BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCF7a10.yg.2.1
(523 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW042667.1|CW042667 104_276_10507221_114_30482 Sorghum m... 190 9e-047
gb|CW157091.1|CW157091 104_560_11147040_116_36386_092 Sorgh... 190 9e-047
gb|CN123987.1|CN123987 RHOH1_1_H10.g1_A002 Acid- and alkali... 121 7e-026
gb|CN135280.1|CN135280 OX1_31_F02.g1_A002 Oxidatively-stres... 70 2e-010
gb|CD228436.1|CD228436 CCC1_7_D11.g1_A007 Callus culture/ce... 68 9e-010
gb|CD233682.1|CD233682 SS1_3_B09.g1_A012 Salt-stressed seed... 68 9e-010
gb|CL172938.1|CL172938 104_376_10890527_148_31794_047 Sorgh... 64 1e-008
gb|CW344933.1|CW344933 104_847_11488219_148_36202_068 Sorgh... 64 1e-008
gb|CW452774.1|CW452774 fsbb001f193h17k0 Sorghum methylation... 64 1e-008
gb|CL190299.1|CL190299 104_408_10905986_116_32502_009 Sorgh... 60 2e-007
gb|CW109338.1|CW109338 104_481_11098049_116_34505_071 Sorgh... 60 2e-007
gb|CW249847.1|CW249847 104_711_11223065_116_35043_067 Sorgh... 60 2e-007
gb|CW288084.1|CW288084 104_766_11411762_116_35530_007 Sorgh... 60 2e-007
gb|CW352664.1|CW352664 fsbb001f015a20k0 Sorghum methylation... 60 2e-007
gb|AW287265.2|AW287265 LG1_268_G06.b1_A002 Light Grown 1 (L... 60 2e-007
gb|CW109339.1|CW109339 104_481_11098049_148_34501_071 Sorgh... 52 5e-005
gb|CW445100.1|CW445100 fsbb001f170a14f0 Sorghum methylation... 50 2e-004
gb|BE597085.1|BE597085 PI1_70_E04.g1_A002 Pathogen induced ... 44 0.013
>gb|CW042667.1|CW042667 104_276_10507221_114_30482 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10507221, DNA
sequence
Length = 579
Score = 190 bits (96), Expect = 9e-047
Identities = 108/112 (96%)
Strand = Plus / Minus
Query: 1 actttgatgcaaggcggaagcctcgtaatgttggaaaaatcattgcagccctggtcctca 60
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 279 actttgatgcaaggcggaagcctcataatgttgggaaaatcattgcagccctggtcctca 220
Query: 61 caacactctgtatatttgctctgaagcaatctcctggttttggtggcaatag 112
||||| |||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 219 caacagtctgtatatttgttctgaagcaatctcctggttttggtggcaatag 168
>gb|CW157091.1|CW157091 104_560_11147040_116_36386_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11147040, DNA
sequence
Length = 657
Score = 190 bits (96), Expect = 9e-047
Identities = 108/112 (96%)
Strand = Plus / Minus
Query: 1 actttgatgcaaggcggaagcctcgtaatgttggaaaaatcattgcagccctggtcctca 60
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 321 actttgatgcaaggcggaagcctcataatgttgggaaaatcattgcagccctggtcctca 262
Query: 61 caacactctgtatatttgctctgaagcaatctcctggttttggtggcaatag 112
||||| |||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 261 caacagtctgtatatttgttctgaagcaatctcctggttttggtggcaatag 210
>gb|CN123987.1|CN123987 RHOH1_1_H10.g1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_1_H10_A002 5', mRNA sequence
Length = 237
Score = 121 bits (61), Expect = 7e-026
Identities = 73/77 (94%)
Strand = Plus / Plus
Query: 116 gttttctcgccatgaacctggtgttacccacgtcttagtaacaggaggagctggttatat 175
|||||||| |||||||||||| |||||||| |||||||| ||||||||||||||||||||
Sbjct: 161 gttttctcaccatgaacctggggttacccatgtcttagttacaggaggagctggttatat 220
Query: 176 tggttcacatgccgctt 192
|||||||||||||||||
Sbjct: 221 tggttcacatgccgctt 237
>gb|CN135280.1|CN135280 OX1_31_F02.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_31_F02_A002 5', mRNA sequence
Length = 787
Score = 69.9 bits (35), Expect = 2e-010
Identities = 63/73 (86%)
Strand = Plus / Plus
Query: 439 aacaagatatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttat 498
||||| |||||| | || ||||||||||||||||| ||||||||||| |||| ||||||
Sbjct: 715 aacaaaatattttcggagaatgcatttgatgctgttatgcactttgctgctgttgcttat 774
Query: 499 gtgggagagagca 511
|| || |||||||
Sbjct: 775 gttggtgagagca 787
Score = 67.9 bits (34), Expect = 9e-010
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 114 gtgttttctcgccatgaacctggtgttacccacgtcttagtaacaggaggagctggttat 173
||||| ||||||| |||| |||| || ||||| || ||||||||||| |||||||| |||
Sbjct: 487 gtgttctctcgccgtgaaactggggtgacccatgtgttagtaacagggggagctgggtat 546
Query: 174 attggttcacatgc 187
||||| ||||||||
Sbjct: 547 attggctcacatgc 560
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 216 cgagttaccattgtggataatctatctagaggaaatatgggagc 259
|||||||||||||||||||| |||| ||||| || ||||||||
Sbjct: 589 cgagttaccattgtggataacttatcaagagggaacatgggagc 632
>gb|CD228436.1|CD228436 CCC1_7_D11.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_7_D11_A007 5', mRNA sequence
Length = 655
Score = 67.9 bits (34), Expect = 9e-010
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 114 gtgttttctcgccatgaacctggtgttacccacgtcttagtaacaggaggagctggttat 173
||||| ||||||| |||| |||| || ||||| || ||||||||||| |||||||| |||
Sbjct: 440 gtgttctctcgccgtgaaactggggtgacccatgtgttagtaacagggggagctgggtat 499
Query: 174 attggttcacatgc 187
||||| ||||||||
Sbjct: 500 attggctcacatgc 513
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 216 cgagttaccattgtggataatctatctagaggaaatatgggagc 259
|||||||||||||||||||| |||| ||||| || ||||||||
Sbjct: 542 cgagttaccattgtggataacttatcaagagggaacatgggagc 585
>gb|CD233682.1|CD233682 SS1_3_B09.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_3_B09_A012 5', mRNA sequence
Length = 671
Score = 67.9 bits (34), Expect = 9e-010
Identities = 59/68 (86%)
Strand = Plus / Plus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttatgtggga 504
|||||||| || || |||||||||||||| |||||||||||||||| || ||||| ||
Sbjct: 547 atatttgcagagaacgcatttgatgctgttatgcactttgcagctgtggcctatgttggt 606
Query: 505 gagagcac 512
||||||||
Sbjct: 607 gagagcac 614
>gb|CL172938.1|CL172938 104_376_10890527_148_31794_047 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10890527, DNA
sequence
Length = 734
Score = 63.9 bits (32), Expect = 1e-008
Identities = 59/68 (86%)
Strand = Plus / Minus
Query: 120 tctcgccatgaacctggtgttacccacgtcttagtaacaggaggagctggttatattggt 179
||||||| |||| |||| || ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 89 tctcgccgtgaaactggggtgacccatgtgttagtaacagggggagctgggtatattggc 30
Query: 180 tcacatgc 187
||||||||
Sbjct: 29 tcacatgc 22
>gb|CW344933.1|CW344933 104_847_11488219_148_36202_068 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11488219, DNA
sequence
Length = 643
Score = 63.9 bits (32), Expect = 1e-008
Identities = 59/68 (86%)
Strand = Plus / Minus
Query: 120 tctcgccatgaacctggtgttacccacgtcttagtaacaggaggagctggttatattggt 179
||||||| |||| |||| || ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 124 tctcgccgtgaaactggggtgacccatgtgttagtaacagggggagctgggtatattggc 65
Query: 180 tcacatgc 187
||||||||
Sbjct: 64 tcacatgc 57
>gb|CW452774.1|CW452774 fsbb001f193h17k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f193h17, DNA
sequence
Length = 700
Score = 63.9 bits (32), Expect = 1e-008
Identities = 59/68 (86%)
Strand = Plus / Minus
Query: 120 tctcgccatgaacctggtgttacccacgtcttagtaacaggaggagctggttatattggt 179
||||||| |||| |||| || ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 98 tctcgccgtgaaactggggtgacccatgtgttagtaacagggggagctgggtatattggc 39
Query: 180 tcacatgc 187
||||||||
Sbjct: 38 tcacatgc 31
>gb|CL190299.1|CL190299 104_408_10905986_116_32502_009 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10905986, DNA
sequence
Length = 633
Score = 60.0 bits (30), Expect = 2e-007
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttatgtggga 504
|||||||| || || |||||||||||||| ||||||||||| |||| || ||||| ||
Sbjct: 365 atatttgcagagaacgcatttgatgctgttatgcactttgctgctgtggcctatgttggt 424
Query: 505 gagagcac 512
||||||||
Sbjct: 425 gagagcac 432
>gb|CW109338.1|CW109338 104_481_11098049_116_34505_071 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11098049, DNA
sequence
Length = 622
Score = 60.0 bits (30), Expect = 2e-007
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttatgtggga 504
|||||||| || || |||||||||||||| ||||||||||| |||| || ||||| ||
Sbjct: 607 atatttgcagagaacgcatttgatgctgttatgcactttgctgctgtggcctatgttggt 548
Query: 505 gagagcac 512
||||||||
Sbjct: 547 gagagcac 540
>gb|CW249847.1|CW249847 104_711_11223065_116_35043_067 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11223065, DNA
sequence
Length = 505
Score = 60.0 bits (30), Expect = 2e-007
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttatgtggga 504
|||||||| || || |||||||||||||| ||||||||||| |||| || ||||| ||
Sbjct: 444 atatttgcagagaacgcatttgatgctgttatgcactttgctgctgtggcctatgttggt 385
Query: 505 gagagcac 512
||||||||
Sbjct: 384 gagagcac 377
>gb|CW288084.1|CW288084 104_766_11411762_116_35530_007 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11411762, DNA sequence
Length = 676
Score = 60.0 bits (30), Expect = 2e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 1 actttgatgcaaggcggaagcctcgtaatgttgg 34
|||||||||||||||||||||||| |||||||||
Sbjct: 34 actttgatgcaaggcggaagcctcataatgttgg 1
>gb|CW352664.1|CW352664 fsbb001f015a20k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f015a20, DNA
sequence
Length = 785
Score = 60.0 bits (30), Expect = 2e-007
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttatgtggga 504
|||||||| || || |||||||||||||| ||||||||||| |||| || ||||| ||
Sbjct: 154 atatttgcagagaacgcatttgatgctgttatgcactttgctgctgtggcctatgttggt 213
Query: 505 gagagcac 512
||||||||
Sbjct: 214 gagagcac 221
>gb|AW287265.2|AW287265 LG1_268_G06.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 501
Score = 60.0 bits (30), Expect = 2e-007
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttatgtggga 504
|||||||| || || |||||||||||||| ||||||||||| |||| || ||||| ||
Sbjct: 180 atatttgcagagaacgcatttgatgctgttatgcactttgctgctgtggcctatgttggt 239
Query: 505 gagagcac 512
||||||||
Sbjct: 240 gagagcac 247
>gb|CW109339.1|CW109339 104_481_11098049_148_34501_071 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11098049, DNA
sequence
Length = 575
Score = 52.0 bits (26), Expect = 5e-005
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctg 490
|||||||| || || |||||||||||||| ||||||||||| ||||
Sbjct: 522 atatttgcagagaacgcatttgatgctgttatgcactttgctgctg 567
>gb|CW445100.1|CW445100 fsbb001f170a14f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f170a14, DNA
sequence
Length = 662
Score = 50.1 bits (25), Expect = 2e-004
Identities = 44/51 (86%)
Strand = Plus / Minus
Query: 468 tgctgtgatgcactttgcagctgnngcttatgtgggagagagcacattgga 518
|||||| ||||||||||| |||| |||||||| || ||||||||| ||||
Sbjct: 662 tgctgttatgcactttgctgctgttgcttatgttggtgagagcacaatgga 612
>gb|BE597085.1|BE597085 PI1_70_E04.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 623
Score = 44.1 bits (22), Expect = 0.013
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 445 atatttgctgaaaatgcatttgatgctgtgatgcactttgcagctg 490
|||||||| || || ||||||||||||| ||||||||||| ||||
Sbjct: 50 atatttgcagagaacgcatttgatgctggtatgcactttgctgctg 5
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 122,143
Number of Sequences: 832831
Number of extensions: 122143
Number of successful extensions: 35508
Number of sequences better than 0.5: 18
Number of HSP's better than 0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35485
Number of HSP's gapped (non-prelim): 23
length of query: 523
length of database: 491,359,669
effective HSP length: 19
effective length of query: 504
effective length of database: 475,535,880
effective search space: 239670083520
effective search space used: 239670083520
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)