BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAW3d03.yg.2.1
(557 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CL172808.1|CL172808 104_375_10890425_148_31796_329 Sorgh... 167 1e-039
gb|CW033103.1|CW033103 104_262_10501765_115_30362 Sorghum m... 50 2e-004
gb|BI245888.1|BI245888 IP1_64_G09.b1_A002 Immature pannicle... 42 0.053
gb|CW110661.1|CW110661 104_483_11103841_148_34521_005 Sorgh... 40 0.21
>gb|CL172808.1|CL172808 104_375_10890425_148_31796_329 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10890425, DNA
sequence
Length = 581
Score = 167 bits (84), Expect = 1e-039
Identities = 122/138 (88%)
Strand = Plus / Minus
Query: 154 caagaggaacttctgatnnatacatgacaagagggttcgaaatgtttgtgacatcataaa 213
||||||||||||| ||| ||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 571 caagaggaacttccgatccctacatgacaagagggtttgaactgtttgtgacatcataaa 512
Query: 214 catttaccaccaattnctgattgccagctagctgcctnnncnnattttnnactaatgatt 273
||||||||||||||| |||||||||||| |||||||| | ||||| ||||||||||
Sbjct: 511 catttaccaccaattcctgattgccagcaagctgcctcaacaaattttccactaatgatt 452
Query: 274 ctacatcaaatgctcccc 291
|||||||||||| |||||
Sbjct: 451 ctacatcaaatgatcccc 434
>gb|CW033103.1|CW033103 104_262_10501765_115_30362 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10501765, DNA
sequence
Length = 630
Score = 50.1 bits (25), Expect = 2e-004
Identities = 43/52 (82%)
Strand = Plus / Plus
Query: 352 catgatagacaggaannntnnntacgacacnnnggtgattcgacatgagccg 403
||||||||||||||| | |||||||| |||||||||||||||||||
Sbjct: 221 catgatagacaggaaaagtcaatacgacacccaggtgattcgacatgagccg 272
>gb|BI245888.1|BI245888 IP1_64_G09.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 448
Score = 42.1 bits (21), Expect = 0.053
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 198 tttgtgacatcataaacatttaccaccaattnctgattgccagc 241
|||||||||||||| ||||| ||||| | | ||||||||||||
Sbjct: 344 tttgtgacatcatagacattaaccacaatatcctgattgccagc 301
>gb|CW110661.1|CW110661 104_483_11103841_148_34521_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11103841, DNA
sequence
Length = 662
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 95 atgctttctgaatggatcac 114
||||||||||||||||||||
Sbjct: 613 atgctttctgaatggatcac 594
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 54,842
Number of Sequences: 832831
Number of extensions: 54842
Number of successful extensions: 15441
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15436
Number of HSP's gapped (non-prelim): 5
length of query: 557
length of database: 491,359,669
effective HSP length: 19
effective length of query: 538
effective length of database: 475,535,880
effective search space: 255838303440
effective search space used: 255838303440
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)