BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF1g01.yg.2.1
(335 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF074169.1|CF074169 FE1_21_G07.g1_A002 Iron-deficient se... 121 4e-026
gb|BG054341.1|BG054341 OV2_3_A09.b1_A002 Ovary 2 (OV2) Sorg... 62 3e-008
gb|CW473573.1|CW473573 fsbb001f229a03k0 Sorghum methylation... 48 5e-004
gb|CW883674.1|CW883674 Sorghum CISP Intron:I00_X00_F_PRSC1_... 44 0.008
gb|CW884311.1|CW884311 Sorghum CISP Intron:I00_X00_F_PRSC1_... 44 0.008
gb|CL170430.1|CL170430 104_371_10813804_116_31791_124 Sorgh... 40 0.12
gb|BG559259.1|BG559259 RHIZ2_52_F03.b1_A003 Rhizome2 (RHIZ2... 40 0.12
>gb|CF074169.1|CF074169 FE1_21_G07.g1_A002 Iron-deficient seedlings Sorghum bicolor cDNA
clone FE1_21_G07_A002 5', mRNA sequence
Length = 580
Score = 121 bits (61), Expect = 4e-026
Identities = 82/91 (90%)
Strand = Plus / Minus
Query: 153 gcatatatatcttcgcttatattaatcactcgagacgccttnnnaatgccacctcgggtt 212
|||||||||||||| |||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 580 gcatatatatcttcacttatattaatcacacgggacgccttgctaatgccacctcgggtt 521
Query: 213 atnnnaaatatccgatcaaaaacatcaggat 243
|| ||||||||||||||||||||||||||
Sbjct: 520 atgtgaaatatccgatcaaaaacatcaggat 490
>gb|BG054341.1|BG054341 OV2_3_A09.b1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA sequence
Length = 528
Score = 61.9 bits (31), Expect = 3e-008
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 6 tctcggctgagaacttgctcaccattgcctccagcaactttcccctcaaatagtgcaat 64
|||||||| |||||||| |||||||| || ||||||||||| || ||||| ||||||||
Sbjct: 493 tctcggctaagaacttgttcaccatttccaccagcaacttttccttcaaagagtgcaat 435
>gb|CW473573.1|CW473573 fsbb001f229a03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f229a03, DNA
sequence
Length = 646
Score = 48.1 bits (24), Expect = 5e-004
Identities = 75/92 (81%)
Strand = Plus / Minus
Query: 21 tgctcaccattgcctccagcaactttcccctcaaatagtgcaatttggttcaagccaaca 80
||||| ||||| || | ||||||||| ||||||| || | |||||| || | || |||
Sbjct: 625 tgctccccatttccgcaagcaactttggcctcaaagagagaaatttgattgagacctaca 566
Query: 81 tcacgccctttccccacctggatatattcatg 112
||||||||||||||||| ||||| || |||||
Sbjct: 565 tcacgccctttccccacttggatgtactcatg 534
>gb|CW883674.1|CW883674 Sorghum CISP Intron:I00_X00_F_PRSC1_002_SORG_BTXX BTXX Sorghum
bicolor genomic, DNA sequence
Length = 509
Score = 44.1 bits (22), Expect = 0.008
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 63 atttggttcaagccaacatcacgccctttcccca 96
|||||||||| ||||||||||||||||| ||||
Sbjct: 152 atttggttcattccaacatcacgccctttgccca 119
>gb|CW884311.1|CW884311 Sorghum CISP Intron:I00_X00_F_PRSC1_002_SORG_IS18 IS18 Sorghum
bicolor genomic, DNA sequence
Length = 501
Score = 44.1 bits (22), Expect = 0.008
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 63 atttggttcaagccaacatcacgccctttcccca 96
|||||||||| ||||||||||||||||| ||||
Sbjct: 144 atttggttcattccaacatcacgccctttgccca 111
>gb|CL170430.1|CL170430 104_371_10813804_116_31791_124 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10813804, DNA
sequence
Length = 746
Score = 40.1 bits (20), Expect = 0.12
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 87 cctttccccacctggatatattcatggtgtgt 118
||||| || ||||||||||| |||||||||||
Sbjct: 284 cctttaccaacctggatatactcatggtgtgt 253
>gb|BG559259.1|BG559259 RHIZ2_52_F03.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 456
Score = 40.1 bits (20), Expect = 0.12
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 87 cctttccccacctggatatattcatggtgtgt 118
||||| || ||||||||||| |||||||||||
Sbjct: 184 cctttaccaacctggatatactcatggtgtgt 153
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 48,075
Number of Sequences: 832831
Number of extensions: 48075
Number of successful extensions: 12585
Number of sequences better than 0.5: 7
Number of HSP's better than 0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12573
Number of HSP's gapped (non-prelim): 12
length of query: 335
length of database: 491,359,669
effective HSP length: 19
effective length of query: 316
effective length of database: 475,535,880
effective search space: 150269338080
effective search space used: 150269338080
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)