BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCN21e10.yg.2.1
(247 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW513921.1|CW513921 115_5_10512125_1_30022 Sorghum unfil... 418 e-116
gb|CW473573.1|CW473573 fsbb001f229a03k0 Sorghum methylation... 58 4e-007
gb|CW243716.1|CW243716 104_704_11220201_116_37577_041 Sorgh... 50 9e-005
gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from ... 44 0.006
gb|BZ341519.1|BZ341519 ic45h08.g1 WGS-SbicolorF (JM107 adap... 42 0.023
gb|CW047637.1|CW047637 104_285_10512819_115_30217 Sorghum m... 42 0.023
gb|CW378881.1|CW378881 fsbb001f057n17f0 Sorghum methylation... 42 0.023
gb|CW378882.1|CW378882 fsbb001f057n17k0 Sorghum methylation... 42 0.023
gb|CW883673.1|CW883673 Sorghum CISP Intron:I00_X00_F_PRSC1_... 40 0.089
gb|CW883674.1|CW883674 Sorghum CISP Intron:I00_X00_F_PRSC1_... 40 0.089
gb|CW884310.1|CW884310 Sorghum CISP Intron:I00_X00_F_PRSC1_... 40 0.089
gb|CW884311.1|CW884311 Sorghum CISP Intron:I00_X00_F_PRSC1_... 40 0.089
gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library fro... 40 0.089
gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-respon... 40 0.089
gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-resp... 40 0.089
gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 40 0.089
gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-respo... 40 0.089
gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 40 0.089
gb|CL188009.1|CL188009 104_404_10901291_116_32446_046 Sorgh... 36 1.4
gb|CW271926.1|CW271926 104_744_11403230_148_36223_059 Sorgh... 36 1.4
gb|CL700285.2|CL700285 SP__Ba0059D17.r SP__Ba Sorghum propi... 36 1.4
gb|BG948457.1|BG948457 IP1_9_H12.b1_A002 Immature pannicle ... 36 1.4
gb|CF675667.1|CF675667 SBP Subtractive cDNA library from so... 36 1.4
gb|DR831552.2|DR831552 MT106 Sorghum bicolor greenbug-respo... 36 1.4
gb|CL180851.1|CL180851 104_391_10896315_116_31928_075 Sorgh... 34 5.5
gb|CW070136.1|CW070136 104_321_10526564_1_30090 Sorghum met... 34 5.5
gb|CW117453.1|CW117453 104_493_11107665_116_34616_039 Sorgh... 34 5.5
gb|CW241152.1|CW241152 104_700_11218610_116_37546_011 Sorgh... 34 5.5
gb|CW241153.1|CW241153 104_700_11218610_148_37541_011 Sorgh... 34 5.5
gb|CW287512.1|CW287512 104_765_11411455_116_35523_022 Sorgh... 34 5.5
gb|CW287513.1|CW287513 104_765_11411455_148_35527_022 Sorgh... 34 5.5
gb|CW340317.1|CW340317 104_841_11485737_116_36146_041 Sorgh... 34 5.5
gb|CW340318.1|CW340318 104_841_11485737_148_36147_041 Sorgh... 34 5.5
gb|CW350790.1|CW350790 fsbb001f012e09k0 Sorghum methylation... 34 5.5
gb|CW387451.1|CW387451 fsbb001f071m19k0 Sorghum methylation... 34 5.5
gb|CW427384.1|CW427384 fsbb001f139f16f0 Sorghum methylation... 34 5.5
gb|CW432451.1|CW432451 fsbb001f147c18k0 Sorghum methylation... 34 5.5
gb|CW432465.1|CW432465 fsbb001f147d01k0 Sorghum methylation... 34 5.5
gb|BG054341.1|BG054341 OV2_3_A09.b1_A002 Ovary 2 (OV2) Sorg... 34 5.5
gb|CD426461.1|CD426461 SA1_20_F02.g1_A002 Salicylic acid-tr... 34 5.5
gb|CD431915.1|CD431915 ETH1_11_B10.g1_A002 Ethylene-treated... 34 5.5
gb|CF430163.1|CF430163 PH1_26_C10.g1_A002 Phosphorous-defic... 34 5.5
gb|DV162821.1|DV162821 P2-F11 Sorghum bicolor greenbug-resp... 34 5.5
gb|DV162821.2|DV162821 P2-F11 Sorghum bicolor greenbug-resp... 34 5.5
>gb|CW513921.1|CW513921 115_5_10512125_1_30022 Sorghum unfiltered library (LibID: 115)
Sorghum bicolor genomic clone 10512125, DNA sequence
Length = 639
Score = 418 bits (211), Expect = e-116
Identities = 226/231 (97%)
Strand = Plus / Minus
Query: 17 gtactgaagtagaaaccaattgttgtgtagtaacaagacagcatcctgaagaaatcaaag 76
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288 gtactgaagtagaaaccaattgttgtgtagtaacaagacagcatcctgaagaaatcaaag 229
Query: 77 cgatgacctagccggtagatgtcacggctcagcgtttgttcgccattgccatttgctatc 136
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 228 cgatgacctagccggtagatgtcacggctcagcgtctgttcgccatttccatttgctatc 169
Query: 137 tttgcctcaaacagagatatttgattgagacctacatcccttcctttgccaacttgcatg 196
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 168 tttgcctcaaacagagatatttgattgagacccacatcccttcccttgccaacttgcatg 109
Query: 197 tattcatggtgagtaacattgccttcgcgcaatgtggaattgaatcctgca 247
|||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 108 tattcatggtgagtaacattgccttcacgcaatgtggaattgaatcctgca 58
>gb|CW473573.1|CW473573 fsbb001f229a03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f229a03, DNA
sequence
Length = 646
Score = 58.0 bits (29), Expect = 4e-007
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 140 gcctcaaacagagatatttgattgagacctacatcccttcctttgccaacttgcatgtat 199
|||||||| ||||| |||||||||||||||||||| | ||||| || ||||| |||||
Sbjct: 598 gcctcaaagagagaaatttgattgagacctacatcacgccctttccccacttggatgtac 539
Query: 200 tcatg 204
|||||
Sbjct: 538 tcatg 534
>gb|CW243716.1|CW243716 104_704_11220201_116_37577_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220201, DNA
sequence
Length = 699
Score = 50.1 bits (25), Expect = 9e-005
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 56 agcatcctgaagaaatcaaagcgatgacctagccggtagatgtcacggctcagcgtttgt 115
|||||||||||||||||||| || |||||||||||| || ||||| || | |||||
Sbjct: 575 agcatcctgaagaaatcaaatcgccgacctagccggtgaatatcacgactgattgtttgc 634
Query: 116 tcgccattgccatttgc 132
|| | ||||||||||||
Sbjct: 635 tcactattgccatttgc 651
>gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone THAU2 similar to
Thaumatin-like protein, mRNA sequence
Length = 747
Score = 44.1 bits (22), Expect = 0.006
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtactg 22
||||||||||||||||||||||
Sbjct: 211 gcggccgcccgggcaggtactg 190
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 204 gcggccgcccgggcaggtac 223
>gb|BZ341519.1|BZ341519 ic45h08.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ic45h08 5', DNA sequence
Length = 728
Score = 42.1 bits (21), Expect = 0.023
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 64 gaagaaatcaaagcgatgacctagccggtagat 96
|||||| |||||||||||||| |||| ||||||
Sbjct: 256 gaagaagtcaaagcgatgaccgagcctgtagat 224
>gb|CW047637.1|CW047637 104_285_10512819_115_30217 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10512819, DNA
sequence
Length = 504
Score = 42.1 bits (21), Expect = 0.023
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 64 gaagaaatcaaagcgatgacctagccggtagat 96
|||||| |||||||||||||| |||| ||||||
Sbjct: 265 gaagaagtcaaagcgatgaccgagcctgtagat 233
>gb|CW378881.1|CW378881 fsbb001f057n17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f057n17, DNA
sequence
Length = 812
Score = 42.1 bits (21), Expect = 0.023
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 64 gaagaaatcaaagcgatgacctagccggtagat 96
|||||| |||||||||||||| |||| ||||||
Sbjct: 694 gaagaagtcaaagcgatgaccgagcctgtagat 662
>gb|CW378882.1|CW378882 fsbb001f057n17k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f057n17, DNA
sequence
Length = 793
Score = 42.1 bits (21), Expect = 0.023
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 64 gaagaaatcaaagcgatgacctagccggtagat 96
|||||| |||||||||||||| |||| ||||||
Sbjct: 266 gaagaagtcaaagcgatgaccgagcctgtagat 298
>gb|CW883673.1|CW883673 Sorghum CISP Intron:I00_X00_F_PRSC1_001_SORG_BTXX BTXX Sorghum
bicolor genomic, DNA sequence
Length = 142
Score = 40.1 bits (20), Expect = 0.089
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 178 tcctttgccaacttgcatgtattcatggtgagtaacattgcctt 221
||||||||| | ||| ||||||||||| || |||||||| ||||
Sbjct: 130 tcctttgcccaattgtatgtattcatgatgcgtaacatttcctt 87
>gb|CW883674.1|CW883674 Sorghum CISP Intron:I00_X00_F_PRSC1_002_SORG_BTXX BTXX Sorghum
bicolor genomic, DNA sequence
Length = 509
Score = 40.1 bits (20), Expect = 0.089
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 52 agacagcatcctgaagaaatcaaa 75
||||||||||||| ||||||||||
Sbjct: 255 agacagcatcctgtagaaatcaaa 232
Score = 38.2 bits (19), Expect = 0.35
Identities = 37/43 (86%)
Strand = Plus / Minus
Query: 179 cctttgccaacttgcatgtattcatggtgagtaacattgcctt 221
|||||||| | ||| ||||||||||| || |||||||| ||||
Sbjct: 128 cctttgcccaattgtatgtattcatgatgcgtaacatttcctt 86
>gb|CW884310.1|CW884310 Sorghum CISP Intron:I00_X00_F_PRSC1_001_SORG_IS18 IS18 Sorghum
bicolor genomic, DNA sequence
Length = 141
Score = 40.1 bits (20), Expect = 0.089
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 178 tcctttgccaacttgcatgtattcatggtgagtaacattgcctt 221
||||||||| | ||| ||||||||||| || |||||||| ||||
Sbjct: 128 tcctttgcccaattgtatgtattcatgatgcgtaacatttcctt 85
>gb|CW884311.1|CW884311 Sorghum CISP Intron:I00_X00_F_PRSC1_002_SORG_IS18 IS18 Sorghum
bicolor genomic, DNA sequence
Length = 501
Score = 40.1 bits (20), Expect = 0.089
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 52 agacagcatcctgaagaaatcaaa 75
||||||||||||| ||||||||||
Sbjct: 247 agacagcatcctgtagaaatcaaa 224
Score = 38.2 bits (19), Expect = 0.35
Identities = 37/43 (86%)
Strand = Plus / Minus
Query: 179 cctttgccaacttgcatgtattcatggtgagtaacattgcctt 221
|||||||| | ||| ||||||||||| || |||||||| ||||
Sbjct: 120 cctttgcccaattgtatgtattcatgatgcgtaacatttcctt 78
>gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone RUBISCO similar to
Ribulose 1,5-biphosphate carboxylase, mRNA sequence
Length = 638
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 225 gcggccgcccgggcaggtac 244
Score = 38.2 bits (19), Expect = 0.35
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 232 gcggccgcccgggcaggta 214
>gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 112
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 2 gcggccgcccgggcaggtac 21
>gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 282
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 32 gcggccgcccgggcaggtac 51
>gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 234
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 84 gcggccgcccgggcaggtac 65
>gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 223
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 119 gcggccgcccgggcaggtac 100
>gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 172
Score = 40.1 bits (20), Expect = 0.089
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 21 gcggccgcccgggcaggtac 2
>gb|CL188009.1|CL188009 104_404_10901291_116_32446_046 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10901291, DNA
sequence
Length = 725
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 60 tcctgaagaaatcaaagc 77
||||||||||||||||||
Sbjct: 104 tcctgaagaaatcaaagc 121
>gb|CW271926.1|CW271926 104_744_11403230_148_36223_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11403230, DNA
sequence
Length = 701
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 60 tcctgaagaaatcaaagc 77
||||||||||||||||||
Sbjct: 165 tcctgaagaaatcaaagc 182
>gb|CL700285.2|CL700285 SP__Ba0059D17.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0059D17 3', DNA sequence
Length = 735
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 55 cagcatcctgaagaaatc 72
||||||||||||||||||
Sbjct: 25 cagcatcctgaagaaatc 8
>gb|BG948457.1|BG948457 IP1_9_H12.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 600
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 60 tcctgaagaaatcaaagc 77
||||||||||||||||||
Sbjct: 160 tcctgaagaaatcaaagc 177
>gb|CF675667.1|CF675667 SBP Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone SBP similar to
Selenium binding protein, mRNA sequence
Length = 847
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggt 18
||||||||||||||||||
Sbjct: 545 gcggccgcccgggcaggt 562
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggt 18
||||||||||||||||||
Sbjct: 552 gcggccgcccgggcaggt 535
>gb|DR831552.2|DR831552 MT106 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 253
Score = 36.2 bits (18), Expect = 1.4
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggt 18
||||||||||||||||||
Sbjct: 214 gcggccgcccgggcaggt 197
>gb|CL180851.1|CL180851 104_391_10896315_116_31928_075 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10896315, DNA
sequence
Length = 702
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 112 ttgttcgccattgccat 128
|||||||||||||||||
Sbjct: 224 ttgttcgccattgccat 208
>gb|CW070136.1|CW070136 104_321_10526564_1_30090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10526564, DNA
sequence
Length = 601
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 134 atctttgcctcaaacag 150
|||||||||||||||||
Sbjct: 316 atctttgcctcaaacag 300
>gb|CW117453.1|CW117453 104_493_11107665_116_34616_039 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11107665, DNA sequence
Length = 638
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 46 actgaagtagaaaccaa 30
>gb|CW241152.1|CW241152 104_700_11218610_116_37546_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11218610, DNA
sequence
Length = 587
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 466 actgaagtagaaaccaa 482
>gb|CW241153.1|CW241153 104_700_11218610_148_37541_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11218610, DNA
sequence
Length = 666
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 427 actgaagtagaaaccaa 411
>gb|CW287512.1|CW287512 104_765_11411455_116_35523_022 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11411455, DNA
sequence
Length = 588
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 202 actgaagtagaaaccaa 218
>gb|CW287513.1|CW287513 104_765_11411455_148_35527_022 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11411455, DNA
sequence
Length = 574
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 529 actgaagtagaaaccaa 513
>gb|CW340317.1|CW340317 104_841_11485737_116_36146_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11485737, DNA
sequence
Length = 638
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 112 ttgttcgccattgccat 128
|||||||||||||||||
Sbjct: 209 ttgttcgccattgccat 193
>gb|CW340318.1|CW340318 104_841_11485737_148_36147_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11485737, DNA
sequence
Length = 660
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 112 ttgttcgccattgccat 128
|||||||||||||||||
Sbjct: 587 ttgttcgccattgccat 603
>gb|CW350790.1|CW350790 fsbb001f012e09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f012e09, DNA
sequence
Length = 768
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 541 actgaagtagaaaccaa 557
>gb|CW387451.1|CW387451 fsbb001f071m19k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f071m19, DNA
sequence
Length = 516
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 134 atctttgcctcaaacag 150
|||||||||||||||||
Sbjct: 26 atctttgcctcaaacag 10
>gb|CW427384.1|CW427384 fsbb001f139f16f0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f139f16, DNA
sequence
Length = 614
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 60 tcctgaagaaatcaaag 76
|||||||||||||||||
Sbjct: 45 tcctgaagaaatcaaag 61
>gb|CW432451.1|CW432451 fsbb001f147c18k0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f147c18, DNA
sequence
Length = 689
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 71 actgaagtagaaaccaa 87
>gb|CW432465.1|CW432465 fsbb001f147d01k0 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone fsbb001f147d01, DNA
sequence
Length = 262
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 19 actgaagtagaaaccaa 35
|||||||||||||||||
Sbjct: 56 actgaagtagaaaccaa 72
>gb|BG054341.1|BG054341 OV2_3_A09.b1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA sequence
Length = 528
Score = 34.2 bits (17), Expect = 5.5
Identities = 35/41 (85%)
Strand = Plus / Minus
Query: 170 acatcccttcctttgccaacttgcatgtattcatggtgagt 210
|||||||| ||||||||||| || || || ||||| |||||
Sbjct: 421 acatccctacctttgccaacctgaatatactcatgatgagt 381
>gb|CD426461.1|CD426461 SA1_20_F02.g1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_20_F02_A002 5', mRNA sequence
Length = 694
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 60 tcctgaagaaatcaaag 76
|||||||||||||||||
Sbjct: 207 tcctgaagaaatcaaag 223
>gb|CD431915.1|CD431915 ETH1_11_B10.g1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_11_B10_A002 5', mRNA sequence
Length = 663
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 60 tcctgaagaaatcaaag 76
|||||||||||||||||
Sbjct: 604 tcctgaagaaatcaaag 620
>gb|CF430163.1|CF430163 PH1_26_C10.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_26_C10_A002 5', mRNA sequence
Length = 802
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 60 tcctgaagaaatcaaag 76
|||||||||||||||||
Sbjct: 686 tcctgaagaaatcaaag 702
>gb|DV162821.1|DV162821 P2-F11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 231
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcagg 17
|||||||||||||||||
Sbjct: 98 gcggccgcccgggcagg 114
>gb|DV162821.2|DV162821 P2-F11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 214
Score = 34.2 bits (17), Expect = 5.5
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcagg 17
|||||||||||||||||
Sbjct: 81 gcggccgcccgggcagg 97
Database: Sorghum_nucl_with_EST.fasta
Posted date: May 2, 2006 3:37 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 61,648
Number of Sequences: 832831
Number of extensions: 61648
Number of successful extensions: 17807
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17756
Number of HSP's gapped (non-prelim): 51
length of query: 247
length of database: 491,359,669
effective HSP length: 19
effective length of query: 228
effective length of database: 475,535,880
effective search space: 108422180640
effective search space used: 108422180640
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)