || || |||||||||||||||
Sbjct: 287 gttgacgagcagctggagggcgagcggcacgtagagggcgaggttgagcaccttggcctt 346
Query: 404 gatggcggtgcaaaggcacgccgccgcggagagcccggcgatgcccttcacgagcgggca 463
|||||||||||| ||||| ||||| |||| ||||||||||||||||| ||| ||||||||
Sbjct: 347 gatggcggtgcagaggcaggccgcggcggtgagcccggcgatgccctgcaccagcgggca 406
Query: 464 gcactggacgttggcgtcgccgacgtgcacctcgttcccgagaacgtccacgcaggcgcc 523
||||| |||| |||||||||||| ||||| |||||| ||||| | ||||| ||| ||||
Sbjct: 407 gcacttgacgctggcgtcgccgatgtgcagctcgttgccgagcaggtccaggcacacgcc 466
Query: 524 gagcttgagcgcgtcgatggggcacttgtccgaggacggcgtgggcgtgggtgtcggcgt 583
||||| |||| |||||| |||||| |||| || || |||||||| | || || |||||
Sbjct: 467 cagcttcagcgtgtcgatcgggcacgtgtcggatgagggcgtggggctcggcgtgggcgt 526
Query: 584 cgggggag 591
||||||||
Sbjct: 527 cgggggag 534
>gb|BF201756.1|BF201756 WHE1765_C04_F07ZS Wheat pre-anthesis spike cDNA library Triticum
aestivum cDNA clone WHE1765_C04_F07, mRNA sequence
Length = 408
Score = 188 bits (95), Expect = 5e-046
Identities = 169/193 (87%), Gaps = 3/193 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 213 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 154
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 153 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 94
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 93 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgca 34
Query: 493 cctcgttcccgag 505
|||||| |||||
Sbjct: 33 gctcgttgccgag 21
>gb|CK205414.1|CK205414 FGAS016898 Triticum aestivum FGAS: Library 5 GATE 7 Triticum
aestivum cDNA, mRNA sequence
Length = 1065
Score = 188 bits (95), Expect = 5e-046
Identities = 209/247 (84%)
Strand = Plus / Plus
Query: 345 ttgacgagcacctcgagcgcgatgggcacgtagacggagatgtcgagcaccttggccttg 404
|||||||||| || ||| |||| |||||||||| || || || ||||||||||||||||
Sbjct: 280 ttgacgagcagctggagggcgagcggcacgtagagggcgaggttgagcaccttggccttg 339
Query: 405 atggcggtgcaaaggcacgccgccgcggagagcccggcgatgcccttcacgagcgggcag 464
||||||||||| ||||| ||||| |||| ||||||||||||||||| ||| |||||||||
Sbjct: 340 atggcggtgcagaggcaggccgcggcggtgagcccggcgatgccctgcaccagcgggcag 399
Query: 465 cactggacgttggcgtcgccgacgtgcacctcgttcccgagaacgtccacgcaggcgccg 524
|||| |||| |||||||||||| ||||| |||||| ||||| | ||||| ||| ||||
Sbjct: 400 cacttgacgctggcgtcgccgatgtgcagctcgttgccgagcaggtccaggcacacgccc 459
Query: 525 agcttgagcgcgtcgatggggcacttgtccgaggacggcgtgggcgtgggtgtcggcgtc 584
||||| |||| |||||| |||||| |||| || || |||||||| | || || ||||||
Sbjct: 460 agcttcagcgtgtcgatcgggcacgtgtcggatgagggcgtggggctcggcgtgggcgtc 519
Query: 585 gggggag 591
|||||||
Sbjct: 520 gggggag 526
>gb|AJ716838.1|AJ716838 AJ716838 Triticum turgidum subsp. durum etiolated seedling 20 days
Triticum turgidum subsp. durum cDNA clone 06766R, mRNA
sequence
Length = 553
Score = 184 bits (93), Expect = 8e-045
Identities = 158/180 (87%)
Strand = Plus / Minus
Query: 389 gagcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccggcgatgcc 448
||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||
Sbjct: 532 gagcaccttggccttgatggcggtgcagaggcacgccgcgncggtgagcccggcgatgcc 473
Query: 449 cttcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgagaac 508
|| ||||||||||||||||| |||| |||||||||||| ||||| |||||| ||||| |
Sbjct: 472 ctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgcagctcgttgccgagcag 413
Query: 509 gtccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgtggg 568
||||| ||| |||| ||||| |||| |||||| |||||| |||| ||||| ||||||||
Sbjct: 412 gtccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggagggcgtggg 353
>gb|CA635692.1|CA635692 wle1n.pk0103.f1 wle1n Triticum aestivum cDNA clone wle1n.pk0103.f1
5' end, mRNA sequence
Length = 484
Score = 180 bits (91), Expect = 1e-043
Identities = 168/193 (87%), Gaps = 3/193 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 203 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 144
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 143 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 84
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 83 tgagcccggcgatgccctgcacgagcgggcagcacttgacgctggcgtcgccgatgtgca 24
Query: 493 cctcgttcccgag 505
|||||| |||||
Sbjct: 23 gctcgttgccgag 11
>gb|CA631750.1|CA631750 wle1n.pk0047.a10 wle1n Triticum aestivum cDNA clone
wle1n.pk0047.a10 5' end, mRNA sequence
Length = 469
Score = 178 bits (90), Expect = 5e-043
Identities = 158/180 (87%), Gaps = 3/180 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 182 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 123
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 122 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 63
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgccgacgtgca 492
||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |||||
Sbjct: 62 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgccgatgtgca 3
>gb|BE489943.1|BE489943 WHE0363_F03_K05ZS Wheat cold-stressed seedling cDNA library
Triticum aestivum cDNA clone WHE0363_F03_K05, mRNA
sequence
Length = 414
Score = 170 bits (86), Expect = 1e-040
Identities = 151/172 (87%), Gaps = 3/172 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 172 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 113
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 112 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 53
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacgttggcgtcgcc 484
||||||||||||||||| ||||||||||||||||| |||| ||||||||||
Sbjct: 52 tgagcccggcgatgccctccacgagcgggcagcacttgacgctggcgtcgcc 1
>gb|CA632419.1|CA632419 wle1n.pk0056.f11 wle1n Triticum aestivum cDNA clone
wle1n.pk0056.f11 5' end, mRNA sequence
Length = 479
Score = 167 bits (84), Expect = 2e-039
Identities = 168/194 (86%), Gaps = 4/194 (2%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 204 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 145
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 144 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 85
Query: 433 agagcccggcgatgcccttcac-gagcgggcagcactggacgttggcgtcgccgacgtgc 491
||||||||||||||||| ||| |||||||||||||| |||| |||||||||||| ||||
Sbjct: 84 tgagcccggcgatgccctgcacggagcgggcagcacttgacgctggcgtcgccgatgtgc 25
Query: 492 acctcgttcccgag 505
| |||||| |||||
Sbjct: 24 agctcgttgccgag 11
>gb|CA630109.1|CA630109 wle1n.pk0014.f12 wle1n Triticum aestivum cDNA clone
wle1n.pk0014.f12 5' end, mRNA sequence
Length = 270
Score = 165 bits (83), Expect = 7e-039
Identities = 171/201 (85%)
Strand = Plus / Minus
Query: 391 gcaccttggccttgatggcggtgcaaaggcacgccgccgcggagagcccggcgatgccct 450
||||| ||||| |||| |||||||| ||||||||||| |||| ||||||||||||||||
Sbjct: 201 gcaccctggccctgatngcggtgcagaggcacgccgcggcggtnagcccggcgatgccct 142
Query: 451 tcacgagcgggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgagaacgt 510
||||||||||||||||| |||| |||||||||||| ||||| |||||| ||||| | ||
Sbjct: 141 ccacgagcgggcagcacttgacgctggcgtcgccgatgtgcagctcgttgccgagcaggt 82
Query: 511 ccacgcaggcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgtgggcg 570
||| ||| |||| ||||| |||| |||||| |||||| |||| ||||| ||||||||
Sbjct: 81 ccaggcacacgcccagcttcagcgtgtcgatcgggcacgtgtcggaggagggcgtggggc 22
Query: 571 tgggtgtcggcgtcgggggag 591
| || || |||||||||||||
Sbjct: 21 tcggcgtgggcgtcgggggag 1
>gb|CA636678.1|CA636678 wle1n.pk0111.b3 wle1n Triticum aestivum cDNA clone wle1n.pk0111.b3
5' end, mRNA sequence
Length = 372
Score = 165 bits (83), Expect = 7e-039
Identities = 165/193 (85%)
Strand = Plus / Minus
Query: 399 gccttgatggcggtgcaaaggcacgccgccgcggagagcccggcgatgcccttcacgagc 458
|||||||||||| |||| ||||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 327 gccttgatggcgntgcagaggcacgccgcggcgntgagcccggcgatgccctccacgagc 268
Query: 459 gggcagcactggacgttggcgtcgccgacgtgcacctcgttcccgagaacgtccacgcag 518
|||||||||| |||| |||||||||||| ||||| |||||| ||||| | ||||| |||
Sbjct: 267 gggcagcacttgacgctggcgtcgccgatgtgcagctcgttgccgagcaggtccaggcac 208
Query: 519 gcgccgagcttgagcgcgtcgatggggcacttgtccgaggacggcgtgggcgtgggtgtc 578
|||| ||||| |||| |||||| |||||| |||| ||||| |||||||| | || ||
Sbjct: 207 acgcccagcttcagcgtgtcgatcgggcacgtgtcggaggagggcgtggggctcggcgtg 148
Query: 579 ggcgtcgggggag 591
|||||||||||||
Sbjct: 147 ggcgtcgggggag 135
>gb|CA635089.1|CA635089 wle1n.pk0092.f6 wle1n Triticum aestivum cDNA clone wle1n.pk0092.f6
5' end, mRNA sequence
Length = 539
Score = 157 bits (79), Expect = 2e-036
Identities = 141/161 (87%), Gaps = 3/161 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 162 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 103
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 102 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 43
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacg 473
||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 42 tgagcccggcgatgccctccacgagcgggcagcacttgacg 2
>gb|CA630582.1|CA630582 wle1n.pk0034.g9 wle1n Triticum aestivum cDNA clone wle1n.pk0034.g9
5' end, mRNA sequence
Length = 471
Score = 155 bits (78), Expect = 7e-036
Identities = 137/156 (87%), Gaps = 3/156 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 157 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 98
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 97 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 38
Query: 433 agagcccggcgatgcccttcacgagcgggcagcact 468
||||||||||||||||| |||||||||||||||||
Sbjct: 37 tgagcccggcgatgccctccacgagcgggcagcact 2
>gb|CA631586.1|CA631586 wle1n.pk0046.h11 wle1n Triticum aestivum cDNA clone
wle1n.pk0046.h11 5' end, mRNA sequence
Length = 478
Score = 147 bits (74), Expect = 2e-033
Identities = 186/223 (83%), Gaps = 4/223 (1%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 225 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 166
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
||| || || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 165 cgtngagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 106
Query: 433 agagcccggcgatgcccttcacgagcgggcagcactggacg-ttggcgtcgccgacgtgc 491
||||||||||||||||| |||||||| |||||||| ||| ||| |||||||| ||||
Sbjct: 105 tgagcccggcgatgccctccacgagcgngcagcacttnacgcntggagtcgccgatgtgc 46
Query: 492 acctcgttcccgagaacgtccacgcaggcgccgagcttgagcg 534
| ||||| ||||| | ||||| ||| |||| ||||| ||||
Sbjct: 45 agntcgttgccgagcaggtccaggcacacgcccagcttcagcg 3
>gb|CA635487.1|CA635487 wle1n.pk0101.c1 wle1n Triticum aestivum cDNA clone wle1n.pk0101.c1
5' end, mRNA sequence
Length = 405
Score = 119 bits (60), Expect = 4e-025
Identities = 119/138 (86%), Gaps = 3/138 (2%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 142 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 83
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 82 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 23
Query: 433 agagcccggcgatgccct 450
|||||||||||||||||
Sbjct: 22 tgagcccggcgatgccct 5
>gb|BE425792.1|BE425792 WHE0337_C06_C06ZS Wheat unstressed seedling shoot cDNA library
Triticum aestivum cDNA clone WHE0337_C06_C06, mRNA
sequence
Length = 419
Score = 113 bits (57), Expect = 2e-023
Identities = 102/117 (87%)
Strand = Plus / Plus
Query: 344 gttgacgagcacctcgagcgcgatgggcacgtagacggagatgtcgagcaccttggcctt 403
||||||||||| || ||| |||| |||||||| | || || || |||||||||||||||
Sbjct: 303 gttgacgagcagctggagggcgagcggcacgtaaagggcgaggttgagcaccttggcctt 362
Query: 404 gatggcggtgcaaaggcacgccgccgcggagagcccggcgatgcccttcacgagcgg 460
||||| |||||||| ||||||||| |||| ||||||||||||||||| |||||||||
Sbjct: 363 gatgggggtgcaaaagcacgccgcggcggtgagcccggcgatgccctccacgagcgg 419
>gb|CA633956.1|CA633956 wle1n.pk0079.b4 wle1n Triticum aestivum cDNA clone wle1n.pk0079.b4
5' end, mRNA sequence
Length = 391
Score = 111 bits (56), Expect = 9e-023
Identities = 112/130 (86%), Gaps = 3/130 (2%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 130 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 71
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| || || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 70 cgtagagggcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 11
Query: 433 agagcccggc 442
|||||||||
Sbjct: 10 tgagcccggc 1
>gb|CA645675.1|CA645675 wre1n.pk0099.f9 wre1n Triticum aestivum cDNA clone wre1n.pk0099.f9
5' end, mRNA sequence
Length = 406
Score = 103 bits (52), Expect = 2e-020
Identities = 111/130 (85%), Gaps = 3/130 (2%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 130 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 71
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 70 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 11
Query: 433 agagcccggc 442
|||||||||
Sbjct: 10 tgagcccggc 1
>gb|CA632351.1|CA632351 wle1n.pk0056.d3 wle1n Triticum aestivum cDNA clone wle1n.pk0056.d3
5' end, mRNA sequence
Length = 357
Score = 91.7 bits (46), Expect = 8e-017
Identities = 102/120 (85%), Gaps = 3/120 (2%)
Strand = Plus / Minus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 121 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 62
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgcaaaggcacgccgccgcgg 432
|||||| | || || ||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 61 cgtagagcgcgaggttgagcaccttggccttgatggcggtgcagaggcacgccgcggcgg 2
>gb|BJ227584.1|BJ227584 BJ227584 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl14o23 3', mRNA sequence
Length = 312
Score = 81.8 bits (41), Expect = 8e-014
Identities = 88/103 (85%), Gaps = 3/103 (2%)
Strand = Plus / Plus
Query: 316 tgtagcctggcgggacggcgcagccgcagt---tgacgagcacctcgagcgcgatgggca 372
||||||| || || |||||||||||||||| ||||||||| || ||| |||| ||||
Sbjct: 206 tgtagcccgggggcacggcgcagccgcagtcgttgacgagcagctggagggcgagcggca 265
Query: 373 cgtagacggagatgtcgagcaccttggccttgatggcggtgca 415
|||||| || || || |||||||||||||||||||||||||||
Sbjct: 266 cgtagagggcgaggttgagcaccttggccttgatggcggtgca 308
>gb|BJ225024.1|BJ225024 BJ225024 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl20e24 5', mRNA sequence
Length = 590
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 306 cgagcacgttggccttgatggcggtgcaaaggca 273
>gb|BJ229823.1|BJ229823 BJ229823 Y. Ogihara unpublished cDNA library, Wh_dL Triticum
aestivum cDNA clone whdl20e24 3', mRNA sequence
Length = 566
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 251 cgagcacgttggccttgatggcggtgcaaaggca 284
>gb|BJ278952.1|BJ278952 BJ278952 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr18h23 5', mRNA sequence
Length = 599
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 315 cgagcacgttggccttgatggcggtgcaaaggca 282
>gb|BJ280435.1|BJ280435 BJ280435 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr8c18 5', mRNA sequence
Length = 469
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 244 cgagcacgttggccttgatggcggtgcaaaggca 211
>gb|BJ282124.1|BJ282124 BJ282124 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr25e09 5', mRNA sequence
Length = 624
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 339 cgagcacgttggccttgatggcggtgcaaaggca 306
>gb|BJ284004.1|BJ284004 BJ284004 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr18h23 3', mRNA sequence
Length = 559
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 245 cgagcacgttggccttgatggcggtgcaaaggca 278
>gb|BJ285422.1|BJ285422 BJ285422 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr8c18 3', mRNA sequence
Length = 553
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 239 cgagcacgttggccttgatggcggtgcaaaggca 272
>gb|BJ287247.1|BJ287247 BJ287247 Y. Ogihara unpublished cDNA library, Wh_r Triticum
aestivum cDNA clone whr25e09 3', mRNA sequence
Length = 565
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 251 cgagcacgttggccttgatggcggtgcaaaggca 284
>gb|AL826234.1|AL826234 AL826234 p:436 Triticum aestivum cDNA clone G03_p436_plate_7, mRNA
sequence
Length = 538
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 332 cgagcacgttggccttgatggcggtgcaaaggca 299
>gb|AL828240.1|AL828240 AL828240 p:436 Triticum aestivum cDNA clone H07_p436_plate_12, mRNA
sequence
Length = 483
Score = 60.0 bits (30), Expect = 3e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 388 cgagcaccttggccttgatggcggtgcaaaggca 421
||||||| ||||||||||||||||||||||||||
Sbjct: 328 cgagcacgttggccttgatggcggtgcaaaggca 295
Database: Triticum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 3:01 PM
Number of letters in database: 367,240,239
Number of sequences in database: 636,343
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 253,210
Number of Sequences: 636343
Number of extensions: 253210
Number of successful extensions: 71888
Number of sequences better than 0.5: 234
Number of HSP's better than 0.5 without gapping: 228
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 71416
Number of HSP's gapped (non-prelim): 431
length of query: 959
length of database: 367,240,239
effective HSP length: 20
effective length of query: 939
effective length of database: 354,513,379
effective search space: 332888062881
effective search space used: 332888062881
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)