BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAD4g02.sg.2.1
(308 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF759649.1|CF759649 DSAF1_48_A01.b1_A011 Drought-stresse... 319 8e-086
gb|CW346505.1|CW346505 fsbb001f006a22k0 Sorghum methylation... 280 7e-074
gb|CN147262.1|CN147262 WOUND1_48_D07.g1_A002 Wounded leaves... 276 1e-072
gb|CD432207.1|CD432207 ETH1_26_G11.g1_A002 Ethylene-treated... 228 2e-058
gb|BG560333.1|BG560333 RHIZ2_73_B06.b1_A003 Rhizome2 (RHIZ2... 216 9e-055
gb|BG560363.1|BG560363 RHIZ2_73_E06.b1_A003 Rhizome2 (RHIZ2... 208 2e-052
gb|CN149722.1|CN149722 WOUND1_64_B06.g1_A002 Wounded leaves... 182 1e-044
gb|BM325263.1|BM325263 PIC1_42_D10.b1_A002 Pathogen-infecte... 180 5e-044
gb|CN147179.1|CN147179 WOUND1_48_D07.b1_A002 Wounded leaves... 153 1e-035
gb|CD207582.1|CD207582 HS1_33_C08.g1_A012 Heat-shocked seed... 137 7e-031
gb|CD208040.1|CD208040 HS1_36_D12.g1_A012 Heat-shocked seed... 135 3e-030
gb|CF427115.1|CF427115 PH1_3_F11.g1_A002 Phosphorous-defici... 135 3e-030
gb|CD204270.1|CD204270 HS1_4_G11.g1_A012 Heat-shocked seedl... 127 6e-028
gb|CN149638.1|CN149638 WOUND1_64_B06.b1_A002 Wounded leaves... 123 1e-026
gb|CX615956.1|CX615956 GABR1_25_A05.b1_A002 GA- or brassino... 111 4e-023
gb|CX620733.1|CX620733 GABR1_53_D12.g1_A002 GA- or brassino... 101 4e-020
gb|CB929002.1|CB929002 ABA1_38_A08.g1_A012 Abscisic acid-tr... 98 6e-019
gb|CD233383.1|CD233383 SS1_13_A05.g1_A012 Salt-stressed see... 92 3e-017
gb|CB928743.1|CB928743 ABA1_17_E08.g1_A012 Abscisic acid-tr... 80 1e-013
gb|CD233562.1|CD233562 SS1_2_B10.g1_A012 Salt-stressed seed... 72 3e-011
gb|BG412608.1|BG412608 OV2_36_E11.g1_A002 Ovary 2 (OV2) Sor... 60 1e-007
gb|CB928908.1|CB928908 ABA1_38_A08.b1_A012 Abscisic acid-tr... 60 1e-007
gb|CD203981.1|CD203981 HS1_3_B06.b1_A012 Heat-shocked seedl... 60 1e-007
gb|CD207954.1|CD207954 HS1_36_D12.b1_A012 Heat-shocked seed... 60 1e-007
gb|CD208815.1|CD208815 HS1_44_A11.b1_A012 Heat-shocked seed... 60 1e-007
gb|CD220490.1|CD220490 CCC1_67_A10.g1_A007 Callus culture/c... 60 1e-007
gb|CD432110.1|CD432110 ETH1_26_G11.b1_A002 Ethylene-treated... 60 1e-007
gb|CX620652.1|CX620652 GABR1_53_D12.b1_A002 GA- or brassino... 60 1e-007
gb|BE595856.1|BE595856 PI1_49_B01.g1_A002 Pathogen induced ... 46 0.002
gb|BE596303.1|BE596303 PI1_49_B01.b1_A002 Pathogen induced ... 46 0.002
>gb|CF759649.1|CF759649 DSAF1_48_A01.b1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_48_A01_A011 5', mRNA sequence
Length = 283
Score = 319 bits (161), Expect = 8e-086
Identities = 236/261 (90%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatccttggtgctgtagtccgtcccgtag 62
||||| ||||||||||||||||||||||| |||||||| || ||||||| || || |||
Sbjct: 261 acaacatggatgtaatcacgcaccccagttccatcctttgtattgtagtctgttccatag 202
Query: 63 accgtgaggtgaggtaacctcccaacagcgacttgctgcacgtagggcatcaggttgttc 122
|||||||||||||||||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 201 accgtgaggtgaggtaacctcccaacagcgacttgctgaacatagggcatcaagttgttt 142
Query: 123 gggacaccgcaggggtcttcgccgatgtacccgcttggatgagcgccaacggggttgaag 182
|||||||| |||||||||||||||||||| |||||||||||||| ||||| || ||||||
Sbjct: 141 gggacaccacaggggtcttcgccgatgtatccgcttggatgagcaccaacaggattgaag 82
Query: 183 tacctgagcagtatgatcttccagtcggggtcggagcggtggacgtcgcggcagatgtct 242
||||||||||||||||||||||| || ||||| || ||||| || ||||| |||||||||
Sbjct: 81 tacctgagcagtatgatcttccaatcagggtctgaacggtgcacatcgcgacagatgtct 22
Query: 243 tcaatcacaagctttgtccgc 263
|||||||||||||| ||||||
Sbjct: 21 tcaatcacaagcttggtccgc 1
>gb|CW346505.1|CW346505 fsbb001f006a22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f006a22, DNA
sequence
Length = 550
Score = 280 bits (141), Expect = 7e-074
Identities = 213/237 (89%)
Strand = Plus / Minus
Query: 19 cacgcaccccagtcccatccttggtgctgtagtccgtcccgtagaccgtgaggtgaggta 78
|||| |||||||| |||||||| || ||||||| || || |||||||||||||||||||
Sbjct: 469 cacgtaccccagttccatcctttgtattgtagtctgttccatagaccgtgaggtgaggta 410
Query: 79 acctcccaacagcgacttgctgcacgtagggcatcaggttgttcgggacaccgcaggggt 138
|||||||||||||||||||||| || |||||||||| |||||| |||||||| |||||||
Sbjct: 409 acctcccaacagcgacttgctgaacatagggcatcaagttgtttgggacaccacaggggt 350
Query: 139 cttcgccgatgtacccgcttggatgagcgccaacggggttgaagtacctgagcagtatga 198
||||||||||||| |||||||||||||| ||||| || ||||||||||||||||||||||
Sbjct: 349 cttcgccgatgtatccgcttggatgagcaccaacaggattgaagtacctgagcagtatga 290
Query: 199 tcttccagtcggggtcggagcggtggacgtcgcggcagatgtcttcaatcacaagct 255
||||||| || ||||| || ||||| || ||||| ||||||||||||||||||||||
Sbjct: 289 tcttccaatcagggtctgaacggtgcacatcgcgacagatgtcttcaatcacaagct 233
Score = 91.7 bits (46), Expect = 3e-017
Identities = 49/50 (98%)
Strand = Plus / Minus
Query: 258 gtccgcccatagggattggtggcgcagagcgggaattcttcggtgcatgg 307
|||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 120 gtccgcccatagggattggtggcgcaaagcgggaattcttcggtgcatgg 71
>gb|CN147262.1|CN147262 WOUND1_48_D07.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_48_D07_A002 5', mRNA sequence
Length = 820
Score = 276 bits (139), Expect = 1e-072
Identities = 187/203 (92%)
Strand = Plus / Minus
Query: 105 tagggcatcaggttgttcgggacaccgcaggggtcttcgccgatgtacccgcttggatga 164
|||||||||| |||||| |||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 813 tagggcatcaagttgtttgggacaccacaggggtcttcgccgatgtatccgcttggatga 754
Query: 165 gcgccaacggggttgaagtacctgagcagtatgatcttccagtcggggtcggagcggtgg 224
|| ||||| || ||||||||||||||||||||||||||||| || ||||| || |||||
Sbjct: 753 gcaccaacaggattgaagtacctgagcagtatgatcttccaatcagggtctgaacggtgc 694
Query: 225 acgtcgcggcagatgtcttcaatcacaagctttgtccgcccatagggattggtggcgcag 284
|| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 693 acatcgcgacagatgtcttcaatcacaagcttggtccgcccatagggattggtggcgcaa 634
Query: 285 agcgggaattcttcggtgcatgg 307
|||||||||||||||||||||||
Sbjct: 633 agcgggaattcttcggtgcatgg 611
>gb|CD432207.1|CD432207 ETH1_26_G11.g1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_26_G11_A002 5', mRNA sequence
Length = 788
Score = 228 bits (115), Expect = 2e-058
Identities = 154/167 (92%)
Strand = Plus / Minus
Query: 141 tcgccgatgtacccgcttggatgagcgccaacggggttgaagtacctgagcagtatgatc 200
||||||||||| |||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 788 tcgccgatgtatccgcttggatgagcaccaacaggattgaagtacctgagcagtatgatc 729
Query: 201 ttccagtcggggtcggagcggtggacgtcgcggcagatgtcttcaatcacaagctttgtc 260
||||| || ||||| || ||||| || ||||| ||||||||||||||||||||||| |||
Sbjct: 728 ttccaatcagggtctgaacggtgcacatcgcgacagatgtcttcaatcacaagcttggtc 669
Query: 261 cgcccatagggattggtggcgcagagcgggaattcttcggtgcatgg 307
||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 668 cgcccatagggattggtggcgcaaagcgggaattcttcggtgcatgg 622
>gb|BG560333.1|BG560333 RHIZ2_73_B06.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 574
Score = 216 bits (109), Expect = 9e-055
Identities = 148/161 (91%)
Strand = Plus / Minus
Query: 147 atgtacccgcttggatgagcgccaacggggttgaagtacctgagcagtatgatcttccag 206
||||| |||||||||||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 574 atgtatccgcttggatgagcaccaacaggattgaagtacctgagcagtatgatcttccaa 515
Query: 207 tcggggtcggagcggtggacgtcgcggcagatgtcttcaatcacaagctttgtccgccca 266
|| ||||| || ||||| || ||||| ||||||||||||||||||||||| |||||||||
Sbjct: 514 tcagggtctgaacggtgcacatcgcgacagatgtcttcaatcacaagcttggtccgccca 455
Query: 267 tagggattggtggcgcagagcgggaattcttcggtgcatgg 307
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 454 tagggattggtggcgcaaagcgggaattcttcggtgcatgg 414
>gb|BG560363.1|BG560363 RHIZ2_73_E06.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 566
Score = 208 bits (105), Expect = 2e-052
Identities = 141/153 (92%)
Strand = Plus / Minus
Query: 155 gcttggatgagcgccaacggggttgaagtacctgagcagtatgatcttccagtcggggtc 214
|||||||||||| ||||| || ||||||||||||||||||||||||||||| || |||||
Sbjct: 566 gcttggatgagcaccaacaggattgaagtacctgagcagtatgatcttccaatcagggtc 507
Query: 215 ggagcggtggacgtcgcggcagatgtcttcaatcacaagctttgtccgcccatagggatt 274
|| ||||| || ||||| ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 506 tgaacggtgcacatcgcgacagatgtcttcaatcacaagcttggtccgcccatagggatt 447
Query: 275 ggtggcgcagagcgggaattcttcggtgcatgg 307
||||||||| |||||||||||||||||||||||
Sbjct: 446 ggtggcgcaaagcgggaattcttcggtgcatgg 414
>gb|CN149722.1|CN149722 WOUND1_64_B06.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_64_B06_A002 5', mRNA sequence
Length = 755
Score = 182 bits (92), Expect = 1e-044
Identities = 128/140 (91%)
Strand = Plus / Minus
Query: 168 ccaacggggttgaagtacctgagcagtatgatcttccagtcggggtcggagcggtggacg 227
||||| || ||||||||||||||||||||||||||||| || |||| || ||||| ||
Sbjct: 755 ccaacaggattgaagtacctgagcagtatgatcttccaatcagggtgtgaccggtgcaca 696
Query: 228 tcgcggcagatgtcttcaatcacaagctttgtccgcccatagggattggtggcgcagagc 287
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 695 tcgcgacagatgtcttcaatcacaagcttggtccgcccatagggattggtggcgcaaagc 636
Query: 288 gggaattcttcggtgcatgg 307
||||||||||||||||||||
Sbjct: 635 gggaattcttcggtgcatgg 616
>gb|BM325263.1|BM325263 PIC1_42_D10.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 560
Score = 180 bits (91), Expect = 5e-044
Identities = 121/131 (92%)
Strand = Plus / Minus
Query: 177 ttgaagtacctgagcagtatgatcttccagtcggggtcggagcggtggacgtcgcggcag 236
||||||||||| ||||||||||||||||| || ||||| || ||||| || ||||| |||
Sbjct: 553 ttgaagtacctaagcagtatgatcttccaatcagggtctgaacggtgcacatcgcgacag 494
Query: 237 atgtcttcaatcacaagctttgtccgcccatagggattggtggcgcagagcgggaattct 296
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||
Sbjct: 493 atgtcttcaatcacaagcttggtccgcccatagggattggtggcgcaaagcgggaattct 434
Query: 297 tcggtgcatgg 307
|||||||||||
Sbjct: 433 tcggtgcatgg 423
>gb|CN147179.1|CN147179 WOUND1_48_D07.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_48_D07_A002 3', mRNA sequence
Length = 743
Score = 153 bits (77), Expect = 1e-035
Identities = 113/125 (90%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatccttggtgctgtagtccgtcccgtag 62
||||| ||||||||||||||||||||||| |||||||| || ||||||| || || |||
Sbjct: 125 acaacatggatgtaatcacgcaccccagttccatcctttgtattgtagtctgttccatag 66
Query: 63 accgtgaggtgaggtaacctcccaacagcgacttgctgcacgtagggcatcaggttgttc 122
|||||||||||||||||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 65 accgtgaggtgaggtaacctcccaacagcgacttgctgaacatagggcatcaagttgttt 6
Query: 123 gggac 127
|||||
Sbjct: 5 gggac 1
>gb|CD207582.1|CD207582 HS1_33_C08.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_33_C08_A012 5', mRNA sequence
Length = 721
Score = 137 bits (69), Expect = 7e-031
Identities = 84/89 (94%)
Strand = Plus / Minus
Query: 219 cggtggacgtcgcggcagatgtcttcaatcacaagctttgtccgcccatagggattggtg 278
||||| || ||||| ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 720 cggtgcacatcgcgacagatgtcttcaatcacaagcttggtccgcccatagggattggtg 661
Query: 279 gcgcagagcgggaattcttcggtgcatgg 307
||||| |||||||||||||||||||||||
Sbjct: 660 gcgcaaagcgggaattcttcggtgcatgg 632
>gb|CD208040.1|CD208040 HS1_36_D12.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_36_D12_A012 5', mRNA sequence
Length = 708
Score = 135 bits (68), Expect = 3e-030
Identities = 77/80 (96%)
Strand = Plus / Minus
Query: 228 tcgcggcagatgtcttcaatcacaagctttgtccgcccatagggattggtggcgcagagc 287
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 702 tcgcgacagatgtcttcaatcacaagcttggtccgcccatagggattggtggcgcaaagc 643
Query: 288 gggaattcttcggtgcatgg 307
||||||||||||||||||||
Sbjct: 642 gggaattcttcggtgcatgg 623
>gb|CF427115.1|CF427115 PH1_3_F11.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_3_F11_A002 5', mRNA sequence
Length = 494
Score = 135 bits (68), Expect = 3e-030
Identities = 77/80 (96%)
Strand = Plus / Minus
Query: 228 tcgcggcagatgtcttcaatcacaagctttgtccgcccatagggattggtggcgcagagc 287
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 486 tcgcgacagatgtcttcaatcacaagcttggtccgcccatagggattggtggcgcaaagc 427
Query: 288 gggaattcttcggtgcatgg 307
||||||||||||||||||||
Sbjct: 426 gggaattcttcggtgcatgg 407
>gb|CD204270.1|CD204270 HS1_4_G11.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA clone
HS1_4_G11_A012 5', mRNA sequence
Length = 724
Score = 127 bits (64), Expect = 6e-028
Identities = 70/72 (97%)
Strand = Plus / Minus
Query: 236 gatgtcttcaatcacaagctttgtccgcccatagggattggtggcgcagagcgggaattc 295
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 687 gatgtcttcaatcacaagcttggtccgcccatagggattggtggcgcaaagcgggaattc 628
Query: 296 ttcggtgcatgg 307
||||||||||||
Sbjct: 627 ttcggtgcatgg 616
>gb|CN149638.1|CN149638 WOUND1_64_B06.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_64_B06_A002 3', mRNA sequence
Length = 717
Score = 123 bits (62), Expect = 1e-026
Identities = 89/98 (90%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatccttggtgctgtagtccgtcccgtag 62
||||| ||||||||||||||||||||||| |||||||| | ||||||| || || |||
Sbjct: 98 acaacatggatgtaatcacgcaccccagttccatcctttggattgtagtctgttccatag 39
Query: 63 accgtgaggtgaggtaacctcccaacagcgacttgctg 100
||||||||||||||||||||||||||||||||||||||
Sbjct: 38 accgtgaggtgaggtaacctcccaacagcgacttgctg 1
>gb|CX615956.1|CX615956 GABR1_25_A05.b1_A002 GA- or brassinolide-treated seedlings
Sorghum bicolor cDNA clone GABR1_25_A05_A002 3', mRNA
sequence
Length = 719
Score = 111 bits (56), Expect = 4e-023
Identities = 80/88 (90%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatccttggtgctgtagtccgtcccgtag 62
||||| ||||||||||||||||||||||| |||||||| || ||||||| || || |||
Sbjct: 88 acaacatggatgtaatcacgcaccccagttccatcctttgtattgtagtctgttccatag 29
Query: 63 accgtgaggtgaggtaacctcccaacag 90
||||||||||||||||||||||||||||
Sbjct: 28 accgtgaggtgaggtaacctcccaacag 1
>gb|CX620733.1|CX620733 GABR1_53_D12.g1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_53_D12_A002 5', mRNA sequence
Length = 666
Score = 101 bits (51), Expect = 4e-020
Identities = 57/59 (96%)
Strand = Plus / Minus
Query: 249 acaagctttgtccgcccatagggattggtggcgcagagcgggaattcttcggtgcatgg 307
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 666 acaagcttggtccgcccatagggattggtggcgcaaagcgggaattcttcggtgcatgg 608
>gb|CB929002.1|CB929002 ABA1_38_A08.g1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_38_A08_A012 5', mRNA sequence
Length = 660
Score = 97.6 bits (49), Expect = 6e-019
Identities = 55/57 (96%)
Strand = Plus / Minus
Query: 251 aagctttgtccgcccatagggattggtggcgcagagcgggaattcttcggtgcatgg 307
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 660 aagcttggtccgcccatagggattggtggcgcaaagcgggaattcttcggtgcatgg 604
>gb|CD233383.1|CD233383 SS1_13_A05.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_13_A05_A012 5', mRNA sequence
Length = 665
Score = 91.7 bits (46), Expect = 3e-017
Identities = 49/50 (98%)
Strand = Plus / Minus
Query: 258 gtccgcccatagggattggtggcgcagagcgggaattcttcggtgcatgg 307
|||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 665 gtccgcccatagggattggtggcgcaaagcgggaattcttcggtgcatgg 616
>gb|CB928743.1|CB928743 ABA1_17_E08.g1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_17_E08_A012 5', mRNA sequence
Length = 659
Score = 79.8 bits (40), Expect = 1e-013
Identities = 43/44 (97%)
Strand = Plus / Minus
Query: 264 ccatagggattggtggcgcagagcgggaattcttcggtgcatgg 307
|||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 659 ccatagggattggtggcgcaaagcgggaattcttcggtgcatgg 616
>gb|CD233562.1|CD233562 SS1_2_B10.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_2_B10_A012 5', mRNA sequence
Length = 662
Score = 71.9 bits (36), Expect = 3e-011
Identities = 39/40 (97%)
Strand = Plus / Minus
Query: 268 agggattggtggcgcagagcgggaattcttcggtgcatgg 307
|||||||||||||||| |||||||||||||||||||||||
Sbjct: 662 agggattggtggcgcaaagcgggaattcttcggtgcatgg 623
>gb|BG412608.1|BG412608 OV2_36_E11.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 620
Score = 60.0 bits (30), Expect = 1e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatcctt 40
||||| ||||||||||||||||||||||| ||||||||
Sbjct: 49 acaacatggatgtaatcacgcaccccagttccatcctt 12
>gb|CB928908.1|CB928908 ABA1_38_A08.b1_A012 Abscisic acid-treated seedlings Sorghum
bicolor cDNA clone ABA1_38_A08_A012 3', mRNA sequence
Length = 690
Score = 60.0 bits (30), Expect = 1e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatcctt 40
||||| ||||||||||||||||||||||| ||||||||
Sbjct: 58 acaacatggatgtaatcacgcaccccagttccatcctt 21
>gb|CD203981.1|CD203981 HS1_3_B06.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_3_B06_A012 3', mRNA sequence
Length = 672
Score = 60.0 bits (30), Expect = 1e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatcctt 40
||||| ||||||||||||||||||||||| ||||||||
Sbjct: 39 acaacatggatgtaatcacgcaccccagttccatcctt 2
>gb|CD207954.1|CD207954 HS1_36_D12.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_36_D12_A012 3', mRNA sequence
Length = 687
Score = 60.0 bits (30), Expect = 1e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatcctt 40
||||| ||||||||||||||||||||||| ||||||||
Sbjct: 58 acaacatggatgtaatcacgcaccccagttccatcctt 21
>gb|CD208815.1|CD208815 HS1_44_A11.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_44_A11_A012 3', mRNA sequence
Length = 676
Score = 60.0 bits (30), Expect = 1e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatcctt 40
||||| ||||||||||||||||||||||| ||||||||
Sbjct: 39 acaacatggatgtaatcacgcaccccagttccatcctt 2
>gb|CD220490.1|CD220490 CCC1_67_A10.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_67_A10_A007 5', mRNA sequence
Length = 645
Score = 60.0 bits (30), Expect = 1e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 274 tggtggcgcagagcgggaattcttcggtgcatgg 307
|||||||||| |||||||||||||||||||||||
Sbjct: 645 tggtggcgcaaagcgggaattcttcggtgcatgg 612
>gb|CD432110.1|CD432110 ETH1_26_G11.b1_A002 Ethylene-treated seedlings Sorghum bicolor
cDNA clone ETH1_26_G11_A002 3', mRNA sequence
Length = 674
Score = 60.0 bits (30), Expect = 1e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatcctt 40
||||| ||||||||||||||||||||||| ||||||||
Sbjct: 58 acaacatggatgtaatcacgcaccccagttccatcctt 21
>gb|CX620652.1|CX620652 GABR1_53_D12.b1_A002 GA- or brassinolide-treated seedlings
Sorghum bicolor cDNA clone GABR1_53_D12_A002 3', mRNA
sequence
Length = 719
Score = 60.0 bits (30), Expect = 1e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcaccccagtcccatcctt 40
||||| ||||||||||||||||||||||| ||||||||
Sbjct: 57 acaacatggatgtaatcacgcaccccagttccatcctt 20
>gb|BE595856.1|BE595856 PI1_49_B01.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 601
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcacccca 29
||||| |||||||||||||||||||||
Sbjct: 35 acaacatggatgtaatcacgcacccca 9
>gb|BE596303.1|BE596303 PI1_49_B01.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 526
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 3 acaacgtggatgtaatcacgcacccca 29
||||| |||||||||||||||||||||
Sbjct: 35 acaacatggatgtaatcacgcacccca 9
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 50,513
Number of Sequences: 832831
Number of extensions: 50513
Number of successful extensions: 13079
Number of sequences better than 0.5: 30
Number of HSP's better than 0.5 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13033
Number of HSP's gapped (non-prelim): 46
length of query: 308
length of database: 491,359,669
effective HSP length: 19
effective length of query: 289
effective length of database: 475,535,880
effective search space: 137429869320
effective search space used: 137429869320
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)