BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCM12h10.yg.2.1
(339 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CD428230.1|CD428230 ETH1_28_F10.g1_A002 Ethylene-treated... 327 4e-088
gb|BF657000.1|BF657000 OV2_19_G06.b1_A002 Ovary 2 (OV2) Sor... 44 0.008
gb|BG355549.1|BG355549 EM1_17_G07.b1_A002 Embryo 1 (EM1) So... 44 0.008
gb|BI643696.1|BI643696 EM1_19_F12.b1_A002 Embryo 1 (EM1) So... 44 0.008
gb|CF482724.1|CF482724 POL1_8_F04.g1_A002 Pollen Sorghum bi... 44 0.008
>gb|CD428230.1|CD428230 ETH1_28_F10.g1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_28_F10_A002 5', mRNA sequence
Length = 533
Score = 327 bits (165), Expect = 4e-088
Identities = 213/235 (90%)
Strand = Plus / Minus
Query: 1 acactgttttcaaccaatcaaaaccagannnnntaaaagcaaatggagccataatccatg 60
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||
Sbjct: 243 acactgttttcaaccaaccaaaaccagatggattaaaagcaaatggagccataatccatg 184
Query: 61 ataccaccagaaaccagctagannnnnnnnnnnntatgtaaacaagtgtattcttggcaa 120
|||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 183 ataccaccagaaaccagctagatatattcatgattatgtaaacaagtgtattcttggcaa 124
Query: 121 taacactgtgtgcagcatacacagtcaatattattccaagctctattgcctttatgaagt 180
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 123 taacactgtgtgcagcatacacagtcaatattattccaagttctattgcctttatgaagt 64
Query: 181 ggcccctagcatacagcntgtaattttcagcaaaactcttgtgctgcacaacaaa 235
||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||
Sbjct: 63 ggctcctagcatacagcctgtaattttcagcaaatctcttgtgctgcacaacaaa 9
>gb|BF657000.1|BF657000 OV2_19_G06.b1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 455
Score = 44.1 bits (22), Expect = 0.008
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 258 tttgcaccaccatgaaggattg 279
||||||||||||||||||||||
Sbjct: 357 tttgcaccaccatgaaggattg 336
>gb|BG355549.1|BG355549 EM1_17_G07.b1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 502
Score = 44.1 bits (22), Expect = 0.008
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 258 tttgcaccaccatgaaggattg 279
||||||||||||||||||||||
Sbjct: 108 tttgcaccaccatgaaggattg 87
>gb|BI643696.1|BI643696 EM1_19_F12.b1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 631
Score = 44.1 bits (22), Expect = 0.008
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 258 tttgcaccaccatgaaggattg 279
||||||||||||||||||||||
Sbjct: 108 tttgcaccaccatgaaggattg 87
>gb|CF482724.1|CF482724 POL1_8_F04.g1_A002 Pollen Sorghum bicolor cDNA clone
POL1_8_F04_A002 5', mRNA sequence
Length = 773
Score = 44.1 bits (22), Expect = 0.008
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 258 tttgcaccaccatgaaggattg 279
||||||||||||||||||||||
Sbjct: 34 tttgcaccaccatgaaggattg 13
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 62,721
Number of Sequences: 832831
Number of extensions: 62721
Number of successful extensions: 16149
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16139
Number of HSP's gapped (non-prelim): 10
length of query: 339
length of database: 491,359,669
effective HSP length: 19
effective length of query: 320
effective length of database: 475,535,880
effective search space: 152171481600
effective search space used: 152171481600
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)