BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCL28h07.yg.2.1
(277 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW414651.1|CW414651 fsbb001f114g15k0 Sorghum methylation... 436 e-121
gb|BM325000.1|BM325000 PIC1_38_E07.b1_A002 Pathogen-infecte... 60 1e-007
gb|CW173113.1|CW173113 104_584_11156668_148_36547_006 Sorgh... 58 4e-007
gb|CW243716.1|CW243716 104_704_11220201_116_37577_041 Sorgh... 56 2e-006
gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-resp... 50 1e-004
gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-respo... 50 1e-004
gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 50 1e-004
gb|CN147848.1|CN147848 WOUND1_52_D08.g1_A002 Wounded leaves... 48 4e-004
gb|DR831552.2|DR831552 MT106 Sorghum bicolor greenbug-respo... 46 0.002
gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-resp... 44 0.006
gb|DV162821.1|DV162821 P2-F11 Sorghum bicolor greenbug-resp... 44 0.006
gb|DV162821.2|DV162821 P2-F11 Sorghum bicolor greenbug-resp... 44 0.006
gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from ... 42 0.026
gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library fro... 40 0.10
gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-respon... 40 0.10
gb|CW256112.1|CW256112 104_721_11226607_148_35144_032 Sorgh... 38 0.40
>gb|CW414651.1|CW414651 fsbb001f114g15k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f114g15, DNA
sequence
Length = 636
Score = 436 bits (220), Expect = e-121
Identities = 247/256 (96%)
Strand = Plus / Minus
Query: 1 acgcaatagctcctcggtatgactgcccaaatatttcatacacaataagcaaaatcatca 60
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 266 acgcaatagctcctcggtatgactgcccaaatatttcatacacaatgagcaaaatcatca 207
Query: 61 gttcaatgcccttcacaaaatggcttcgcgaatacaatcgataattctcagcaaacttgg 120
|||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| ||||
Sbjct: 206 gttcgatgcccttcacaaaatgacttcgtgaatacaatcgatagttctcagcaaatttgg 147
Query: 121 catggaacaccacaaatccacgccctgtagctctatattcagctcctccatgtagcagcg 180
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |
Sbjct: 146 catggaagaccacaaatccacgccctgtagctctatattcagctcctccatgtaacagtg 87
Query: 181 tggttccgtagtagtgagttttggtcccaagagagaatgtgaagaacacagatgctaact 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86 tggttccgtagtagtgagttttggtcccaagagagaatgtgaagaacacagatgctaact 27
Query: 241 ggagctgcataagtac 256
||||||||||||||||
Sbjct: 26 ggagctgcataagtac 11
>gb|BM325000.1|BM325000 PIC1_38_E07.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 558
Score = 60.0 bits (30), Expect = 1e-007
Identities = 150/190 (78%)
Strand = Plus / Minus
Query: 42 acaataagcaaaatcatcagttcaatgcccttcacaaaatggcttcgcgaatacaatcga 101
||||| |||| ||||||||| ||||| || || ||||| ||||| || || || | || |
Sbjct: 382 acaatgagcagaatcatcagctcaatccctttaacaaagtggctgcgagagtagagtcta 323
Query: 102 taattctcagcaaacttggcatggaacaccacaaatccacgccctgtagctctatattca 161
|||||||| |||||||| ||||| || || |||||||| | || ||| |||| || | |
Sbjct: 322 taattctctgcaaactttgcatgaaagacgacaaatcccctaccagtacctctgtactga 263
Query: 162 gctcctccatgtagcagcgtggttccgtagtagtgagttttggtcccaagagagaatgtg 221
|| |||||||| |||| | | | || ||||||||||| || || ||||| || ||||||
Sbjct: 262 gcacctccatgaagcaacattctcccatagtagtgagtcttagtgccaagggaaaatgtg 203
Query: 222 aagaacacag 231
|| |||||||
Sbjct: 202 aaaaacacag 193
>gb|CW173113.1|CW173113 104_584_11156668_148_36547_006 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11156668, DNA
sequence
Length = 628
Score = 58.0 bits (29), Expect = 4e-007
Identities = 53/61 (86%)
Strand = Plus / Minus
Query: 99 cgataattctcagcaaacttggcatggaacaccacaaatccacgccctgtagctctatat 158
|||||||| ||||||||||| |||||| |||| || |||||||| ||||||| ||| |||
Sbjct: 97 cgataattttcagcaaactttgcatggtacacaacgaatccacggcctgtaggtctgtat 38
Query: 159 t 159
|
Sbjct: 37 t 37
>gb|CW243716.1|CW243716 104_704_11220201_116_37577_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220201, DNA
sequence
Length = 699
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 186 ccgtagtagtgagttttggtcccaagagagaatgtgaagaacacagatgctaactg 241
||||||||||| | ||| || |||||||||||||||||||| || ||||| |||||
Sbjct: 71 ccgtagtagtgtgcttttgttccaagagagaatgtgaagaaaactgatgccaactg 126
>gb|DV162795.1|DV162795 P1-M15 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 282
Score = 50.1 bits (25), Expect = 1e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 253 gtacctgcccgggcggccgctcgaa 277
|||||||||||||||||||||||||
Sbjct: 51 gtacctgcccgggcggccgctcgaa 27
>gb|DV162820.1|DV162820 P3-G6 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 223
Score = 50.1 bits (25), Expect = 1e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 253 gtacctgcccgggcggccgctcgaa 277
|||||||||||||||||||||||||
Sbjct: 100 gtacctgcccgggcggccgctcgaa 124
>gb|DV162819.2|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 172
Score = 50.1 bits (25), Expect = 1e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 253 gtacctgcccgggcggccgctcgaa 277
|||||||||||||||||||||||||
Sbjct: 2 gtacctgcccgggcggccgctcgaa 26
>gb|CN147848.1|CN147848 WOUND1_52_D08.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_52_D08_A002 5', mRNA sequence
Length = 731
Score = 48.1 bits (24), Expect = 4e-004
Identities = 42/48 (87%)
Strand = Plus / Minus
Query: 72 ttcacaaaatggcttcgcgaatacaatcgataattctcagcaaacttg 119
||||||||||||||||| | ||| | ||||| |||||||||||||||
Sbjct: 72 ttcacaaaatggcttcgagcataaatacgatagttctcagcaaacttg 25
>gb|DR831552.2|DR831552 MT106 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 253
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 255 acctgcccgggcggccgctcgaa 277
|||||||||||||||||||||||
Sbjct: 197 acctgcccgggcggccgctcgaa 219
>gb|DV162819.1|DV162819 P5-B11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 234
Score = 44.1 bits (22), Expect = 0.006
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 253 gtacctgcccgggcggccgctc 274
||||||||||||||||||||||
Sbjct: 65 gtacctgcccgggcggccgctc 86
>gb|DV162821.1|DV162821 P2-F11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 231
Score = 44.1 bits (22), Expect = 0.006
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 256 cctgcccgggcggccgctcgaa 277
||||||||||||||||||||||
Sbjct: 114 cctgcccgggcggccgctcgaa 93
>gb|DV162821.2|DV162821 P2-F11 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 214
Score = 44.1 bits (22), Expect = 0.006
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 256 cctgcccgggcggccgctcgaa 277
||||||||||||||||||||||
Sbjct: 97 cctgcccgggcggccgctcgaa 76
>gb|CF675626.1|CF675626 THAU2 Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone THAU2 similar to
Thaumatin-like protein, mRNA sequence
Length = 747
Score = 42.1 bits (21), Expect = 0.026
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 252 agtacctgcccgggcggccgc 272
|||||||||||||||||||||
Sbjct: 191 agtacctgcccgggcggccgc 211
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 253 gtacctgcccgggcggccgc 272
||||||||||||||||||||
Sbjct: 223 gtacctgcccgggcggccgc 204
>gb|CF675675.1|CF675675 RUBISCO Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone RUBISCO similar to
Ribulose 1,5-biphosphate carboxylase, mRNA sequence
Length = 638
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 253 gtacctgcccgggcggccgc 272
||||||||||||||||||||
Sbjct: 244 gtacctgcccgggcggccgc 225
Score = 38.2 bits (19), Expect = 0.40
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 254 tacctgcccgggcggccgc 272
|||||||||||||||||||
Sbjct: 214 tacctgcccgggcggccgc 232
>gb|DR831561.1|DR831561 MT14 Sorghum bicolor greenbug-responsive cDNA library Sorghum
bicolor cDNA 5', mRNA sequence
Length = 112
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 253 gtacctgcccgggcggccgc 272
||||||||||||||||||||
Sbjct: 21 gtacctgcccgggcggccgc 2
>gb|CW256112.1|CW256112 104_721_11226607_148_35144_032 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226607, DNA
sequence
Length = 678
Score = 38.2 bits (19), Expect = 0.40
Identities = 49/59 (83%)
Strand = Plus / Minus
Query: 99 cgataattctcagcaaacttggcatggaacaccacaaatccacgccctgtagctctata 157
|||||||||||||| ||||| ||||| ||| ||||| || | ||| |||||||||||
Sbjct: 245 cgataattctcagcgaacttcgcatgccgcacaacaaaccctctcccagtagctctata 187
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 67,265
Number of Sequences: 832831
Number of extensions: 67265
Number of successful extensions: 17906
Number of sequences better than 0.5: 16
Number of HSP's better than 0.5 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17886
Number of HSP's gapped (non-prelim): 20
length of query: 277
length of database: 491,359,669
effective HSP length: 19
effective length of query: 258
effective length of database: 475,535,880
effective search space: 122688257040
effective search space used: 122688257040
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)