BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCI2h07.yg.2.1
(286 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF480979.1|BF480979 FM1_15_G12.g1_A003 Floral-Induced Me... 371 e-101
gb|BG050984.1|BG050984 FM1_55_A02.b1_A003 Floral-Induced Me... 371 e-101
gb|BF481250.1|BF481250 FM1_17_E01.b1_A003 Floral-Induced Me... 260 6e-068
gb|BI140990.1|BI140990 IP1_41_G10.b1_A002 Immature pannicle... 234 3e-060
gb|CX618063.1|CX618063 GABR1_37_B05.g1_A002 GA- or brassino... 212 1e-053
gb|BG101839.1|BG101839 RHIZ2_23_A10.g1_A003 Rhizome2 (RHIZ2... 127 6e-028
gb|CN132882.1|CN132882 OX1_8_F12.g1_A002 Oxidatively-stress... 125 2e-027
gb|BG933529.1|BG933529 WS1_4_E04.b1_A002 Water-stressed 1 (... 76 2e-012
gb|CF757235.1|CF757235 DSAF1_15_D07.g1_A011 Drought-stresse... 72 3e-011
gb|CW140470.1|CW140470 104_531_11135797_116_34926_063 Sorgh... 66 2e-009
gb|CL167974.1|CL167974 104_365_10810478_114_31804_158 Sorgh... 40 0.10
gb|CL167975.1|CL167975 104_365_10810478_116_31805_158 Sorgh... 40 0.10
gb|CW031320.1|CW031320 104_259_10500738_116_30398 Sorghum m... 40 0.10
gb|CW235188.1|CW235188 104_690_11214849_116_37409_041 Sorgh... 40 0.10
gb|CW235189.1|CW235189 104_690_11214849_148_37413_041 Sorgh... 40 0.10
gb|CW315001.1|CW315001 104_805_11472128_148_35822_018 Sorgh... 40 0.10
gb|CW413531.1|CW413531 fsbb001f112l18f0 Sorghum methylation... 40 0.10
gb|BE126002.1|BE126002 DG1_60_H10.b1_A002 Dark Grown 1 (DG1... 40 0.10
gb|BE357339.1|BE357339 DG1_148_D12.g1_A002 Dark Grown 1 (DG... 40 0.10
gb|BE362248.1|BE362248 DG1_85_H01.b1_A002 Dark Grown 1 (DG1... 40 0.10
gb|BE595269.1|BE595269 PI1_48_A12.b1_A002 Pathogen induced ... 40 0.10
gb|BE598973.1|BE598973 PI1_84_A12.b1_A002 Pathogen induced ... 40 0.10
gb|BE600108.1|BE600108 PI1_79_D08.b1_A002 Pathogen induced ... 40 0.10
gb|BF420934.1|BF420934 FM1_5_B03.g1_A003 Floral-Induced Mer... 40 0.10
gb|BG240580.1|BG240580 OV1_31_F08.b1_A002 Ovary 1 (OV1) Sor... 40 0.10
gb|BM318632.1|BM318632 PI1_15_H01.b9_A002 Pathogen induced ... 40 0.10
gb|BM322368.1|BM322368 PIC1_3_H09.b1_A002 Pathogen-infected... 40 0.10
gb|BM325425.1|BM325425 PIC1_44_D07.b1_A002 Pathogen-infecte... 40 0.10
gb|CD203902.1|CD203902 HS1_2_C09.g1_A012 Heat-shocked seedl... 40 0.10
gb|CD206564.1|CD206564 HS1_23_B06.g1_A012 Heat-shocked seed... 40 0.10
gb|CD208902.1|CD208902 HS1_44_E05.g1_A012 Heat-shocked seed... 40 0.10
gb|CD209934.1|CD209934 HS1_55_A04.g1_A012 Heat-shocked seed... 40 0.10
gb|CD212347.1|CD212347 HS1_30_F08.g1_A012 Heat-shocked seed... 40 0.10
gb|CD234021.1|CD234021 SS1_5_E12.g1_A012 Salt-stressed seed... 40 0.10
gb|CD234992.1|CD234992 SS1_19_D08.g1_A012 Salt-stressed see... 40 0.10
gb|CF427627.1|CF427627 PH1_16_D09.g1_A002 Phosphorous-defic... 40 0.10
gb|CF429881.1|CF429881 PH1_25_C04.b1_A002 Phosphorous-defic... 40 0.10
gb|CF433456.1|CF433456 NIT1_27_E11.b1_A002 Nitrogen-deficie... 40 0.10
gb|CN134554.1|CN134554 OX1_27_C06.b1_A002 Oxidatively-stres... 40 0.10
gb|CX606901.1|CX606901 ANR1_5_C09.g1_A002 Anaerobic roots S... 40 0.10
gb|CX607839.1|CX607839 ANR1_31_C06.b1_A002 Anaerobic roots ... 40 0.10
gb|CX617100.1|CX617100 GABR1_31_E06.g1_A002 GA- or brassino... 40 0.10
gb|CX621700.1|CX621700 GABR1_59_D11.g1_A002 GA- or brassino... 40 0.10
gb|CX622537.1|CX622537 GABR1_64_C02.g2_A002 GA- or brassino... 40 0.10
>gb|BF480979.1|BF480979 FM1_15_G12.g1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 721
Score = 371 bits (187), Expect = e-101
Identities = 253/279 (90%)
Strand = Plus / Plus
Query: 8 gcagttttggnnnattggaggcgtgtcttcacatctctttgctgtgttccagggactact 67
|||||||||| |||||||| ||||||||||||||||||||||||||||| ||||| ||
Sbjct: 125 gcagttttgggtcattggaggtgtgtcttcacatctctttgctgtgttccaaggactcct 184
Query: 68 caagnnnatagctggtgtagacacgagcttcactgtgacatccaagggcggagacgacga 127
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 185 caaggtcatagctggtgtagacacgagcttcactgtgacatccaagggtggagacgacga 244
Query: 128 ggagttctcagagctctacacattcaaatggacgacccttctgatacctccgacaaccct 187
||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 245 ggagttctcagagctgtacacattcaaatggacaacccttctgatacctccgaccaccct 304
Query: 188 gctcctactgaacttcattggagtggtagctggcattnnnaatgcgatcannnacggata 247
||| |||||||| ||||||||||| ||||||||| || ||||| |||| | |||||
Sbjct: 305 gcttctactgaatttcattggagtagtagctggcgtttccaatgcaatcaacaatggata 364
Query: 248 tgaatcatggggccccctgttcgggaagctcttctttgc 286
|||||||||||| ||||||||||||||||||||||||||
Sbjct: 365 tgaatcatgggggcccctgttcgggaagctcttctttgc 403
>gb|BG050984.1|BG050984 FM1_55_A02.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 362
Score = 371 bits (187), Expect = e-101
Identities = 253/279 (90%)
Strand = Plus / Plus
Query: 8 gcagttttggnnnattggaggcgtgtcttcacatctctttgctgtgttccagggactact 67
|||||||||| |||||||| ||||||||||||||||||||||||||||| ||||| ||
Sbjct: 43 gcagttttgggtcattggaggtgtgtcttcacatctctttgctgtgttccaaggactcct 102
Query: 68 caagnnnatagctggtgtagacacgagcttcactgtgacatccaagggcggagacgacga 127
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 103 caaggtcatagctggtgtagacacgagcttcactgtgacatccaagggtggagacgacga 162
Query: 128 ggagttctcagagctctacacattcaaatggacgacccttctgatacctccgacaaccct 187
||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 163 ggagttctcagagctgtacacattcaaatggacaacccttctgatacctccgaccaccct 222
Query: 188 gctcctactgaacttcattggagtggtagctggcattnnnaatgcgatcannnacggata 247
||| |||||||| ||||||||||| ||||||||| || ||||| |||| | |||||
Sbjct: 223 gcttctactgaatttcattggagtagtagctggcgtttccaatgcaatcaacaatggata 282
Query: 248 tgaatcatggggccccctgttcgggaagctcttctttgc 286
|||||||||||| ||||||||||||||||||||||||||
Sbjct: 283 tgaatcatgggggcccctgttcgggaagctcttctttgc 321
>gb|BF481250.1|BF481250 FM1_17_E01.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 412
Score = 260 bits (131), Expect = 6e-068
Identities = 176/193 (91%)
Strand = Plus / Plus
Query: 94 gcttcactgtgacatccaagggcggagacgacgaggagttctcagagctctacacattca 153
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 8 gcttcactgtgacatccaagggtggagacgacgaggagttctcagagctgtacacattca 67
Query: 154 aatggacgacccttctgatacctccgacaaccctgctcctactgaacttcattggagtgg 213
||||||| |||||||||||||||||||| |||||||| |||||||| ||||||||||| |
Sbjct: 68 aatggacaacccttctgatacctccgaccaccctgcttctactgaatttcattggagtag 127
Query: 214 tagctggcattnnnaatgcgatcannnacggatatgaatcatggggccccctgttcggga 273
|||||||| || ||||| |||| | ||||||||||||||||| |||||||||||||
Sbjct: 128 tagctggcgtttccaatgcaatcaacaatggatatgaatcatgggggcccctgttcggga 187
Query: 274 agctcttctttgc 286
|||||||||||||
Sbjct: 188 agctcttctttgc 200
>gb|BI140990.1|BI140990 IP1_41_G10.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 513
Score = 234 bits (118), Expect = 3e-060
Identities = 163/180 (90%)
Strand = Plus / Plus
Query: 107 atccaagggcggagacgacgaggagttctcagagctctacacattcaaatggacgaccct 166
||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 9 atccaagggtggagacgacgaggagttctcagagctgtacacattcaaatggacaaccct 68
Query: 167 tctgatacctccgacaaccctgctcctactgaacttcattggagtggtagctggcattnn 226
||||||||||||||| |||||||| |||||||| ||||||||||| ||||||||| ||
Sbjct: 69 tctgatacctccgaccaccctgcttctactgaatttcattggagtagtagctggcgtttc 128
Query: 227 naatgcgatcannnacggatatgaatcatggggccccctgttcgggaagctcttctttgc 286
||||| |||| | ||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 129 caatgcaatcaacaatggatatgaatcatgggggcccctgttcgggaagctcttctttgc 188
>gb|CX618063.1|CX618063 GABR1_37_B05.g1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_37_B05_A002 5', mRNA sequence
Length = 728
Score = 212 bits (107), Expect = 1e-053
Identities = 224/266 (84%)
Strand = Plus / Plus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| ||||| || || ||||||||||||||||||||||| |||||| ||||||
Sbjct: 385 attggaggtgtgtcctcgcacctctttgctgtgttccagggacttctcaaggtcatagct 444
Query: 81 ggtgtagacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagag 140
||||| || || ||||||||||||||||| ||||| ||||| || |||||||||||||||
Sbjct: 445 ggtgttgatacaagcttcactgtgacatcaaagggtggagatgatgaggagttctcagag 504
Query: 141 ctctacacattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaac 200
|| || |||||||||||||| ||| | |||||||||| || || |||||||| |||||
Sbjct: 505 ctgtatacattcaaatggactaccttattgatacctcctaccactttgctcctattgaac 564
Query: 201 ttcattggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggc 260
|||||||| ||||| ||||| || || || |||| |||||||||| ||||||||
Sbjct: 565 ttcattggtgtggttgctggtgtttccaacgcaatcaataacggatatgagtcatggggt 624
Query: 261 cccctgttcgggaagctcttctttgc 286
||||| || |||||||||||||||||
Sbjct: 625 cccctctttgggaagctcttctttgc 650
>gb|BG101839.1|BG101839 RHIZ2_23_A10.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 647
Score = 127 bits (64), Expect = 6e-028
Identities = 199/247 (80%)
Strand = Plus / Plus
Query: 37 cacatctctttgctgtgttccagggactactcaagnnnatagctggtgtagacacgagct 96
|||||||||| || |||||||| || || |||||| | || ||| | ||||||||||
Sbjct: 110 cacatctcttcgcggtgttccaaggccttctcaaggtcctcgccggtatcgacacgagct 169
Query: 97 tcactgtgacatccaagggcggagacgacgaggagttctcagagctctacacattcaaat 156
|||| || ||||| |||| ||| ||||||||||||||||||||||| ||||| |||||||
Sbjct: 170 tcaccgtcacatcaaaggccggggacgacgaggagttctcagagctgtacacgttcaaat 229
Query: 157 ggacgacccttctgatacctccgacaaccctgctcctactgaacttcattggagtggtag 216
|||| ||||| |||||||||| || || || ||||| || |||||||| || || || |
Sbjct: 230 ggaccaccctgttgatacctcccaccacgcttctcctgctcaacttcatcggggtcgtgg 289
Query: 217 ctggcattnnnaatgcgatcannnacggatatgaatcatggggccccctgttcgggaagc 276
|||| || || ||||||| |||| || || |||||||| || || ||||||||||
Sbjct: 290 ctggaatctcgaacgcgatcaacaacgggtacgagtcatggggtcctctcttcgggaagc 349
Query: 277 tcttctt 283
|||||||
Sbjct: 350 tcttctt 356
>gb|CN132882.1|CN132882 OX1_8_F12.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_8_F12_A002 5', mRNA sequence
Length = 704
Score = 125 bits (63), Expect = 2e-027
Identities = 162/197 (82%)
Strand = Plus / Plus
Query: 87 gacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagagctctac 146
|||||||||||||| || ||||| |||| ||| ||||||||||||||||||||||| |||
Sbjct: 443 gacacgagcttcaccgtcacatcaaaggccggggacgacgaggagttctcagagctgtac 502
Query: 147 acattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaacttcatt 206
|| ||||||||||| ||||| |||| ||||| || || || ||||| |||||||||||
Sbjct: 503 acgttcaaatggaccaccctgttgatccctccaaccacgcttctcctgctgaacttcatc 562
Query: 207 ggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggccccctg 266
|| || || ||||| || || ||||||| |||| || || |||||||| || ||
Sbjct: 563 ggggtcgtggctggaatctcgaacgcgatcaacaacgggtacgagtcatggggtcctctc 622
Query: 267 ttcgggaagctcttctt 283
|||||||||||||||||
Sbjct: 623 ttcgggaagctcttctt 639
>gb|BG933529.1|BG933529 WS1_4_E04.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 466
Score = 75.8 bits (38), Expect = 2e-012
Identities = 83/100 (83%)
Strand = Plus / Plus
Query: 187 tgctcctactgaacttcattggagtggtagctggcattnnnaatgcgatcannnacggat 246
|||||||| ||||||||||||| ||||| ||||| || || || |||| ||||||
Sbjct: 3 tgctcctattgaacttcattggtgtggttgctggtgtttccaacgcaatcaataacggat 62
Query: 247 atgaatcatggggccccctgttcgggaagctcttctttgc 286
|||| |||||||| ||||| || |||||||||||||||||
Sbjct: 63 atgagtcatggggtcccctctttgggaagctcttctttgc 102
>gb|CF757235.1|CF757235 DSAF1_15_D07.g1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_15_D07_A011 3', mRNA sequence
Length = 393
Score = 71.9 bits (36), Expect = 3e-011
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 243 ggatatgaatcatggggccccctgttcgggaagctcttctttgc 286
||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 21 ggatatgaatcatggggccccctgttcgggaagcttttttttgc 64
>gb|CW140470.1|CW140470 104_531_11135797_116_34926_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135797, DNA
sequence
Length = 540
Score = 65.9 bits (33), Expect = 2e-009
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| ||||| || || ||||||||||||||||| ||||| |||||| |||||
Sbjct: 455 attggaggtgtgtcctcgcacctctttgctgtgttccaaggacttctcaaggtcatagca 514
Query: 81 ggtgtagacacgagcttcactgtgac 106
|| || || || ||||||||||||||
Sbjct: 515 ggagttgatacaagcttcactgtgac 540
>gb|CL167974.1|CL167974 104_365_10810478_114_31804_158 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10810478, DNA
sequence
Length = 777
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 392 tcatggggcccgctcttcggcaagctcttctt 423
>gb|CL167975.1|CL167975 104_365_10810478_116_31805_158 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10810478, DNA
sequence
Length = 638
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 577 tcatggggcccgctcttcggcaagctcttctt 546
>gb|CW031320.1|CW031320 104_259_10500738_116_30398 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10500738, DNA
sequence
Length = 854
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 345 tcatggggcccgctcttcggcaagctcttctt 314
>gb|CW235188.1|CW235188 104_690_11214849_116_37409_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214849, DNA
sequence
Length = 601
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 264 tcatggggcccgctcttcggcaagctcttctt 233
>gb|CW235189.1|CW235189 104_690_11214849_148_37413_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214849, DNA
sequence
Length = 686
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 598 tcatggggcccgctcttcggcaagctcttctt 629
>gb|CW315001.1|CW315001 104_805_11472128_148_35822_018 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11472128, DNA
sequence
Length = 685
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 352 tcatggggcccgctcttcggcaagctcttctt 383
>gb|CW413531.1|CW413531 fsbb001f112l18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f112l18, DNA
sequence
Length = 427
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 255 tcatggggcccgctcttcggcaagctcttctt 286
>gb|BE126002.1|BE126002 DG1_60_H10.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 518
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 185 agggcggagacgacgaggag 166
>gb|BE357339.1|BE357339 DG1_148_D12.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 505
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 390 tcatggggcccgctcttcggcaagctcttctt 421
>gb|BE362248.1|BE362248 DG1_85_H01.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 604
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 182 agggcggagacgacgaggag 163
>gb|BE595269.1|BE595269 PI1_48_A12.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 525
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 189 agggcggagacgacgaggag 170
>gb|BE598973.1|BE598973 PI1_84_A12.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 366
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 233 agggcggagacgacgaggag 214
>gb|BE600108.1|BE600108 PI1_79_D08.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 486
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 182 agggcggagacgacgaggag 163
>gb|BF420934.1|BF420934 FM1_5_B03.g1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 259
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
|||||||| ||||| ||||| |||||||||||
Sbjct: 34 tcatggggacccctcttcggcaagctcttctt 65
>gb|BG240580.1|BG240580 OV1_31_F08.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 538
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 39 catctctttgctgtgttcca 58
||||||||||||||||||||
Sbjct: 170 catctctttgctgtgttcca 189
>gb|BM318632.1|BM318632 PI1_15_H01.b9_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 546
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 239 agggcggagacgacgaggag 220
>gb|BM322368.1|BM322368 PIC1_3_H09.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 393
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 126 agggcggagacgacgaggag 107
>gb|BM325425.1|BM325425 PIC1_44_D07.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 179
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 170 agggcggagacgacgaggag 151
>gb|CD203902.1|CD203902 HS1_2_C09.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA clone
HS1_2_C09_A012 5', mRNA sequence
Length = 574
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 140 agggcggagacgacgaggag 121
>gb|CD206564.1|CD206564 HS1_23_B06.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_23_B06_A012 5', mRNA sequence
Length = 562
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 250 agggcggagacgacgaggag 231
>gb|CD208902.1|CD208902 HS1_44_E05.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_44_E05_A012 5', mRNA sequence
Length = 403
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 117 agggcggagacgacgaggag 98
>gb|CD209934.1|CD209934 HS1_55_A04.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_55_A04_A012 5', mRNA sequence
Length = 284
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 227 agggcggagacgacgaggag 208
>gb|CD212347.1|CD212347 HS1_30_F08.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_30_F08_A012 5', mRNA sequence
Length = 489
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 152 agggcggagacgacgaggag 133
>gb|CD234021.1|CD234021 SS1_5_E12.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_5_E12_A012 5', mRNA sequence
Length = 649
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 127 agggcggagacgacgaggag 108
>gb|CD234992.1|CD234992 SS1_19_D08.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_19_D08_A012 5', mRNA sequence
Length = 568
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 122 agggcggagacgacgaggag 103
>gb|CF427627.1|CF427627 PH1_16_D09.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_16_D09_A002 5', mRNA sequence
Length = 586
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 129 agggcggagacgacgaggag 110
>gb|CF429881.1|CF429881 PH1_25_C04.b1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_25_C04_A002 3', mRNA sequence
Length = 553
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 152 tcatggggcccgctcttcggcaagctcttctt 183
>gb|CF433456.1|CF433456 NIT1_27_E11.b1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_27_E11_A002 3', mRNA sequence
Length = 553
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
||||||||||| || ||||| |||||||||||
Sbjct: 43 tcatggggcccgctcttcggcaagctcttctt 74
>gb|CN134554.1|CN134554 OX1_27_C06.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_27_C06_A002 3', mRNA sequence
Length = 677
Score = 40.1 bits (20), Expect = 0.10
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctt 283
|||||||| || || |||||||||||||||||
Sbjct: 39 tcatggggtcctcttttcgggaagctcttctt 70
>gb|CX606901.1|CX606901 ANR1_5_C09.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_5_C09_A002 5', mRNA sequence
Length = 315
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 216 agggcggagacgacgaggag 197
>gb|CX607839.1|CX607839 ANR1_31_C06.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_31_C06_A002 3', mRNA sequence
Length = 841
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 39 catctctttgctgtgttcca 58
||||||||||||||||||||
Sbjct: 34 catctctttgctgtgttcca 53
>gb|CX617100.1|CX617100 GABR1_31_E06.g1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_31_E06_A002 5', mRNA sequence
Length = 626
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 112 agggcggagacgacgaggag 93
>gb|CX621700.1|CX621700 GABR1_59_D11.g1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_59_D11_A002 5', mRNA sequence
Length = 653
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 114 agggcggagacgacgaggag 95
>gb|CX622537.1|CX622537 GABR1_64_C02.g2_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_64_C02_A002 5', mRNA sequence
Length = 722
Score = 40.1 bits (20), Expect = 0.10
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 112 agggcggagacgacgaggag 131
||||||||||||||||||||
Sbjct: 112 agggcggagacgacgaggag 93
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 52,050
Number of Sequences: 832831
Number of extensions: 52050
Number of successful extensions: 14746
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14698
Number of HSP's gapped (non-prelim): 44
length of query: 286
length of database: 491,359,669
effective HSP length: 19
effective length of query: 267
effective length of database: 475,535,880
effective search space: 126968079960
effective search space used: 126968079960
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)