BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 6293482.2.1
(2042 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW237503.1|CW237503 104_693_11216207_148_37517_082 Sorgh... 103 6e-020
gb|CW265862.1|CW265862 104_735_11232115_148_35265_074 Sorgh... 103 6e-020
gb|CW460327.1|CW460327 fsbb001f207h20k0 Sorghum methylation... 103 6e-020
gb|CW481020.1|CW481020 fsbb001f240g01k0 Sorghum methylation... 103 6e-020
gb|BE599417.1|BE599417 PI1_87_C08.b1_A002 Pathogen induced ... 103 6e-020
gb|CD425104.1|CD425104 SA1_10_A05.g1_A002 Salicylic acid-tr... 103 6e-020
gb|CD427429.1|CD427429 SA1_30_F07.g1_A002 Salicylic acid-tr... 103 6e-020
gb|CN133967.1|CN133967 OX1_19_A01.g1_A002 Oxidatively-stres... 103 6e-020
gb|CW265861.1|CW265861 104_735_11232115_116_35269_074 Sorgh... 82 2e-013
gb|CL185775.1|CL185775 104_400_10899767_116_32402_094 Sorgh... 70 9e-010
gb|CW087487.1|CW087487 104_432_10947661_114_32550_061 Sorgh... 70 9e-010
gb|CW112888.1|CW112888 104_487_11105141_116_34553_031 Sorgh... 70 9e-010
gb|CD227071.1|CD227071 CCC1_4_A07.b1_A007 Callus culture/ce... 70 9e-010
gb|AC152913.1| Sorghum bicolor clone SB106M24, *** SEQUENCI... 70 9e-010
gb|CL174916.1|CL174916 104_379_10892004_148_31768_372 Sorgh... 68 4e-009
gb|CW033973.1|CW033973 104_263_10502270_115_30360 Sorghum m... 68 4e-009
gb|CW238741.1|CW238741 104_695_11216895_116_37527_052 Sorgh... 68 4e-009
gb|CW238742.1|CW238742 104_695_11216895_148_37524_052 Sorgh... 68 4e-009
gb|CW356439.1|CW356439 fsbb001f021i08k0 Sorghum methylation... 68 4e-009
gb|CW423432.1|CW423432 fsbb001f133e01f0 Sorghum methylation... 68 4e-009
gb|CW062310.1|CW062310 104_307_10521269_1_30043 Sorghum met... 62 2e-007
gb|CW323938.1|CW323938 104_818_11476894_148_35909_091 Sorgh... 62 2e-007
gb|CN128570.1|CN128570 RHOH1_30_G11.b1_A002 Acid- and alkal... 62 2e-007
gb|CW265642.1|CW265642 104_735_11231994_148_35268_079 Sorgh... 60 9e-007
gb|CW475267.1|CW475267 fsbb001f231i17k0 Sorghum methylation... 60 9e-007
gb|BG053297.1|BG053297 RHIZ2_25_F08.b1_A003 Rhizome2 (RHIZ2... 60 9e-007
gb|BG101809.1|BG101809 RHIZ2_22_F11.g1_A003 Rhizome2 (RHIZ2... 60 9e-007
gb|BG102350.1|BG102350 RHIZ2_22_F11.b1_A003 Rhizome2 (RHIZ2... 60 9e-007
gb|CL158338.1|CL158338 104_347_10803476_114_31377_068 Sorgh... 58 3e-006
gb|CW317464.1|CW317464 104_809_11473427_116_35861_044 Sorgh... 58 3e-006
gb|CL190528.1|CL190528 104_408_10906137_114_32483_035 Sorgh... 56 1e-005
gb|CW164797.1|CW164797 104_572_11152171_116_36465_066 Sorgh... 56 1e-005
gb|CW300393.1|CW300393 104_783_11463632_148_36251_020 Sorgh... 56 1e-005
gb|CW464096.1|CW464096 fsbb001f213c15k0 Sorghum methylation... 56 1e-005
gb|CL151818.1|CL151818 104_334_10779515_114_31361_299 Sorgh... 54 5e-005
gb|CW030659.1|CW030659 104_258_10500355_114_30403 Sorghum m... 54 5e-005
gb|CW030660.1|CW030660 104_258_10500355_116_30404 Sorghum m... 54 5e-005
gb|CW138607.1|CW138607 104_528_11134785_116_34890_041 Sorgh... 54 5e-005
gb|CW138608.1|CW138608 104_528_11134785_148_34894_041 Sorgh... 54 5e-005
gb|CW207268.1|CW207268 104_636_11188037_116_36971_025 Sorgh... 54 5e-005
gb|CW247245.1|CW247245 104_708_11221685_116_35017_027 Sorgh... 54 5e-005
gb|CW300561.1|CW300561 104_784_11463730_116_36260_047 Sorgh... 54 5e-005
gb|CW312225.1|CW312225 104_802_11470645_148_35778_063 Sorgh... 54 5e-005
gb|CW448555.1|CW448555 fsbb001f182d20f0 Sorghum methylation... 54 5e-005
gb|CW457788.1|CW457788 fsbb001f203m03k0 Sorghum methylation... 54 5e-005
gb|CW490044.1|CW490044 fsbb001f275e17f0 Sorghum methylation... 54 5e-005
gb|AW680736.1|AW680736 WS1_6_C01.g1_A002 Water-stressed 1 (... 54 5e-005
gb|AW747003.1|AW747003 WS1_65_A05.b1_A002 Water-stressed 1 ... 54 5e-005
gb|AW747072.1|AW747072 WS1_65_A05.g1_A002 Water-stressed 1 ... 54 5e-005
gb|BE357204.1|BE357204 DG1_147_F07.g1_A002 Dark Grown 1 (DG... 54 5e-005
gb|BE360446.1|BE360446 DG1_63_H09.g1_A002 Dark Grown 1 (DG1... 54 5e-005
gb|BE363172.1|BE363172 DG1_9_G07.g1_A002 Dark Grown 1 (DG1)... 54 5e-005
gb|BE363357.1|BE363357 WS1_62_A01.g1_A002 Water-stressed 1 ... 54 5e-005
gb|BE592275.1|BE592275 WS1_90_F06.g1_A002 Water-stressed 1 ... 54 5e-005
gb|BE592808.1|BE592808 WS1_90_F06.b1_A002 Water-stressed 1 ... 54 5e-005
gb|BE600555.1|BE600555 PI1_94_F03.b1_A002 Pathogen induced ... 54 5e-005
gb|CB927631.1|CB927631 ABA1_27_D01.b1_A012 Abscisic acid-tr... 54 5e-005
gb|CD219881.1|CD219881 CCC1_59_D12.g1_A007 Callus culture/c... 54 5e-005
gb|CD226777.1|CD226777 CCC1_48_B05.b1_A007 Callus culture/c... 54 5e-005
gb|CD226817.1|CD226817 CCC1_48_F12.b1_A007 Callus culture/c... 54 5e-005
gb|CD423734.1|CD423734 SA1_1_A11.b1_A002 Salicylic acid-tre... 54 5e-005
gb|CD426490.1|CD426490 SA1_21_B12.b1_A002 Salicylic acid-tr... 54 5e-005
gb|CF756592.1|CF756592 DSAF1_6_A10.g1_A011 Drought-stressed... 54 5e-005
gb|CF758672.1|CF758672 DSAF1_35_C04.g1_A011 Drought-stresse... 54 5e-005
gb|CF761554.1|CF761554 DSAF1_77_F10.b1_A011 Drought-stresse... 54 5e-005
gb|CN126134.1|CN126134 RHOH1_15_H01.b1_A002 Acid- and alkal... 54 5e-005
gb|CN126472.1|CN126472 RHOH1_17_H02.b1_A002 Acid- and alkal... 54 5e-005
gb|CN130724.1|CN130724 RHOH1_43_H05.b1_A002 Acid- and alkal... 54 5e-005
gb|CN132285.1|CN132285 OX1_5_E12.b1_A002 Oxidatively-stress... 54 5e-005
gb|CN135339.1|CN135339 OX1_32_D04.b1_A002 Oxidatively-stres... 54 5e-005
gb|CN135408.1|CN135408 OX1_32_D04.g1_A002 Oxidatively-stres... 54 5e-005
gb|CN135639.1|CN135639 OX1_38_C10.b1_A002 Oxidatively-stres... 54 5e-005
gb|CN138170.1|CN138170 OX1_62_D10.b1_A002 Oxidatively-stres... 54 5e-005
gb|CN141771.1|CN141771 WOUND1_1_F03.g1_A002 Wounded leaves ... 54 5e-005
gb|CN142468.1|CN142468 WOUND1_10_E08.b1_A002 Wounded leaves... 54 5e-005
gb|CN142639.1|CN142639 WOUND1_11_F04.b1_A002 Wounded leaves... 54 5e-005
gb|CN142892.1|CN142892 WOUND1_13_A05.b1_A002 Wounded leaves... 54 5e-005
gb|CN144061.1|CN144061 WOUND1_20_A06.b1_A002 Wounded leaves... 54 5e-005
gb|CN144901.1|CN144901 WOUND1_25_D03.g1_A002 Wounded leaves... 54 5e-005
gb|CN145020.1|CN145020 WOUND1_26_G06.b2_A002 Wounded leaves... 54 5e-005
gb|CN145141.1|CN145141 WOUND1_27_B11.b2_A002 Wounded leaves... 54 5e-005
gb|CN148254.1|CN148254 WOUND1_55_D07.b1_A002 Wounded leaves... 54 5e-005
gb|CN148860.1|CN148860 WOUND1_59_F07.b1_A002 Wounded leaves... 54 5e-005
gb|CN149498.1|CN149498 WOUND1_63_D05.b1_A002 Wounded leaves... 54 5e-005
gb|CN149832.1|CN149832 WOUND1_65_D06.b1_A002 Wounded leaves... 54 5e-005
gb|CN151354.1|CN151354 WOUND1_75_A07.b1_A002 Wounded leaves... 54 5e-005
gb|CF675649.1|CF675649 CYP71E1 Subtractive cDNA library fro... 54 5e-005
gb|CX606656.1|CX606656 ANR1_4_F07.b1_A002 Anaerobic roots S... 54 5e-005
gb|CX606785.1|CX606785 ANR1_5_A08.b1_A002 Anaerobic roots S... 54 5e-005
gb|CX606858.1|CX606858 ANR1_5_H01.b1_A002 Anaerobic roots S... 54 5e-005
gb|CX607037.1|CX607037 ANR1_6_G11.b1_A002 Anaerobic roots S... 54 5e-005
gb|CX607388.1|CX607388 ANR1_8_G10.b1_A002 Anaerobic roots S... 54 5e-005
gb|CX608012.1|CX608012 ANR1_32_D01.b1_A002 Anaerobic roots ... 54 5e-005
gb|CX609508.1|CX609508 ANR1_13_D05.b1_A002 Anaerobic roots ... 54 5e-005
gb|CX610000.1|CX610000 ANR1_16_B12.b1_A002 Anaerobic roots ... 54 5e-005
gb|CX610482.1|CX610482 ANR1_19_B04.b1_A002 Anaerobic roots ... 54 5e-005
gb|CX611220.1|CX611220 ANR1_23_G09.b1_A002 Anaerobic roots ... 54 5e-005
gb|CX611683.1|CX611683 ANR1_26_C10.b1_A002 Anaerobic roots ... 54 5e-005
gb|CX612239.1|CX612239 GABR1_1_G06.b1_A002 GA- or brassinol... 54 5e-005
gb|CX612948.1|CX612948 GABR1_5_H05.b1_A002 GA- or brassinol... 54 5e-005
gb|CX612952.1|CX612952 GABR1_5_H09.b1_A002 GA- or brassinol... 54 5e-005
gb|CX613292.1|CX613292 GABR1_7_H02.b1_A002 GA- or brassinol... 54 5e-005
gb|CX613397.1|CX613397 GABR1_8_A02.b1_A002 GA- or brassinol... 54 5e-005
gb|CX614280.1|CX614280 GABR1_13_D05.b1_A002 GA- or brassino... 54 5e-005
gb|CX615401.1|CX615401 GABR1_20_A01.b1_A002 GA- or brassino... 54 5e-005
gb|CX618160.1|CX618160 GABR1_38_B09.b1_A002 GA- or brassino... 54 5e-005
gb|CX618553.1|CX618553 GABR1_40_G03.b1_A002 GA- or brassino... 54 5e-005
gb|CX620640.1|CX620640 GABR1_53_C11.b1_A002 GA- or brassino... 54 5e-005
gb|CX621968.1|CX621968 GABR1_61_F03.b2_A002 GA- or brassino... 54 5e-005
gb|CX623165.1|CX623165 GABR1_68_C12.b1_A002 GA- or brassino... 54 5e-005
gb|AF029858.1|AF029858 Sorghum bicolor cytochrome P450 CYP7... 54 5e-005
gb|CL153773.1|CL153773 104_338_10780950_116_31370_198 Sorgh... 52 2e-004
gb|CW115722.1|CW115722 104_491_11106716_116_34601_080 Sorgh... 52 2e-004
gb|CW121754.1|CW121754 104_499_11110079_148_34659_084 Sorgh... 52 2e-004
gb|CW146760.1|CW146760 104_539_11139160_116_34991_052 Sorgh... 52 2e-004
gb|CW207619.1|CW207619 104_636_11188248_116_36976_082 Sorgh... 52 2e-004
gb|CW207620.1|CW207620 104_636_11188248_148_36968_082 Sorgh... 52 2e-004
gb|CW217293.1|CW217293 104_650_11195580_116_37132_040 Sorgh... 52 2e-004
gb|CW228065.1|CW228065 104_667_11206156_116_37246_004 Sorgh... 52 2e-004
gb|CW492912.1|CW492912 fsbb001f283h01k0 Sorghum methylation... 52 2e-004
gb|CW500161.1|CW500161 fsbb001f295f07k0 Sorghum methylation... 52 2e-004
gb|CW500198.1|CW500198 fsbb001f295g07k0 Sorghum methylation... 52 2e-004
gb|BE357542.1|BE357542 DG1_21_G06.b1_A002 Dark Grown 1 (DG1... 52 2e-004
gb|CD426965.1|CD426965 SA1_26_D12.b1_A002 Salicylic acid-tr... 52 2e-004
gb|CX606441.1|CX606441 ANR1_3_C01.b1_A002 Anaerobic roots S... 52 2e-004
gb|CX610986.1|CX610986 ANR1_22_B03.b1_A002 Anaerobic roots ... 52 2e-004
gb|CX611829.1|CX611829 ANR1_27_A08.b1_A002 Anaerobic roots ... 52 2e-004
gb|AF029856.1|AF029856 Sorghum bicolor cytochrome P450 CYP9... 52 2e-004
gb|CW032003.1|CW032003 104_260_10501126_114_30365 Sorghum m... 50 8e-004
gb|CW159482.1|CW159482 104_565_11149381_116_36407_053 Sorgh... 50 8e-004
gb|CW203427.1|CW203427 104_631_11186016_148_37094_096 Sorgh... 50 8e-004
gb|CW396920.1|CW396920 fsbb001f085j10k0 Sorghum methylation... 50 8e-004
gb|BE360532.1|BE360532 DG1_64_F09.b1_A002 Dark Grown 1 (DG1... 50 8e-004
gb|CL152904.1|CL152904 104_336_10780327_114_31365_343 Sorgh... 48 0.003
gb|CL157508.1|CL157508 104_345_10783630_114_31477_190 Sorgh... 48 0.003
gb|CL179027.1|CL179027 104_387_10895001_116_31906_297 Sorgh... 48 0.003
gb|CL197054.1|CL197054 104_423_10943482_114_32326_035 Sorgh... 48 0.003
gb|CL197055.1|CL197055 104_423_10943482_116_32330_035 Sorgh... 48 0.003
gb|CW031279.1|CW031279 104_259_10500717_114_30397 Sorghum m... 48 0.003
gb|CW046545.1|CW046545 104_283_10510266_115_30138 Sorghum m... 48 0.003
gb|CW047894.1|CW047894 104_285_10512935_115_30217 Sorghum m... 48 0.003
gb|CW114223.1|CW114223 104_488_11105877_148_34561_081 Sorgh... 48 0.003
gb|CW115514.1|CW115514 104_490_11106601_148_34588_003 Sorgh... 48 0.003
gb|CW121588.1|CW121588 104_499_11109987_148_34657_006 Sorgh... 48 0.003
gb|CW126787.1|CW126787 104_507_11113083_116_34734_006 Sorgh... 48 0.003
gb|CW214790.1|CW214790 104_646_11194199_148_37052_082 Sorgh... 48 0.003
gb|CW234170.1|CW234170 104_687_11213839_116_37381_020 Sorgh... 48 0.003
gb|CW234171.1|CW234171 104_687_11213839_148_37382_020 Sorgh... 48 0.003
gb|CW257988.1|CW257988 104_723_11227632_148_35157_086 Sorgh... 48 0.003
gb|CW278490.1|CW278490 104_752_11406575_148_35682_082 Sorgh... 48 0.003
gb|CW282234.1|CW282234 104_758_11408605_148_35469_059 Sorgh... 48 0.003
gb|CW304081.1|CW304081 104_788_11465588_148_35696_066 Sorgh... 48 0.003
gb|CW387965.1|CW387965 fsbb001f072i13f0 Sorghum methylation... 48 0.003
gb|CW395241.1|CW395241 fsbb001f083d04f0 Sorghum methylation... 48 0.003
gb|CW423885.1|CW423885 fsbb001f133o22k0 Sorghum methylation... 48 0.003
gb|CW448556.1|CW448556 fsbb001f182d20k0 Sorghum methylation... 48 0.003
gb|CW457787.1|CW457787 fsbb001f203m03f0 Sorghum methylation... 48 0.003
gb|CW465569.1|CW465569 fsbb001f216g11f0 Sorghum methylation... 48 0.003
gb|CW493615.1|CW493615 fsbb001f284h14f0 Sorghum methylation... 48 0.003
gb|BE593764.1|BE593764 WS1_101_H08.g1_A002 Water-stressed 1... 48 0.003
gb|BE600290.1|BE600290 PI1_94_F03.g1_A002 Pathogen induced ... 48 0.003
gb|BF587952.1|BF587952 FM1_34_H09.g1_A003 Floral-Induced Me... 48 0.003
gb|BG357638.1|BG357638 OV2_32_D07.g1_A002 Ovary 2 (OV2) Sor... 48 0.003
gb|BM323991.1|BM323991 PIC1_30_A06.b1_A002 Pathogen-infecte... 48 0.003
gb|BM328505.1|BM328505 PIC1_30_A06.g1_A002 Pathogen-infecte... 48 0.003
gb|CD211460.1|CD211460 HS1_60_D11.b1_A012 Heat-shocked seed... 48 0.003
gb|CF758281.1|CF758281 DSAF1_29_G09.g1_A011 Drought-stresse... 48 0.003
gb|CN128554.1|CN128554 RHOH1_30_F06.b1_A002 Acid- and alkal... 48 0.003
gb|CN137129.1|CN137129 OX1_55_H03.b1_A002 Oxidatively-stres... 48 0.003
gb|CN140437.1|CN140437 OX1_36_E03.b1_A002 Oxidatively-stres... 48 0.003
gb|CN143955.1|CN143955 WOUND1_19_H05.b1_A002 Wounded leaves... 48 0.003
gb|CN144556.1|CN144556 WOUND1_23_D02.b1_A002 Wounded leaves... 48 0.003
gb|CN145888.1|CN145888 WOUND1_36_A12.b1_A002 Wounded leaves... 48 0.003
gb|CN145921.1|CN145921 WOUND1_36_E04.b1_A002 Wounded leaves... 48 0.003
gb|CN146237.1|CN146237 WOUND1_39_B09.b1_A002 Wounded leaves... 48 0.003
gb|CN148369.1|CN148369 WOUND1_56_A10.b1_A002 Wounded leaves... 48 0.003
gb|CN149843.1|CN149843 WOUND1_65_E07.b1_A002 Wounded leaves... 48 0.003
gb|CN151205.1|CN151205 WOUND1_74_C01.b1_A002 Wounded leaves... 48 0.003
gb|CN151280.1|CN151280 WOUND1_74_C01.g1_A002 Wounded leaves... 48 0.003
gb|CX607513.1|CX607513 ANR1_29_D09.b1_A002 Anaerobic roots ... 48 0.003
gb|CX607822.1|CX607822 ANR1_31_A05.b1_A002 Anaerobic roots ... 48 0.003
gb|CX607869.1|CX607869 ANR1_31_F08.b1_A002 Anaerobic roots ... 48 0.003
gb|CX608015.1|CX608015 ANR1_32_D04.b1_A002 Anaerobic roots ... 48 0.003
gb|CX609033.1|CX609033 ANR1_10_F03.b1_A002 Anaerobic roots ... 48 0.003
gb|CX609337.1|CX609337 ANR1_12_C06.b1_A002 Anaerobic roots ... 48 0.003
gb|CX609688.1|CX609688 ANR1_14_D08.b1_A002 Anaerobic roots ... 48 0.003
gb|CX611881.1|CX611881 ANR1_27_F07.b1_A002 Anaerobic roots ... 48 0.003
gb|CX613106.1|CX613106 GABR1_6_G01.b1_A002 GA- or brassinol... 48 0.003
gb|CX614757.1|CX614757 GABR1_16_D04.b1_A002 GA- or brassino... 48 0.003
gb|CX616979.1|CX616979 GABR1_31_B04.b1_A002 GA- or brassino... 48 0.003
gb|CX618551.1|CX618551 GABR1_40_F12.b1_A002 GA- or brassino... 48 0.003
gb|CX618710.1|CX618710 GABR1_41_E09.b1_A002 GA- or brassino... 48 0.003
gb|CX618716.1|CX618716 GABR1_41_F04.b1_A002 GA- or brassino... 48 0.003
gb|CX619188.1|CX619188 GABR1_44_B03.b1_A002 GA- or brassino... 48 0.003
gb|CX619860.1|CX619860 GABR1_48_F11.b1_A002 GA- or brassino... 48 0.003
gb|CX620792.1|CX620792 GABR1_54_C01.b1_A002 GA- or brassino... 48 0.003
gb|CX621647.1|CX621647 GABR1_59_G11.b1_A002 GA- or brassino... 48 0.003
gb|CX622273.1|CX622273 GABR1_63_A12.b2_A002 GA- or brassino... 48 0.003
gb|CX622462.1|CX622462 GABR1_64_D02.b2_A002 GA- or brassino... 48 0.003
gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase ... 48 0.003
gb|CL170439.1|CL170439 104_371_10813812_148_31790_132 Sorgh... 46 0.013
gb|CL179028.1|CL179028 104_387_10895001_148_31905_297 Sorgh... 46 0.013
gb|CW036870.1|CW036870 104_268_10504018_115_30382 Sorghum m... 46 0.013
gb|CW067431.1|CW067431 104_315_10524273_114_30124 Sorghum m... 46 0.013
gb|CW071935.1|CW071935 104_324_10591952_116_30465 Sorghum m... 46 0.013
gb|CW132069.1|CW132069 104_515_11116013_148_34794_027 Sorgh... 46 0.013
gb|CW142446.1|CW142446 104_533_11136861_148_34942_083 Sorgh... 46 0.013
gb|CW164995.1|CW164995 104_573_11152274_116_36471_011 Sorgh... 46 0.013
gb|CW186112.1|CW186112 104_604_11166394_148_36707_047 Sorgh... 46 0.013
gb|CW212697.1|CW212697 104_644_11191159_148_37027_032 Sorgh... 46 0.013
gb|CW229184.1|CW229184 104_670_11207169_116_37259_041 Sorgh... 46 0.013
gb|CW264501.1|CW264501 104_733_11231332_116_35254_010 Sorgh... 46 0.013
gb|CW267381.1|CW267381 104_737_11400703_116_35291_022 Sorgh... 46 0.013
gb|CW283070.1|CW283070 104_759_11409051_116_35479_010 Sorgh... 46 0.013
gb|CW283073.1|CW283073 104_759_11409052_148_35476_010 Sorgh... 46 0.013
gb|CW344397.1|CW344397 104_847_11487932_148_36203_080 Sorgh... 46 0.013
gb|CW350845.1|CW350845 fsbb001f012f16k0 Sorghum methylation... 46 0.013
gb|CW360775.1|CW360775 fsbb001f029a12f0 Sorghum methylation... 46 0.013
gb|CW370954.1|CW370954 fsbb001f046c21k0 Sorghum methylation... 46 0.013
gb|CW375858.1|CW375858 fsbb001f053g17f0 Sorghum methylation... 46 0.013
gb|CW375859.1|CW375859 fsbb001f053g17k0 Sorghum methylation... 46 0.013
gb|CW408891.1|CW408891 fsbb001f102p14f0 Sorghum methylation... 46 0.013
gb|CW469735.1|CW469735 fsbb001f222j11f0 Sorghum methylation... 46 0.013
gb|CW485366.1|CW485366 fsbb001f248b06f0 Sorghum methylation... 46 0.013
gb|CW490045.1|CW490045 fsbb001f275e17k0 Sorghum methylation... 46 0.013
gb|AW671488.1|AW671488 LG1_347_D09.b1_A002 Light Grown 1 (L... 46 0.013
gb|BE360552.1|BE360552 DG1_64_D07.b1_A002 Dark Grown 1 (DG1... 46 0.013
gb|BG049964.1|BG049964 FM1_68_F08.g1_A003 Floral-Induced Me... 46 0.013
gb|BG053008.1|BG053008 RHIZ2_16_C09.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG102572.1|BG102572 RHIZ2_34_F11.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG103237.1|BG103237 RHIZ2_19_H06.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG103558.1|BG103558 RHIZ2_38_A04.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG241437.1|BG241437 RHIZ2_49_B10.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG465866.1|BG465866 RHIZ2_45_E08.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG465910.1|BG465910 RHIZ2_46_B05.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG487882.1|BG487882 RHIZ2_60_E07.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|BG559923.1|BG559923 RHIZ2_75_C11.g1_A003 Rhizome2 (RHIZ2... 46 0.013
gb|CD226485.1|CD226485 CCC1_46_D06.b1_A007 Callus culture/c... 46 0.013
gb|CD430835.1|CD430835 ETH1_5_G07.b1_A002 Ethylene-treated ... 46 0.013
gb|CD432432.1|CD432432 ETH1_30_H03.b1_A002 Ethylene-treated... 46 0.013
gb|CF427349.1|CF427349 PH1_1_H08.b1_A002 Phosphorous-defici... 46 0.013
gb|CF429944.1|CF429944 PH1_25_E07.b1_A002 Phosphorous-defic... 46 0.013
gb|CF431307.1|CF431307 NIT1_5_D02.b1_A002 Nitrogen-deficien... 46 0.013
gb|CN126165.1|CN126165 RHOH1_15_B11.g1_A002 Acid- and alkal... 46 0.013
gb|CN137853.1|CN137853 OX1_60_C10.b1_A002 Oxidatively-stres... 46 0.013
gb|CN144424.1|CN144424 WOUND1_22_D09.b1_A002 Wounded leaves... 46 0.013
gb|CN144817.1|CN144817 WOUND1_25_D03.b2_A002 Wounded leaves... 46 0.013
gb|CN146974.1|CN146974 WOUND1_46_B05.b1_A002 Wounded leaves... 46 0.013
gb|CN150613.1|CN150613 WOUND1_70_H03.b1_A002 Wounded leaves... 46 0.013
gb|CN151700.1|CN151700 WOUND1_77_C01.b1_A002 Wounded leaves... 46 0.013
gb|CN152586.1|CN152586 WOUND1_83_B01.b1_A002 Wounded leaves... 46 0.013
gb|CX609348.1|CX609348 ANR1_12_D07.b1_A002 Anaerobic roots ... 46 0.013
gb|CX610878.1|CX610878 ANR1_21_G12.b1_A002 Anaerobic roots ... 46 0.013
gb|CX611187.1|CX611187 ANR1_23_D08.b1_A002 Anaerobic roots ... 46 0.013
gb|CX613126.1|CX613126 GABR1_6_H11.b1_A002 GA- or brassinol... 46 0.013
gb|CX614891.1|CX614891 GABR1_17_A07.b1_A002 GA- or brassino... 46 0.013
gb|CX617088.1|CX617088 GABR1_31_D06.g1_A002 GA- or brassino... 46 0.013
gb|CX619909.1|CX619909 GABR1_48_D06.g1_A002 GA- or brassino... 46 0.013
gb|DN551794.1|DN551794 pSPR-RT-A-H1_B10_S100 pSPR Sorghum p... 46 0.013
gb|DN552334.1|DN552334 pSPR-RT-A-H2_A01_C319 pSPR Sorghum p... 46 0.013
gb|BZ339043.1|BZ339043 ic29c07.g1 WGS-SbicolorF (JM107 adap... 44 0.051
gb|CL187901.1|CL187901 104_403_10901215_116_32465_018 Sorgh... 44 0.051
gb|CL196350.1|CL196350 104_422_10943001_116_32320_039 Sorgh... 44 0.051
gb|CW056270.1|CW056270 104_297_10517593_115_30173 Sorghum m... 44 0.051
gb|CW066286.1|CW066286 104_313_10523603_115_30147 Sorghum m... 44 0.051
gb|CW081976.1|CW081976 104_422_10943001_114_32345_039 Sorgh... 44 0.051
gb|CW117663.1|CW117663 104_493_11107774_148_34613_083 Sorgh... 44 0.051
gb|CW135891.1|CW135891 104_520_11118086_148_34835_053 Sorgh... 44 0.051
gb|CW200012.1|CW200012 104_625_11183823_116_36857_058 Sorgh... 44 0.051
gb|CW342334.1|CW342334 104_844_11486817_116_36177_045 Sorgh... 44 0.051
gb|CW351440.1|CW351440 fsbb001f013d07k0 Sorghum methylation... 44 0.051
gb|CW360728.1|CW360728 fsbb001f028p06f0 Sorghum methylation... 44 0.051
gb|CW360729.1|CW360729 fsbb001f028p06k0 Sorghum methylation... 44 0.051
gb|CW370049.1|CW370049 fsbb001f044m10f0 Sorghum methylation... 44 0.051
gb|CW430163.1|CW430163 fsbb001f143l23f0 Sorghum methylation... 44 0.051
gb|CW460065.1|CW460065 fsbb001f207b20k0 Sorghum methylation... 44 0.051
gb|CW467911.1|CW467911 fsbb001f219m18f0 Sorghum methylation... 44 0.051
gb|BE598861.1|BE598861 PI1_83_E05.b1_A002 Pathogen induced ... 44 0.051
gb|BG412521.1|BG412521 OV2_35_D06.g1_A002 Ovary 2 (OV2) Sor... 44 0.051
gb|BG465568.1|BG465568 RHIZ2_46_B05.b1_A003 Rhizome2 (RHIZ2... 44 0.051
gb|CN147506.1|CN147506 WOUND1_50_E01.b1_A002 Wounded leaves... 44 0.051
gb|BZ331488.1|BZ331488 hw08h04.b1 WGS-SbicolorF (JM107 adap... 42 0.20
gb|BZ340884.1|BZ340884 ic41f10.b1 WGS-SbicolorF (JM107 adap... 42 0.20
gb|BZ342449.1|BZ342449 ic83e12.b1 WGS-SbicolorF (JM107 adap... 42 0.20
gb|BZ423254.1|BZ423254 id47b10.g1 WGS-SbicolorF (DH5a methy... 42 0.20
gb|BZ625993.1|BZ625993 ih42c11.b1 WGS-SbicolorF (DH5a methy... 42 0.20
gb|CL151466.1|CL151466 104_334_10779271_116_31362_055 Sorgh... 42 0.20
gb|CL153772.1|CL153772 104_338_10780950_114_31369_198 Sorgh... 42 0.20
gb|CL155930.1|CL155930 104_342_10782507_114_31473_219 Sorgh... 42 0.20
gb|CL155931.1|CL155931 104_342_10782507_116_31474_219 Sorgh... 42 0.20
gb|CL157370.1|CL157370 104_345_10783510_114_31477_070 Sorgh... 42 0.20
gb|CL167858.1|CL167858 104_365_10810387_116_31805_067 Sorgh... 42 0.20
gb|CL185511.1|CL185511 104_399_10899583_114_32392_022 Sorgh... 42 0.20
gb|CL185512.1|CL185512 104_399_10899583_116_32396_022 Sorgh... 42 0.20
gb|CL189698.1|CL189698 104_407_10905557_116_32479_027 Sorgh... 42 0.20
gb|CL189801.1|CL189801 104_407_10905635_114_32477_042 Sorgh... 42 0.20
gb|CL189802.1|CL189802 104_407_10905635_116_32481_042 Sorgh... 42 0.20
gb|CL194114.1|CL194114 104_418_10941401_116_32289_075 Sorgh... 42 0.20
gb|CW512334.1|CW512334 115_1_10510444_1_30023 Sorghum unfil... 42 0.20
gb|CW026050.1|CW026050 104_252_10497731_114_30510 Sorghum m... 42 0.20
gb|CW031104.1|CW031104 104_259_10500613_114_30397 Sorghum m... 42 0.20
gb|CW032853.1|CW032853 104_262_10501627_115_30362 Sorghum m... 42 0.20
gb|CW035041.1|CW035041 104_265_10502908_115_30379 Sorghum m... 42 0.20
gb|CW037839.1|CW037839 104_269_10504576_114_30383 Sorghum m... 42 0.20
gb|CW039175.1|CW039175 104_271_10505346_114_30387 Sorghum m... 42 0.20
gb|CW041581.1|CW041581 104_275_10506628_114_30284 Sorghum m... 42 0.20
gb|CW044006.1|CW044006 104_279_10508703_114_30275 Sorghum m... 42 0.20
gb|CW050876.1|CW050876 104_290_10514904_114_30195 Sorghum m... 42 0.20
gb|CW051802.1|CW051802 104_292_10515367_114_30286 Sorghum m... 42 0.20
gb|CW059139.1|CW059139 104_302_10519142_115_30168 Sorghum m... 42 0.20
gb|CW066586.1|CW066586 104_313_10523759_115_30149 Sorghum m... 42 0.20
gb|CW067910.1|CW067910 104_316_10524623_115_30145 Sorghum m... 42 0.20
gb|CW070401.1|CW070401 104_321_10526728_1_30090 Sorghum met... 42 0.20
gb|CW071426.1|CW071426 104_323_10591512_114_30474 Sorghum m... 42 0.20
gb|CW072040.1|CW072040 104_325_10592042_116_30542 Sorghum m... 42 0.20
gb|CW072312.1|CW072312 104_325_10592198_114_30538 Sorghum m... 42 0.20
gb|CW074421.1|CW074421 104_347_10803595_116_31378_187 Sorgh... 42 0.20
gb|CW088702.1|CW088702 104_433_10948289_116_32575_067 Sorgh... 42 0.20
gb|CW093265.1|CW093265 104_456_10999669_116_37469_059 Sorgh... 42 0.20
gb|CW093687.1|CW093687 104_457_10999927_148_37474_032 Sorgh... 42 0.20
gb|CW100130.1|CW100130 104_467_11003932_148_34387_010 Sorgh... 42 0.20
gb|CW110290.1|CW110290 104_483_11103613_148_34521_063 Sorgh... 42 0.20
gb|CW121462.1|CW121462 104_499_11109918_116_34664_025 Sorgh... 42 0.20
gb|CW128892.1|CW128892 104_510_11114265_116_34756_035 Sorgh... 42 0.20
gb|CW129623.1|CW129623 104_511_11114664_148_34761_084 Sorgh... 42 0.20
gb|CW132956.1|CW132956 104_516_11116496_116_34807_024 Sorgh... 42 0.20
gb|CW137012.1|CW137012 104_523_11119067_148_34864_044 Sorgh... 42 0.20
gb|CW147666.1|CW147666 104_542_11140009_148_35006_015 Sorgh... 42 0.20
gb|CW158824.1|CW158824 104_564_11149032_148_36397_084 Sorgh... 42 0.20
gb|CW163404.1|CW163404 104_571_11151442_148_36459_047 Sorgh... 42 0.20
gb|CW169758.1|CW169758 104_579_11154840_116_36502_082 Sorgh... 42 0.20
gb|CW169759.1|CW169759 104_579_11154840_148_36501_082 Sorgh... 42 0.20
gb|CW175671.1|CW175671 104_588_11158069_148_36579_059 Sorgh... 42 0.20
gb|CW176740.1|CW176740 104_589_11158648_148_36588_052 Sorgh... 42 0.20
gb|CW180521.1|CW180521 104_595_11162991_148_36643_062 Sorgh... 42 0.20
gb|CW188921.1|CW188921 104_610_11173692_148_37099_048 Sorgh... 42 0.20
gb|CW192042.1|CW192042 104_614_11178814_116_36950_091 Sorgh... 42 0.20
gb|CW201807.1|CW201807 104_627_11184763_116_37109_068 Sorgh... 42 0.20
gb|CW207642.1|CW207642 104_636_11188260_148_36970_034 Sorgh... 42 0.20
gb|CW208157.1|CW208157 104_637_11188527_116_37465_054 Sorgh... 42 0.20
gb|CW213589.1|CW213589 104_645_11191633_148_37035_011 Sorgh... 42 0.20
gb|CW225928.1|CW225928 104_663_11204618_116_37214_003 Sorgh... 42 0.20
gb|CW226108.1|CW226108 104_664_11204713_148_37220_015 Sorgh... 42 0.20
gb|CW233719.1|CW233719 104_687_11213596_148_37383_014 Sorgh... 42 0.20
gb|CW235677.1|CW235677 104_691_11215123_116_37404_078 Sorgh... 42 0.20
gb|CW235678.1|CW235678 104_691_11215123_148_37401_078 Sorgh... 42 0.20
gb|CW237313.1|CW237313 104_693_11216095_116_37514_022 Sorgh... 42 0.20
gb|CW249147.1|CW249147 104_710_11222687_148_35035_084 Sorgh... 42 0.20
gb|CW257033.1|CW257033 104_722_11227122_116_35151_073 Sorgh... 42 0.20
gb|CW265904.1|CW265904 104_735_11232138_148_35268_073 Sorgh... 42 0.20
gb|CW268673.1|CW268673 104_739_11401453_116_35306_053 Sorgh... 42 0.20
gb|CW271699.1|CW271699 104_744_11403138_116_36224_079 Sorgh... 42 0.20
gb|CW274872.1|CW274872 104_748_11404660_116_35379_016 Sorgh... 42 0.20
gb|CW284938.1|CW284938 104_762_11410066_116_35504_047 Sorgh... 42 0.20
gb|CW284939.1|CW284939 104_762_11410066_148_35500_047 Sorgh... 42 0.20
gb|CW294850.1|CW294850 104_775_11415402_148_36234_065 Sorgh... 42 0.20
gb|CW299109.1|CW299109 104_782_11462940_148_36236_048 Sorgh... 42 0.20
gb|CW306652.1|CW306652 104_792_11466957_116_35711_089 Sorgh... 42 0.20
gb|CW306653.1|CW306653 104_792_11466957_148_35715_089 Sorgh... 42 0.20
gb|CW321849.1|CW321849 104_815_11475773_148_35942_025 Sorgh... 42 0.20
gb|CW322429.1|CW322429 104_816_11476093_116_35948_059 Sorgh... 42 0.20
gb|CW322914.1|CW322914 104_816_11476357_116_35953_049 Sorgh... 42 0.20
gb|CW323900.1|CW323900 104_818_11476875_148_35908_012 Sorgh... 42 0.20
gb|CW336278.1|CW336278 104_835_11483503_116_36096_024 Sorgh... 42 0.20
gb|CW344346.1|CW344346 104_847_11487904_148_36199_064 Sorgh... 42 0.20
gb|CW345753.1|CW345753 104_849_11488667_116_36213_048 Sorgh... 42 0.20
gb|CW346471.1|CW346471 fsbb001f006a02f0 Sorghum methylation... 42 0.20
gb|CW353347.1|CW353347 fsbb001f016b02k0 Sorghum methylation... 42 0.20
gb|CW353904.1|CW353904 fsbb001f016n18f0 Sorghum methylation... 42 0.20
gb|CW361810.1|CW361810 fsbb001f030j03k0 Sorghum methylation... 42 0.20
gb|CW374939.1|CW374939 fsbb001f052a24f0 Sorghum methylation... 42 0.20
gb|CW374940.1|CW374940 fsbb001f052a24k0 Sorghum methylation... 42 0.20
gb|CW379254.1|CW379254 fsbb001f058g21k0 Sorghum methylation... 42 0.20
gb|CW382379.1|CW382379 fsbb001f064e17f0 Sorghum methylation... 42 0.20
gb|CW384981.1|CW384981 fsbb001f068e08k0 Sorghum methylation... 42 0.20
gb|CW386961.1|CW386961 fsbb001f071b19f0 Sorghum methylation... 42 0.20
gb|CW389731.1|CW389731 fsbb001f075b04k0 Sorghum methylation... 42 0.20
gb|CW393603.1|CW393603 fsbb001f080l21f0 Sorghum methylation... 42 0.20
gb|CW397088.1|CW397088 fsbb001f085n06f0 Sorghum methylation... 42 0.20
gb|CW398207.1|CW398207 fsbb001f087i19k0 Sorghum methylation... 42 0.20
gb|CW401368.1|CW401368 fsbb001f092c05k0 Sorghum methylation... 42 0.20
gb|CW406209.1|CW406209 fsbb001f099b24f0 Sorghum methylation... 42 0.20
gb|CW406555.1|CW406555 fsbb001f099j22k0 Sorghum methylation... 42 0.20
gb|CW409222.1|CW409222 fsbb001f103h02k0 Sorghum methylation... 42 0.20
gb|CW420255.1|CW420255 fsbb001f126h21k0 Sorghum methylation... 42 0.20
gb|CW430090.1|CW430090 fsbb001f143k08f0 Sorghum methylation... 42 0.20
gb|CW433520.1|CW433520 fsbb001f148m07f0 Sorghum methylation... 42 0.20
gb|CW438573.1|CW438573 fsbb001f156e10f0 Sorghum methylation... 42 0.20
gb|CW438830.1|CW438830 fsbb001f156k15f0 Sorghum methylation... 42 0.20
gb|CW440247.1|CW440247 fsbb001f158m19f0 Sorghum methylation... 42 0.20
gb|CW450593.1|CW450593 fsbb001f189f02f0 Sorghum methylation... 42 0.20
gb|CW455654.1|CW455654 fsbb001f200k02f0 Sorghum methylation... 42 0.20
gb|CW456550.1|CW456550 fsbb001f201o24k0 Sorghum methylation... 42 0.20
gb|CW460451.1|CW460451 fsbb001f207k13f0 Sorghum methylation... 42 0.20
gb|CW462840.1|CW462840 fsbb001f211c18f0 Sorghum methylation... 42 0.20
gb|CW463195.1|CW463195 fsbb001f211k19k0 Sorghum methylation... 42 0.20
gb|CW464247.1|CW464247 fsbb001f213g06f0 Sorghum methylation... 42 0.20
gb|CW469509.1|CW469509 fsbb001f222e09f0 Sorghum methylation... 42 0.20
gb|CL703376.2|CL703376 SP__Ba0095M14.r SP__Ba Sorghum propi... 42 0.20
gb|AW287182.2|AW287182 LG1_267_E06.b1_A002 Light Grown 1 (L... 42 0.20
gb|AW286415.2|AW286415 LG1_332_E01.g1_A002 Light Grown 1 (L... 42 0.20
gb|AW680035.1|AW680035 WS1_3_H10.g1_A002 Water-stressed 1 (... 42 0.20
gb|AW745073.1|AW745073 LG1_386_D12.b1_A002 Light Grown 1 (L... 42 0.20
gb|AW924128.1|AW924128 WS1_50_D05.b1_A002 Water-stressed 1 ... 42 0.20
gb|AW924514.1|AW924514 WS1_70_D03.b1_A002 Water-stressed 1 ... 42 0.20
gb|AW924624.1|AW924624 WS1_70_D03.g1_A002 Water-stressed 1 ... 42 0.20
gb|BE356891.1|BE356891 DG1_145_B10.b1_A002 Dark Grown 1 (DG... 42 0.20
gb|BE357399.1|BE357399 DG1_15_D06.b2_A002 Dark Grown 1 (DG1... 42 0.20
gb|BE361168.1|BE361168 DG1_70_F07.b1_A002 Dark Grown 1 (DG1... 42 0.20
gb|BE362076.1|BE362076 DG1_84_F08.b1_A002 Dark Grown 1 (DG1... 42 0.20
gb|BE362393.1|BE362393 DG1_86_G02.b1_A002 Dark Grown 1 (DG1... 42 0.20
gb|BE597019.1|BE597019 PI1_60_D02.b1_A002 Pathogen induced ... 42 0.20
gb|BE598973.1|BE598973 PI1_84_A12.b1_A002 Pathogen induced ... 42 0.20
gb|BE598981.1|BE598981 PI1_84_A04.b1_A002 Pathogen induced ... 42 0.20
gb|BE599255.1|BE599255 PI1_87_C08.g1_A002 Pathogen induced ... 42 0.20
gb|BF317984.1|BF317984 OV1_10_D02.b1_A002 Ovary 1 (OV1) Sor... 42 0.20
gb|BG051102.1|BG051102 FM1_56_C10.b1_A003 Floral-Induced Me... 42 0.20
gb|BG051103.1|BG051103 FM1_56_C11.b1_A003 Floral-Induced Me... 42 0.20
gb|BG051426.1|BG051426 FM1_56_C10.g1_A003 Floral-Induced Me... 42 0.20
gb|BG051427.1|BG051427 FM1_56_C11.g1_A003 Floral-Induced Me... 42 0.20
gb|BG053711.1|BG053711 RHIZ2_8_G12.b1_A003 Rhizome2 (RHIZ2)... 42 0.20
gb|BG053923.1|BG053923 RHIZ2_11_F12.b1_A003 Rhizome2 (RHIZ2... 42 0.20
gb|BG102016.1|BG102016 RHIZ2_23_G12.g1_A003 Rhizome2 (RHIZ2... 42 0.20
gb|BG102051.1|BG102051 RHIZ2_24_C03.g1_A003 Rhizome2 (RHIZ2... 42 0.20
gb|BG102239.1|BG102239 RHIZ2_23_G12.b1_A003 Rhizome2 (RHIZ2... 42 0.20
gb|BG103443.1|BG103443 RHIZ2_20_E07.b1_A003 Rhizome2 (RHIZ2... 42 0.20
gb|BG462754.1|BG462754 EM1_45_B07.b1_A002 Embryo 1 (EM1) So... 42 0.20
gb|BG462755.1|BG462755 EM1_45_B08.b1_A002 Embryo 1 (EM1) So... 42 0.20
gb|BG487884.1|BG487884 RHIZ2_60_E09.g1_A003 Rhizome2 (RHIZ2... 42 0.20
gb|BG488183.1|BG488183 RHIZ2_60_E09.b1_A003 Rhizome2 (RHIZ2... 42 0.20
gb|BG556606.1|BG556606 EM1_37_C12.b1_A002 Embryo 1 (EM1) So... 42 0.20
gb|BG739526.1|BG739526 EM1_82_A04.b1_A002 Embryo 1 (EM1) So... 42 0.20
gb|BM318632.1|BM318632 PI1_15_H01.b9_A002 Pathogen induced ... 42 0.20
gb|CB925359.1|CB925359 ABA1_32_E05.g1_A012 Abscisic acid-tr... 42 0.20
gb|CB926723.1|CB926723 ABA1_10_F05.b1_A012 Abscisic acid-tr... 42 0.20
gb|CB928422.1|CB928422 ABA1_15_G10.g1_A012 Abscisic acid-tr... 42 0.20
gb|CD206148.1|CD206148 HS1_20_H07.g1_A012 Heat-shocked seed... 42 0.20
gb|CD210203.1|CD210203 HS1_57_B02.g1_A012 Heat-shocked seed... 42 0.20
gb|CD219912.1|CD219912 CCC1_59_D06.g1_A007 Callus culture/c... 42 0.20
gb|CD224663.1|CD224663 CCC1_35_C08.g1_A007 Callus culture/c... 42 0.20
gb|CD224804.1|CD224804 CCC1_36_G04.g1_A007 Callus culture/c... 42 0.20
gb|CD225282.1|CD225282 CCC1_39_A07.g1_A007 Callus culture/c... 42 0.20
gb|CD225324.1|CD225324 CCC1_39_G03.g1_A007 Callus culture/c... 42 0.20
gb|CD225355.1|CD225355 CCC1_39_D09.g1_A007 Callus culture/c... 42 0.20
gb|CD225799.1|CD225799 CCC1_41_D06.g1_A007 Callus culture/c... 42 0.20
gb|CD226037.1|CD226037 CCC1_43_A07.b1_A007 Callus culture/c... 42 0.20
gb|CD226062.1|CD226062 CCC1_43_G11.b1_A007 Callus culture/c... 42 0.20
gb|CD230582.1|CD230582 SS1_44_A03.g1_A012 Salt-stressed see... 42 0.20
gb|CD231333.1|CD231333 SS1_15_E04.g1_A012 Salt-stressed see... 42 0.20
gb|CD231653.1|CD231653 SS1_22_D08.g1_A012 Salt-stressed see... 42 0.20
gb|CD231916.1|CD231916 SS1_30_H03.g1_A012 Salt-stressed see... 42 0.20
gb|CD232062.1|CD232062 SS1_31_C05.g1_A012 Salt-stressed see... 42 0.20
gb|CD233287.1|CD233287 SS1_13_A08.b1_A012 Salt-stressed see... 42 0.20
gb|CD235744.1|CD235744 SS1_37_G06.g1_A012 Salt-stressed see... 42 0.20
gb|CD423335.1|CD423335 SA1_28_B03.g1_A002 Salicylic acid-tr... 42 0.20
gb|CD423519.1|CD423519 SA1_23_C01.g1_A002 Salicylic acid-tr... 42 0.20
gb|CD424515.1|CD424515 SA1_6_A09.g1_A002 Salicylic acid-tre... 42 0.20
gb|CD425086.1|CD425086 SA1_10_A05.b1_A002 Salicylic acid-tr... 42 0.20
gb|CD426580.1|CD426580 SA1_21_F11.g1_A002 Salicylic acid-tr... 42 0.20
gb|CD428512.1|CD428512 ETH1_27_C07.b1_A002 Ethylene-treated... 42 0.20
gb|CD430429.1|CD430429 ETH1_18_F12.g1_A002 Ethylene-treated... 42 0.20
gb|CD432171.1|CD432171 ETH1_26_D07.g1_A002 Ethylene-treated... 42 0.20
gb|CD461931.1|CD461931 SA1_31_B05.g1_A002 Salicylic acid-tr... 42 0.20
gb|CD463041.1|CD463041 ETH1_41_B11.g1_A002 Ethylene-treated... 42 0.20
gb|CF071740.1|CF071740 FE1_18_H07.b1_A002 Iron-deficient se... 42 0.20
gb|CF426908.1|CF426908 PH1_2_E02.g1_A002 Phosphorous-defici... 42 0.20
gb|CF426921.1|CF426921 PH1_2_F12.g1_A002 Phosphorous-defici... 42 0.20
gb|CF426968.1|CF426968 PH1_2_G11.g1_A002 Phosphorous-defici... 42 0.20
gb|CF427293.1|CF427293 PH1_4_G10.g1_A002 Phosphorous-defici... 42 0.20
gb|CF430674.1|CF430674 NIT1_3_B05.g1_A002 Nitrogen-deficien... 42 0.20
gb|CF432008.1|CF432008 NIT1_16_F04.g1_A002 Nitrogen-deficie... 42 0.20
gb|CF432769.1|CF432769 NIT1_18_C02.g1_A002 Nitrogen-deficie... 42 0.20
gb|CF433406.1|CF433406 NIT1_26_H01.g1_A002 Nitrogen-deficie... 42 0.20
gb|CF433516.1|CF433516 NIT1_27_B06.g1_A002 Nitrogen-deficie... 42 0.20
gb|CF481240.1|CF481240 POL1_70_G01.g1_A002 Pollen Sorghum b... 42 0.20
gb|CF482754.1|CF482754 POL1_9_A03.b1_A002 Pollen Sorghum bi... 42 0.20
gb|CF485289.1|CF485289 POL1_30_D03.g1_A002 Pollen Sorghum b... 42 0.20
gb|CN124587.1|CN124587 RHOH1_5_E12.g1_A002 Acid- and alkali... 42 0.20
gb|CN125503.1|CN125503 RHOH1_11_B02.g1_A002 Acid- and alkal... 42 0.20
gb|CN125527.1|CN125527 RHOH1_11_D05.g1_A002 Acid- and alkal... 42 0.20
gb|CN127026.1|CN127026 RHOH1_20_D01.g1_A002 Acid- and alkal... 42 0.20
gb|CN129643.1|CN129643 RHOH1_36_C06.g1_A002 Acid- and alkal... 42 0.20
gb|CN130056.1|CN130056 RHOH1_39_B08.b1_A002 Acid- and alkal... 42 0.20
gb|CN132004.1|CN132004 OX1_3_B10.g1_A002 Oxidatively-stress... 42 0.20
gb|CN133884.1|CN133884 OX1_19_A01.b1_A002 Oxidatively-stres... 42 0.20
gb|CN135895.1|CN135895 OX1_39_C10.g1_A002 Oxidatively-stres... 42 0.20
gb|CN137307.1|CN137307 OX1_56_B02.g1_A002 Oxidatively-stres... 42 0.20
gb|CN137789.1|CN137789 OX1_59_D04.g1_A002 Oxidatively-stres... 42 0.20
gb|CN138377.1|CN138377 OX1_63_A01.g1_A002 Oxidatively-stres... 42 0.20
gb|CN140215.1|CN140215 OX1_34_G03.g1_A002 Oxidatively-stres... 42 0.20
gb|CN140731.1|CN140731 OX1_46_D02.g1_A002 Oxidatively-stres... 42 0.20
gb|CN141230.1|CN141230 OX1_50_D07.b1_A002 Oxidatively-stres... 42 0.20
gb|CN142455.1|CN142455 WOUND1_10_D04.b1_A002 Wounded leaves... 42 0.20
gb|CN144307.1|CN144307 WOUND1_21_H10.b1_A002 Wounded leaves... 42 0.20
gb|CN148801.1|CN148801 WOUND1_58_H03.g1_A002 Wounded leaves... 42 0.20
gb|CN149804.1|CN149804 WOUND1_65_A11.b1_A002 Wounded leaves... 42 0.20
gb|CN150078.1|CN150078 WOUND1_66_G02.g1_A002 Wounded leaves... 42 0.20
gb|CN150642.1|CN150642 WOUND1_70_C07.g1_A002 Wounded leaves... 42 0.20
gb|CN152428.1|CN152428 WOUND1_82_B02.b1_A002 Wounded leaves... 42 0.20
gb|CN152696.1|CN152696 WOUND1_83_E01.g1_A002 Wounded leaves... 42 0.20
>gb|CW237503.1|CW237503 104_693_11216207_148_37517_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11216207, DNA
sequence
Length = 651
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Minus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 589 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 530
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 529 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 470
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 469 gggccgtgcttcgtggcgag 450
>gb|CW265862.1|CW265862 104_735_11232115_148_35265_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232115, DNA
sequence
Length = 629
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Minus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 512 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 453
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 452 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 393
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 392 gggccgtgcttcgtggcgag 373
>gb|CW460327.1|CW460327 fsbb001f207h20k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f207h20, DNA
sequence
Length = 709
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Plus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 291 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 350
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 351 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 410
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 411 gggccgtgcttcgtggcgag 430
>gb|CW481020.1|CW481020 fsbb001f240g01k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f240g01, DNA
sequence
Length = 641
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Minus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 581 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 522
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 521 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 462
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 461 gggccgtgcttcgtggcgag 442
>gb|BE599417.1|BE599417 PI1_87_C08.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 505
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Minus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 335 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 276
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 275 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 216
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 215 gggccgtgcttcgtggcgag 196
>gb|CD425104.1|CD425104 SA1_10_A05.g1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_10_A05_A002 5', mRNA sequence
Length = 538
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Minus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 491 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 432
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 431 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 372
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 371 gggccgtgcttcgtggcgag 352
>gb|CD427429.1|CD427429 SA1_30_F07.g1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_30_F07_A002 5', mRNA sequence
Length = 624
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Minus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 450 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 391
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 390 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 331
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 330 gggccgtgcttcgtggcgag 311
>gb|CN133967.1|CN133967 OX1_19_A01.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_19_A01_A002 5', mRNA sequence
Length = 586
Score = 103 bits (52), Expect = 6e-020
Identities = 118/140 (84%)
Strand = Plus / Minus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 443 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 384
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagcagcatcaggtcc 1586
|||| |||||||| || |||| ||||| ||||||||||||||||||||| |||||
Sbjct: 383 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagcagcatgaggtcg 324
Query: 1587 gggccgtacctggtggcgag 1606
||||||| | | ||||||||
Sbjct: 323 gggccgtgcttcgtggcgag 304
>gb|CW265861.1|CW265861 104_735_11232115_116_35269_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232115, DNA
sequence
Length = 621
Score = 81.8 bits (41), Expect = 2e-013
Identities = 92/109 (84%)
Strand = Plus / Plus
Query: 1467 accagggagcgcgggcgggaggagaagacgtggtcgtaggtgcggagcacggcctcggcg 1526
||||||||| |||| ||||| | ||| |||||||||| ||||| |||||||||||||||
Sbjct: 513 accagggagtgcggccgggacgcgaacacgtggtcgtgcgtgcgcagcacggcctcggcg 572
Query: 1527 acgcgcggcgacgagaccacgacggtcggcacggcgccgaggcggagca 1575
|||| |||||||| || |||| ||||| |||||||||||||||||
Sbjct: 573 gcgcggggcgacgacacgacgagcaccggcatggcgccgaggcggagca 621
>gb|CL185775.1|CL185775 104_400_10899767_116_32402_094 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10899767, DNA
sequence
Length = 586
Score = 69.9 bits (35), Expect = 9e-010
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgaggt 726
||||| |||||||||| |||||| ||||||||||||||||||||| ||||||||
Sbjct: 192 aggagtggcaccggcgtgtgcagccggagcgtctccttgatgacgcacttgaggt 246
>gb|CW087487.1|CW087487 104_432_10947661_114_32550_061 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10947661, DNA
sequence
Length = 675
Score = 69.9 bits (35), Expect = 9e-010
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgaggt 726
||||| |||||||||| |||||| ||||||||||||||||||||| ||||||||
Sbjct: 26 aggagtggcaccggcgtgtgcagccggagcgtctccttgatgacgcacttgaggt 80
>gb|CW112888.1|CW112888 104_487_11105141_116_34553_031 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11105141, DNA
sequence
Length = 636
Score = 69.9 bits (35), Expect = 9e-010
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgaggt 726
||||| |||||||||| |||||| ||||||||||||||||||||| ||||||||
Sbjct: 553 aggagtggcaccggcgtgtgcagccggagcgtctccttgatgacgcacttgaggt 607
>gb|CD227071.1|CD227071 CCC1_4_A07.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_4_A07_A007 3', mRNA sequence
Length = 653
Score = 69.9 bits (35), Expect = 9e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgaggt 726
||||| |||||||||| |||||| ||||||||||||||||||||| ||||||||
Sbjct: 149 aggagtggcaccggcgtgtgcagccggagcgtctccttgatgacgcacttgaggt 95
>gb|AC152913.1| Sorghum bicolor clone SB106M24, *** SEQUENCING IN PROGRESS ***, 7
ordered pieces
Length = 102187
Score = 69.9 bits (35), Expect = 9e-010
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgaggt 726
||||| |||||||||| |||||| ||||||||||||||||||||| ||||||||
Sbjct: 91450 aggagtggcaccggcgtgtgcagccggagcgtctccttgatgacgcacttgaggt 91504
Score = 58.0 bits (29), Expect = 3e-006
Identities = 41/45 (91%)
Strand = Plus / Minus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacg 716
|||||||||||||||| |||| |||||||||||||||||||||
Sbjct: 101185 aggagcggcaccggcgtccgcagccggagcgtctccttgatgacg 101141
Score = 48.1 bits (24), Expect = 0.003
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 587 cgcccaggcgttgacgacgacgcgggtg 614
||||||||||||||||| ||||||||||
Sbjct: 93816 cgcccaggcgttgacgatgacgcgggtg 93843
Score = 48.1 bits (24), Expect = 0.003
Identities = 45/52 (86%)
Strand = Plus / Plus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgaggt 726
||||||| ||||| |||||| |||||||||||||| | |||||||| ||||
Sbjct: 68977 agcggcaacggcgcgtgcagccggagcgtctccttcaccacggccttcaggt 69028
Score = 46.1 bits (23), Expect = 0.013
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 588 gcccaggcgttgacgacgacgcgggtg 614
|||||||||||||||| ||||||||||
Sbjct: 101269 gcccaggcgttgacgatgacgcgggtg 101243
Score = 46.1 bits (23), Expect = 0.013
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctcctt 709
||||||| ||||| |||||| ||||||||||||||
Sbjct: 57756 agcggcaacggcgcgtgcagccggagcgtctcctt 57722
Score = 44.1 bits (22), Expect = 0.051
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 682 ccggcgggtgcaggcggagcgtctccttga 711
|||||| |||||| ||||||||||||||||
Sbjct: 83034 ccggcgtgtgcagacggagcgtctccttga 83063
Score = 42.1 bits (21), Expect = 0.20
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 684 ggcgggtgcaggcggagcgtctccttgat 712
|||| |||||| |||||||||||||||||
Sbjct: 93913 ggcgcgtgcagtcggagcgtctccttgat 93941
>gb|CL174916.1|CL174916 104_379_10892004_148_31768_372 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10892004, DNA
sequence
Length = 560
Score = 67.9 bits (34), Expect = 4e-009
Identities = 37/38 (97%)
Strand = Plus / Minus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctccttgat 712
|||||||||||||||||||| |||||||||||||||||
Sbjct: 219 agcggcaccggcgggtgcagccggagcgtctccttgat 182
>gb|CW033973.1|CW033973 104_263_10502270_115_30360 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10502270, DNA
sequence
Length = 655
Score = 67.9 bits (34), Expect = 4e-009
Identities = 37/38 (97%)
Strand = Plus / Plus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctccttgat 712
|||||||||||||||||||| |||||||||||||||||
Sbjct: 32 agcggcaccggcgggtgcagccggagcgtctccttgat 69
>gb|CW238741.1|CW238741 104_695_11216895_116_37527_052 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11216895, DNA
sequence
Length = 682
Score = 67.9 bits (34), Expect = 4e-009
Identities = 37/38 (97%)
Strand = Plus / Plus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctccttgat 712
|||||||||||||||||||| |||||||||||||||||
Sbjct: 437 agcggcaccggcgggtgcagccggagcgtctccttgat 474
>gb|CW238742.1|CW238742 104_695_11216895_148_37524_052 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11216895, DNA
sequence
Length = 614
Score = 67.9 bits (34), Expect = 4e-009
Identities = 37/38 (97%)
Strand = Plus / Minus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctccttgat 712
|||||||||||||||||||| |||||||||||||||||
Sbjct: 380 agcggcaccggcgggtgcagccggagcgtctccttgat 343
>gb|CW356439.1|CW356439 fsbb001f021i08k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f021i08, DNA
sequence
Length = 705
Score = 67.9 bits (34), Expect = 4e-009
Identities = 37/38 (97%)
Strand = Plus / Plus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctccttgat 712
|||||||||||||||||||| |||||||||||||||||
Sbjct: 61 agcggcaccggcgggtgcagccggagcgtctccttgat 98
>gb|CW423432.1|CW423432 fsbb001f133e01f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f133e01, DNA
sequence
Length = 497
Score = 67.9 bits (34), Expect = 4e-009
Identities = 37/38 (97%)
Strand = Plus / Plus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctccttgat 712
|||||||||||||||||||| |||||||||||||||||
Sbjct: 251 agcggcaccggcgggtgcagccggagcgtctccttgat 288
>gb|CW062310.1|CW062310 104_307_10521269_1_30043 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10521269, DNA
sequence
Length = 262
Score = 61.9 bits (31), Expect = 2e-007
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 667 ggaggaggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgagg 725
||||||| ||||| | ||||||||| || ||||||||||||||||||||| |||||||
Sbjct: 225 ggaggagcagcgggatcggcgggtggagacggagcgtctccttgatgacgcacttgagg 167
>gb|CW323938.1|CW323938 104_818_11476894_148_35909_091 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11476894, DNA
sequence
Length = 664
Score = 61.9 bits (31), Expect = 2e-007
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 667 ggaggaggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgagg 725
||||||| ||||| | ||||||||| || ||||||||||||||||||||| |||||||
Sbjct: 314 ggaggagcagcgggatcggcgggtggagacggagcgtctccttgatgacgcacttgagg 256
>gb|CN128570.1|CN128570 RHOH1_30_G11.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_30_G11_A002 3', mRNA sequence
Length = 822
Score = 61.9 bits (31), Expect = 2e-007
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 667 ggaggaggagcggcaccggcgggtgcaggcggagcgtctccttgatgacggccttgagg 725
||||||| ||||| | ||||||||| || ||||||||||||||||||||| |||||||
Sbjct: 229 ggaggagcagcgggatcggcgggtggagacggagcgtctccttgatgacgcacttgagg 171
>gb|CW265642.1|CW265642 104_735_11231994_148_35268_079 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11231994, DNA
sequence
Length = 624
Score = 60.0 bits (30), Expect = 9e-007
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 1506 gtgcggagcacggcctcggcgacgcgcggcgacgagaccacgacggtcggcacggcgccg 1565
||||| ||||| ||||||||| ||||||||||||| || |||| ||||| |||||||
Sbjct: 203 gtgcgcagcaccgcctcggcggcgcgcggcgacgacacgacgagcaccggcatggcgccg 262
Query: 1566 aggcggagcagcat 1579
|||||||| |||||
Sbjct: 263 aggcggaggagcat 276
>gb|CW475267.1|CW475267 fsbb001f231i17k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f231i17, DNA
sequence
Length = 517
Score = 60.0 bits (30), Expect = 9e-007
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 1506 gtgcggagcacggcctcggcgacgcgcggcgacgagaccacgacggtcggcacggcgccg 1565
||||| ||||| ||||||||| ||||||||||||| || |||| ||||| |||||||
Sbjct: 315 gtgcgcagcaccgcctcggcggcgcgcggcgacgacacgacgagcaccggcatggcgccg 374
Query: 1566 aggcggagcagcat 1579
|||||||| |||||
Sbjct: 375 aggcggaggagcat 388
>gb|BG053297.1|BG053297 RHIZ2_25_F08.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 470
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 683 cggcgggtgcaggcggagcgtctccttgatgacggcct 720
|||||||||||||||||||| |||||||| ||||||||
Sbjct: 65 cggcgggtgcaggcggagcgactccttgacgacggcct 28
>gb|BG101809.1|BG101809 RHIZ2_22_F11.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 641
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 683 cggcgggtgcaggcggagcgtctccttgatgacggcct 720
|||||||||||||||||||| |||||||| ||||||||
Sbjct: 40 cggcgggtgcaggcggagcgactccttgacgacggcct 3
>gb|BG102350.1|BG102350 RHIZ2_22_F11.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 555
Score = 60.0 bits (30), Expect = 9e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 683 cggcgggtgcaggcggagcgtctccttgatgacggcct 720
|||||||||||||||||||| |||||||| ||||||||
Sbjct: 65 cggcgggtgcaggcggagcgactccttgacgacggcct 28
>gb|CL158338.1|CL158338 104_347_10803476_114_31377_068 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803476, DNA
sequence
Length = 745
Score = 58.0 bits (29), Expect = 3e-006
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacg 716
|||||||||||||||| |||| |||||||||||||||||||||
Sbjct: 129 aggagcggcaccggcgtccgcagccggagcgtctccttgatgacg 173
Score = 46.1 bits (23), Expect = 0.013
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 588 gcccaggcgttgacgacgacgcgggtg 614
|||||||||||||||| ||||||||||
Sbjct: 45 gcccaggcgttgacgatgacgcgggtg 71
>gb|CW317464.1|CW317464 104_809_11473427_116_35861_044 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11473427, DNA
sequence
Length = 687
Score = 58.0 bits (29), Expect = 3e-006
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 672 aggagcggcaccggcgggtgcaggcggagcgtctccttgatgacg 716
|||||||||||||||| |||| |||||||||||||||||||||
Sbjct: 438 aggagcggcaccggcgtccgcagccggagcgtctccttgatgacg 482
Score = 46.1 bits (23), Expect = 0.013
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 588 gcccaggcgttgacgacgacgcgggtg 614
|||||||||||||||| ||||||||||
Sbjct: 354 gcccaggcgttgacgatgacgcgggtg 380
>gb|CL190528.1|CL190528 104_408_10906137_114_32483_035 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906137, DNA
sequence
Length = 691
Score = 56.0 bits (28), Expect = 1e-005
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 1641 aggtgcaggtgcccgatgatggggagcttcatgggcggcgacggcagc 1688
||||||||||| ||||||||||||||| || |||| ||||| ||||||
Sbjct: 287 aggtgcaggtggccgatgatggggagcctcctgggaggcgaaggcagc 334
>gb|CW164797.1|CW164797 104_572_11152171_116_36465_066 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11152171, DNA
sequence
Length = 694
Score = 56.0 bits (28), Expect = 1e-005
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 1641 aggtgcaggtgcccgatgatggggagcttcatgggcggcgacggcagc 1688
||||||||||| ||||||||||||||| || |||| ||||| ||||||
Sbjct: 174 aggtgcaggtggccgatgatggggagcctcctgggaggcgaaggcagc 127
>gb|CW300393.1|CW300393 104_783_11463632_148_36251_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11463632, DNA
sequence
Length = 727
Score = 56.0 bits (28), Expect = 1e-005
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 1641 aggtgcaggtgcccgatgatggggagcttcatgggcggcgacggcagc 1688
||||||||||| ||||||||||||||| || |||| ||||| ||||||
Sbjct: 365 aggtgcaggtggccgatgatggggagcctcctgggaggcgaaggcagc 318
>gb|CW464096.1|CW464096 fsbb001f213c15k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f213c15, DNA
sequence
Length = 668
Score = 56.0 bits (28), Expect = 1e-005
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 1641 aggtgcaggtgcccgatgatggggagcttcatgggcggcgacggcagc 1688
||||||||||| ||||||||||||||| || |||| ||||| ||||||
Sbjct: 652 aggtgcaggtggccgatgatggggagcctcctgggaggcgaaggcagc 605
>gb|CL151818.1|CL151818 104_334_10779515_114_31361_299 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10779515, DNA
sequence
Length = 616
Score = 54.0 bits (27), Expect = 5e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 588 gcccaggcgttgacgacgacgcgggtgttggccgg 622
|||||||||||||||| |||||| |||||||||||
Sbjct: 544 gcccaggcgttgacgaagacgcgcgtgttggccgg 578
>gb|CW030659.1|CW030659 104_258_10500355_114_30403 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10500355, DNA
sequence
Length = 821
Score = 54.0 bits (27), Expect = 5e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 315 accgtgatcccaaacacctcggtcatgtccacgtcctccgccttcatccccgccggcagc 374
|||||||| ||||||||||| |||||||| || |||| | ||| ||| ||| || |||
Sbjct: 659 accgtgattccaaacacctctgtcatgtcaacatccttctcctccatgcccatggggagc 600
Query: 375 tgccagtcgaaccggtacatgaggttggacagcat 409
|||||||| || | |||||||||||| | ||||||
Sbjct: 599 tgccagtcaaagcagtacatgaggtttgccagcat 565
>gb|CW030660.1|CW030660 104_258_10500355_116_30404 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10500355, DNA
sequence
Length = 804
Score = 54.0 bits (27), Expect = 5e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 315 accgtgatcccaaacacctcggtcatgtccacgtcctccgccttcatccccgccggcagc 374
|||||||| ||||||||||| |||||||| || |||| | ||| ||| ||| || |||
Sbjct: 459 accgtgattccaaacacctctgtcatgtcaacatccttctcctccatgcccatggggagc 518
Query: 375 tgccagtcgaaccggtacatgaggttggacagcat 409
|||||||| || | |||||||||||| | ||||||
Sbjct: 519 tgccagtcaaagcagtacatgaggtttgccagcat 553
>gb|CW138607.1|CW138607 104_528_11134785_116_34890_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11134785, DNA
sequence
Length = 696
Score = 54.0 bits (27), Expect = 5e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 588 gcccaggcgttgacgacgacgcgggtgttggccgg 622
|||||||||||||||| |||||| |||||||||||
Sbjct: 605 gcccaggcgttgacgaagacgcgcgtgttggccgg 639
>gb|CW138608.1|CW138608 104_528_11134785_148_34894_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11134785, DNA
sequence
Length = 665
Score = 54.0 bits (27), Expect = 5e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 588 gcccaggcgttgacgacgacgcgggtgttggccgg 622
|||||||||||||||| |||||| |||||||||||
Sbjct: 380 gcccaggcgttgacgaagacgcgcgtgttggccgg 346
Score = 44.1 bits (22), Expect = 0.051
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 682 ccggcgggtgcaggcggagcgtctccttga 711
||||||||||||| || |||||||||||||
Sbjct: 286 ccggcgggtgcagccgcagcgtctccttga 257
>gb|CW207268.1|CW207268 104_636_11188037_116_36971_025 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188037, DNA
sequence
Length = 469
Score = 54.0 bits (27), Expect = 5e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 588 gcccaggcgttgacgacgacgcgggtgttggccgg 622
|||||||||||||||| |||||| |||||||||||
Sbjct: 252 gcccaggcgttgacgaagacgcgcgtgttggccgg 218
Score = 44.1 bits (22), Expect = 0.051
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 682 ccggcgggtgcaggcggagcgtctccttga 711
||||||||||||| || |||||||||||||
Sbjct: 158 ccggcgggtgcagccgcagcgtctccttga 129
>gb|CW247245.1|CW247245 104_708_11221685_116_35017_027 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11221685, DNA
sequence
Length = 581
Score = 54.0 bits (27), Expect = 5e-005
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 674 gagcggcaccggcgggtgcaggcggagcgtctccttgatgacg 716
|||||||||||||| |||| |||||||||||||||||||||
Sbjct: 280 gagcggcaccggcgtccgcagccggagcgtctccttgatgacg 322
Score = 46.1 bits (23), Expect = 0.013
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 588 gcccaggcgttgacgacgacgcgggtg 614
|||||||||||||||| ||||||||||
Sbjct: 194 gcccaggcgttgacgatgacgcgggtg 220
>gb|CW300561.1|CW300561 104_784_11463730_116_36260_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11463730, DNA
sequence
Length = 505
Score = 54.0 bits (27), Expect = 5e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 315 accgtgatcccaaacacctcggtcatgtccacgtcctccgccttcatccccgccggcagc 374
|||||||| ||||||||||| |||||||| || |||| | ||| ||| ||| || |||
Sbjct: 260 accgtgattccaaacacctctgtcatgtcaacatccttctcctccatgcccatggggagc 319
Query: 375 tgccagtcgaaccggtacatgaggttggacagcat 409
|||||||| || | |||||||||||| | ||||||
Sbjct: 320 tgccagtcaaagcagtacatgaggtttgccagcat 354
>gb|CW312225.1|CW312225 104_802_11470645_148_35778_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11470645, DNA
sequence
Length = 673
Score = 54.0 bits (27), Expect = 5e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 588 gcccaggcgttgacgacgacgcgggtgttggccgg 622
|||||||||||||||| |||||| |||||||||||
Sbjct: 305 gcccaggcgttgacgaagacgcgcgtgttggccgg 271
Score = 44.1 bits (22), Expect = 0.051
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 682 ccggcgggtgcaggcggagcgtctccttga 711
||||||||||||| || |||||||||||||
Sbjct: 211 ccggcgggtgcagccgcagcgtctccttga 182
>gb|CW448555.1|CW448555 fsbb001f182d20f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f182d20, DNA
sequence
Length = 638
Score = 54.0 bits (27), Expect = 5e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 1167 agctcccggaacagcctgttgcggccttcctccatggagaacttgcc 1213
||||| ||||| |||||||| |||||||| ||| |||||||||||||
Sbjct: 240 agctcgcggaagagcctgttccggccttcttccctggagaacttgcc 194
>gb|CW457788.1|CW457788 fsbb001f203m03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f203m03, DNA
sequence
Length = 695
Score = 54.0 bits (27), Expect = 5e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 1167 agctcccggaacagcctgttgcggccttcctccatggagaacttgcc 1213
||||| ||||| |||||||| |||||||| ||| |||||||||||||
Sbjct: 203 agctcgcggaagagcctgttccggccttcttccctggagaacttgcc 157
>gb|CW490044.1|CW490044 fsbb001f275e17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f275e17, DNA
sequence
Length = 655
Score = 54.0 bits (27), Expect = 5e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 675 agcggcaccggcgggtgcaggcggagcgtctcctt 709
||||||||||||| |||||| ||||||||||||||
Sbjct: 605 agcggcaccggcgcgtgcagccggagcgtctcctt 639
>gb|AW680736.1|AW680736 WS1_6_C01.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 647
Score = 54.0 bits (27), Expect = 5e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 315 accgtgatcccaaacacctcggtcatgtccacgtcctccgccttcatccccgccggcagc 374
|||||||| ||||||||||| |||||||| || |||| | ||| ||| ||| || |||
Sbjct: 341 accgtgattccaaacacctctgtcatgtcaacatccttctcctccatgcccatggggagc 282
Query: 375 tgccagtcgaaccggtacatgaggttggacagcat 409
|||||||| || | |||||||||||| | ||||||
Sbjct: 281 tgccagtcaaagcagtacatgaggtttgccagcat 247
>gb|AW747003.1|AW747003 WS1_65_A05.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 508
Score = 54.0 bits (27), Expect = 5e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 315 accgtgatcccaaacacctcggtcatgtccacgtcctccgccttcatccccgccggcagc 374
|||||||| ||||||||||| |||||||| || |||| | ||| ||| ||| || |||
Sbjct: 368 accgtgattccaaacacctctgtcatgtcaacatccttctcctccatgcccatggggagc 309
Query: 375 tgccagtcgaaccggtacatgaggttggacagcat 409
|||||||| || | |||||||||||| | ||||||
Sbjct: 308 tgccagtcaaagcagtacatgaggtttgccagcat 274
>gb|AW747072.1|AW747072 WS1_65_A05.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 503
Score = 54.0 bits (27), Expect = 5e-005
Identities = 78/95 (82%)
Strand = Plus / Minus
Query: 315 accgtgatcccaaacacctcggtcatgtccacgtcctccgccttcatccccgccggcagc 374
|||||||| ||||||||||| |||||||| || |||| | ||| ||| ||| || |||
Sbjct: 165 accgtgattccaaacacctctgtcatgtcaacatccttctcctccatgcccatggggagc 106
Query: 375 tgccagtcgaaccggtacatgaggttggacagcat 409
|||||||| || | |||||||||||| | ||||||
Sbjct: 105 tgccagtcaaagcagtacatgaggtttgccagcat 71
>gb|BE357204.1|BE357204 DG1_147_F07.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 593
Score = 54.0 bits (27), Expect = 5e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 588 gcccaggcgttgacgacgacgcgggtgttggccgg 622
|||||||||||||||| |||||| |||||||||||
Sbjct: 115 gcccaggcgttgacgaagacgcgcgtgttggccgg 81
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 830,796
Number of Sequences: 832831
Number of extensions: 830796
Number of successful extensions: 273926
Number of sequences better than 0.5: 529
Number of HSP's better than 0.5 without gapping: 528
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 271854
Number of HSP's gapped (non-prelim): 1818
length of query: 2042
length of database: 491,359,669
effective HSP length: 20
effective length of query: 2022
effective length of database: 474,703,049
effective search space: 959849565078
effective search space used: 959849565078
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)