BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.006E19F020311.3.1
(789 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW206090.1|CW206090 104_634_11187412_116_36954_004 Sorgh... 56 5e-006
gb|CW265871.1|CW265871 104_735_11232120_116_35270_090 Sorgh... 56 5e-006
gb|CW130774.1|CW130774 104_513_11115303_148_34778_058 Sorgh... 44 0.019
gb|CW024926.1|CW024926 104_226_10487858_116_30525 Sorghum m... 40 0.30
gb|AC169370.3| Sorghum bicolor clone SB_BBc0011I20, WORKING... 40 0.30
>gb|CW206090.1|CW206090 104_634_11187412_116_36954_004 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11187412, DNA
sequence
Length = 717
Score = 56.0 bits (28), Expect = 5e-006
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 497 gtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggt 544
||||||||||| || |||||||||||| ||||||||| |||||||||
Sbjct: 324 gtgtatgagaaacaacagaagctaagggctatgatgaagatgcacggt 277
>gb|CW265871.1|CW265871 104_735_11232120_116_35270_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232120, DNA
sequence
Length = 719
Score = 56.0 bits (28), Expect = 5e-006
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 497 gtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggt 544
||||||||||| || |||||||||||| ||||||||| |||||||||
Sbjct: 445 gtgtatgagaaacaacagaagctaagggctatgatgaagatgcacggt 398
>gb|CW130774.1|CW130774 104_513_11115303_148_34778_058 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11115303, DNA
sequence
Length = 653
Score = 44.1 bits (22), Expect = 0.019
Identities = 58/70 (82%)
Strand = Plus / Plus
Query: 485 ttgacatatctggtgtatgagaagcagcagaagctaaggattatgatgaaaatgcacggt 544
|||||||| || || || ||||||||||||| ||||| | |||||||| ||||| ||
Sbjct: 584 ttgacataccttgtttacgagaagcagcagagactaagactcatgatgaagatgcatggg 643
Query: 545 ctgaaggatg 554
||||||||||
Sbjct: 644 ctgaaggatg 653
>gb|CW024926.1|CW024926 104_226_10487858_116_30525 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10487858, DNA
sequence
Length = 716
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 238 tgtttggtacaactctactt 257
||||||||||||||||||||
Sbjct: 85 tgtttggtacaactctactt 104
>gb|AC169370.3| Sorghum bicolor clone SB_BBc0011I20, WORKING DRAFT SEQUENCE, 9
unordered pieces
Length = 143922
Score = 40.1 bits (20), Expect = 0.30
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 238 tgtttggtacaactctactt 257
||||||||||||||||||||
Sbjct: 95088 tgtttggtacaactctactt 95069
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 218,270
Number of Sequences: 832831
Number of extensions: 218270
Number of successful extensions: 57608
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57586
Number of HSP's gapped (non-prelim): 22
length of query: 789
length of database: 491,359,669
effective HSP length: 20
effective length of query: 769
effective length of database: 474,703,049
effective search space: 365046644681
effective search space used: 365046644681
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)