BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF31c07.yg.2.3
(732 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF756186.1|CF756186 DSAF1_4_C09.b1_A011 Drought-stressed... 40 0.28
>gb|CF756186.1|CF756186 DSAF1_4_C09.b1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_4_C09_A011 5', mRNA sequence
Length = 435
Score = 40.1 bits (20), Expect = 0.28
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 401 atggattggatcattcacctcgatactgatgagttg 436
|||||||||||||| || || || ||||||||||||
Sbjct: 378 atggattggatcatacatctagacactgatgagttg 413
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 160,419
Number of Sequences: 832831
Number of extensions: 160419
Number of successful extensions: 43170
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43169
Number of HSP's gapped (non-prelim): 1
length of query: 732
length of database: 491,359,669
effective HSP length: 20
effective length of query: 712
effective length of database: 474,703,049
effective search space: 337988570888
effective search space used: 337988570888
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)