BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3742548.2.1
(554 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW433885.1|CW433885 fsbb001f149f03k0 Sorghum methylation... 504 e-141
gb|CW071877.1|CW071877 104_324_10591880_116_30463 Sorghum m... 182 2e-044
gb|CW485366.1|CW485366 fsbb001f248b06f0 Sorghum methylation... 84 2e-014
gb|CW389731.1|CW389731 fsbb001f075b04k0 Sorghum methylation... 80 2e-013
gb|CW231895.1|CW231895 104_681_11211369_148_37349_041 Sorgh... 78 1e-012
gb|CW084589.1|CW084589 104_427_10945885_116_32509_055 Sorgh... 74 2e-011
gb|CW150998.1|CW150998 104_551_11143708_148_36313_006 Sorgh... 74 2e-011
gb|AC169377.3| Sorghum bicolor clone SB_BBc0068O12, WORKING... 74 2e-011
gb|AC169379.4| Sorghum bicolor clone SB_BBc0088B22, complet... 74 2e-011
gb|CW065653.1|CW065653 104_312_10523266_114_30129 Sorghum m... 70 2e-010
gb|CW084588.1|CW084588 104_427_10945885_114_32505_055 Sorgh... 70 2e-010
gb|CW235305.1|CW235305 104_690_11214911_116_37409_088 Sorgh... 70 2e-010
gb|CW235306.1|CW235306 104_690_11214911_148_37413_088 Sorgh... 70 2e-010
gb|CW350302.1|CW350302 fsbb001f011i17f0 Sorghum methylation... 70 2e-010
gb|CL153870.1|CL153870 104_338_10781006_116_31370_254 Sorgh... 62 6e-008
gb|CW253648.1|CW253648 104_717_11225217_148_35108_041 Sorgh... 62 6e-008
gb|CL170464.1|CL170464 104_371_10813835_148_31790_155 Sorgh... 60 2e-007
gb|CL171390.1|CL171390 104_373_10889394_148_31776_066 Sorgh... 60 2e-007
gb|CL195525.1|CL195525 104_421_10942439_114_32308_096 Sorgh... 60 2e-007
gb|CW294837.1|CW294837 104_775_11415396_116_36233_034 Sorgh... 60 2e-007
gb|CW294838.1|CW294838 104_775_11415396_148_36234_034 Sorgh... 60 2e-007
gb|CW345965.1|CW345965 104_849_11488777_116_36217_011 Sorgh... 60 2e-007
gb|CW345966.1|CW345966 104_849_11488777_148_36218_011 Sorgh... 60 2e-007
gb|BE366751.1|BE366751 PI1_3_F06.g1_A002 Pathogen induced 1... 60 2e-007
gb|BM318020.1|BM318020 PI1_36_E06.g9_A002 Pathogen induced ... 60 2e-007
gb|CF427182.1|CF427182 PH1_4_G10.b1_A002 Phosphorous-defici... 60 2e-007
gb|CN126076.1|CN126076 RHOH1_15_B06.b1_A002 Acid- and alkal... 60 2e-007
gb|CX608661.1|CX608661 ANR1_40_A09.b1_A002 Anaerobic roots ... 60 2e-007
gb|CX610538.1|CX610538 ANR1_19_G09.b1_A002 Anaerobic roots ... 60 2e-007
gb|CX611043.1|CX611043 ANR1_22_G05.b1_A002 Anaerobic roots ... 60 2e-007
gb|CX611163.1|CX611163 ANR1_23_B06.b1_A002 Anaerobic roots ... 60 2e-007
gb|CX622143.1|CX622143 GABR1_62_F09.b2_A002 GA- or brassino... 60 2e-007
gb|CL181970.1|CL181970 104_393_10897108_148_31921_100 Sorgh... 58 9e-007
gb|CW157844.1|CW157844 104_561_11147739_116_36391_010 Sorgh... 58 9e-007
gb|CW157845.1|CW157845 104_561_11147739_148_36392_010 Sorgh... 58 9e-007
gb|CW184987.1|CW184987 104_602_11165826_116_36692_071 Sorgh... 58 9e-007
gb|CW184988.1|CW184988 104_602_11165826_148_36691_071 Sorgh... 58 9e-007
gb|CW251951.1|CW251951 104_714_11224220_148_35073_068 Sorgh... 58 9e-007
gb|CW314688.1|CW314688 104_805_11471961_148_35819_039 Sorgh... 58 9e-007
gb|CW483692.1|CW483692 fsbb001f245h06f0 Sorghum methylation... 58 9e-007
gb|CW119823.1|CW119823 104_497_11108979_116_34640_016 Sorgh... 56 4e-006
gb|AW565784.1|AW565784 LG1_349_C06.g1_A002 Light Grown 1 (L... 56 4e-006
gb|BZ693496.1|BZ693496 SP__Ba0035C24.r SP__Ba Sorghum propi... 54 1e-005
gb|CL151818.1|CL151818 104_334_10779515_114_31361_299 Sorgh... 54 1e-005
gb|CW138607.1|CW138607 104_528_11134785_116_34890_041 Sorgh... 54 1e-005
gb|CW138608.1|CW138608 104_528_11134785_148_34894_041 Sorgh... 54 1e-005
gb|CW207268.1|CW207268 104_636_11188037_116_36971_025 Sorgh... 54 1e-005
gb|CW312225.1|CW312225 104_802_11470645_148_35778_063 Sorgh... 54 1e-005
gb|CW787486.1|CW787486 SP__Ba0035C24.r SP__Ba Sorghum propi... 54 1e-005
gb|BE355653.1|BE355653 DG1_115_B08.g1_A002 Dark Grown 1 (DG... 54 1e-005
gb|BE357204.1|BE357204 DG1_147_F07.g1_A002 Dark Grown 1 (DG... 54 1e-005
gb|BE360446.1|BE360446 DG1_63_H09.g1_A002 Dark Grown 1 (DG1... 54 1e-005
gb|BE363172.1|BE363172 DG1_9_G07.g1_A002 Dark Grown 1 (DG1)... 54 1e-005
gb|BF421887.1|BF421887 FM1_16_F07.g1_A003 Floral-Induced Me... 54 1e-005
gb|BF587991.1|BF587991 FM1_35_D04.g1_A003 Floral-Induced Me... 54 1e-005
gb|BF705449.1|BF705449 RHIZ2_4_B02.g1_A003 Rhizome2 (RHIZ2)... 54 1e-005
gb|BG053008.1|BG053008 RHIZ2_16_C09.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG101959.1|BG101959 RHIZ2_21_H10.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG102572.1|BG102572 RHIZ2_34_F11.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG103558.1|BG103558 RHIZ2_38_A04.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG241437.1|BG241437 RHIZ2_49_B10.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG241566.1|BG241566 RHIZ2_17_B07.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG357638.1|BG357638 OV2_32_D07.g1_A002 Ovary 2 (OV2) Sor... 54 1e-005
gb|BG465866.1|BG465866 RHIZ2_45_E08.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG465910.1|BG465910 RHIZ2_46_B05.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG487882.1|BG487882 RHIZ2_60_E07.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG558903.1|BG558903 RHIZ2_52_B07.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG559158.1|BG559158 RHIZ2_55_D05.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG559660.1|BG559660 RHIZ2_72_A12.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG559923.1|BG559923 RHIZ2_75_C11.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|BG605901.1|BG605901 RHIZ2_83_A01.g1_A003 Rhizome2 (RHIZ2... 54 1e-005
gb|CD211283.1|CD211283 HS1_59_F05.b1_A012 Heat-shocked seed... 54 1e-005
gb|CD219864.1|CD219864 CCC1_59_D12.b1_A007 Callus culture/c... 54 1e-005
gb|CD219881.1|CD219881 CCC1_59_D12.g1_A007 Callus culture/c... 54 1e-005
gb|CD222346.1|CD222346 CCC1_21_C05.b1_A007 Callus culture/c... 54 1e-005
gb|CD223454.1|CD223454 CCC1_28_F06.b1_A007 Callus culture/c... 54 1e-005
gb|CD224141.1|CD224141 CCC1_32_H11.b1_A007 Callus culture/c... 54 1e-005
gb|CD224264.1|CD224264 CCC1_33_F03.b1_A007 Callus culture/c... 54 1e-005
gb|CD227868.1|CD227868 CCC1_56_C05.b1_A007 Callus culture/c... 54 1e-005
gb|CD231554.1|CD231554 SS1_22_C03.b1_A012 Salt-stressed see... 54 1e-005
gb|CD231556.1|CD231556 SS1_22_B09.b1_A012 Salt-stressed see... 54 1e-005
gb|CD232253.1|CD232253 SS1_39_H07.b1_A012 Salt-stressed see... 54 1e-005
gb|CD232850.1|CD232850 SS1_10_G12.b1_A012 Salt-stressed see... 54 1e-005
gb|CD233293.1|CD233293 SS1_13_E06.b1_A012 Salt-stressed see... 54 1e-005
gb|CD235971.1|CD235971 SS1_25_B02.b1_A012 Salt-stressed see... 54 1e-005
gb|CD422862.1|CD422862 SA1_38_C11.b1_A002 Salicylic acid-tr... 54 1e-005
gb|CD426490.1|CD426490 SA1_21_B12.b1_A002 Salicylic acid-tr... 54 1e-005
gb|CD431829.1|CD431829 ETH1_11_C08.b1_A002 Ethylene-treated... 54 1e-005
gb|CD461569.1|CD461569 SA1_33_F08.b1_A002 Salicylic acid-tr... 54 1e-005
gb|CF074250.1|CF074250 FE1_23_D05.b1_A002 Iron-deficient se... 54 1e-005
gb|CF431307.1|CF431307 NIT1_5_D02.b1_A002 Nitrogen-deficien... 54 1e-005
gb|CN126134.1|CN126134 RHOH1_15_H01.b1_A002 Acid- and alkal... 54 1e-005
gb|CN126472.1|CN126472 RHOH1_17_H02.b1_A002 Acid- and alkal... 54 1e-005
gb|CN126811.1|CN126811 RHOH1_19_G01.b1_A002 Acid- and alkal... 54 1e-005
gb|CN130724.1|CN130724 RHOH1_43_H05.b1_A002 Acid- and alkal... 54 1e-005
gb|CN132285.1|CN132285 OX1_5_E12.b1_A002 Oxidatively-stress... 54 1e-005
gb|CN135639.1|CN135639 OX1_38_C10.b1_A002 Oxidatively-stres... 54 1e-005
gb|CN137853.1|CN137853 OX1_60_C10.b1_A002 Oxidatively-stres... 54 1e-005
gb|CN138170.1|CN138170 OX1_62_D10.b1_A002 Oxidatively-stres... 54 1e-005
gb|CN142012.1|CN142012 WOUND1_3_G05.b1_A002 Wounded leaves ... 54 1e-005
gb|CN142468.1|CN142468 WOUND1_10_E08.b1_A002 Wounded leaves... 54 1e-005
gb|CN142639.1|CN142639 WOUND1_11_F04.b1_A002 Wounded leaves... 54 1e-005
gb|CN142791.1|CN142791 WOUND1_12_F02.b1_A002 Wounded leaves... 54 1e-005
gb|CN142892.1|CN142892 WOUND1_13_A05.b1_A002 Wounded leaves... 54 1e-005
gb|CN144061.1|CN144061 WOUND1_20_A06.b1_A002 Wounded leaves... 54 1e-005
gb|CN144424.1|CN144424 WOUND1_22_D09.b1_A002 Wounded leaves... 54 1e-005
gb|CN144817.1|CN144817 WOUND1_25_D03.b2_A002 Wounded leaves... 54 1e-005
gb|CN144901.1|CN144901 WOUND1_25_D03.g1_A002 Wounded leaves... 54 1e-005
gb|CN145020.1|CN145020 WOUND1_26_G06.b2_A002 Wounded leaves... 54 1e-005
gb|CN145141.1|CN145141 WOUND1_27_B11.b2_A002 Wounded leaves... 54 1e-005
gb|CN146974.1|CN146974 WOUND1_46_B05.b1_A002 Wounded leaves... 54 1e-005
gb|CN148099.1|CN148099 WOUND1_54_E05.b1_A002 Wounded leaves... 54 1e-005
gb|CN148182.1|CN148182 WOUND1_54_E05.g1_A002 Wounded leaves... 54 1e-005
gb|CN148254.1|CN148254 WOUND1_55_D07.b1_A002 Wounded leaves... 54 1e-005
gb|CN148860.1|CN148860 WOUND1_59_F07.b1_A002 Wounded leaves... 54 1e-005
gb|CN149832.1|CN149832 WOUND1_65_D06.b1_A002 Wounded leaves... 54 1e-005
gb|CN150101.1|CN150101 WOUND1_67_A02.b1_A002 Wounded leaves... 54 1e-005
gb|CN151354.1|CN151354 WOUND1_75_A07.b1_A002 Wounded leaves... 54 1e-005
gb|CN151700.1|CN151700 WOUND1_77_C01.b1_A002 Wounded leaves... 54 1e-005
gb|CN152586.1|CN152586 WOUND1_83_B01.b1_A002 Wounded leaves... 54 1e-005
gb|CF675649.1|CF675649 CYP71E1 Subtractive cDNA library fro... 54 1e-005
gb|CX606656.1|CX606656 ANR1_4_F07.b1_A002 Anaerobic roots S... 54 1e-005
gb|CX606785.1|CX606785 ANR1_5_A08.b1_A002 Anaerobic roots S... 54 1e-005
gb|CX606858.1|CX606858 ANR1_5_H01.b1_A002 Anaerobic roots S... 54 1e-005
gb|CX607037.1|CX607037 ANR1_6_G11.b1_A002 Anaerobic roots S... 54 1e-005
gb|CX607388.1|CX607388 ANR1_8_G10.b1_A002 Anaerobic roots S... 54 1e-005
gb|CX607535.1|CX607535 ANR1_29_F10.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX608012.1|CX608012 ANR1_32_D01.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX609348.1|CX609348 ANR1_12_D07.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX609508.1|CX609508 ANR1_13_D05.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX610000.1|CX610000 ANR1_16_B12.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX610482.1|CX610482 ANR1_19_B04.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX611220.1|CX611220 ANR1_23_G09.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX611683.1|CX611683 ANR1_26_C10.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX612239.1|CX612239 GABR1_1_G06.b1_A002 GA- or brassinol... 54 1e-005
gb|CX612550.1|CX612550 GABR1_3_C05.b1_A002 GA- or brassinol... 54 1e-005
gb|CX612948.1|CX612948 GABR1_5_H05.b1_A002 GA- or brassinol... 54 1e-005
gb|CX612952.1|CX612952 GABR1_5_H09.b1_A002 GA- or brassinol... 54 1e-005
gb|CX613126.1|CX613126 GABR1_6_H11.b1_A002 GA- or brassinol... 54 1e-005
gb|CX613292.1|CX613292 GABR1_7_H02.b1_A002 GA- or brassinol... 54 1e-005
gb|CX613397.1|CX613397 GABR1_8_A02.b1_A002 GA- or brassinol... 54 1e-005
gb|CX613806.1|CX613806 GABR1_10_G04.b1_A002 GA- or brassino... 54 1e-005
gb|CX614125.1|CX614125 GABR1_12_E10.b1_A002 GA- or brassino... 54 1e-005
gb|CX614280.1|CX614280 GABR1_13_D05.b1_A002 GA- or brassino... 54 1e-005
gb|CX614948.1|CX614948 GABR1_17_F09.b1_A002 GA- or brassino... 54 1e-005
gb|CX615401.1|CX615401 GABR1_20_A01.b1_A002 GA- or brassino... 54 1e-005
gb|CX615616.1|CX615616 GABR1_21_E11.b1_A002 GA- or brassino... 54 1e-005
gb|CX615720.1|CX615720 GABR1_22_E11.b1_A002 GA- or brassino... 54 1e-005
gb|CX618160.1|CX618160 GABR1_38_B09.b1_A002 GA- or brassino... 54 1e-005
gb|CX618553.1|CX618553 GABR1_40_G03.b1_A002 GA- or brassino... 54 1e-005
gb|CX618571.1|CX618571 GABR1_40_H10.b1_A002 GA- or brassino... 54 1e-005
gb|CX619055.1|CX619055 GABR1_43_F06.b1_A002 GA- or brassino... 54 1e-005
gb|CX619683.1|CX619683 GABR1_47_D04.b1_A002 GA- or brassino... 54 1e-005
gb|CX619965.1|CX619965 GABR1_49_B04.b1_A002 GA- or brassino... 54 1e-005
gb|CX620640.1|CX620640 GABR1_53_C11.b1_A002 GA- or brassino... 54 1e-005
gb|CX620654.1|CX620654 GABR1_53_E03.b1_A002 GA- or brassino... 54 1e-005
gb|CX621433.1|CX621433 GABR1_58_C07.b1_A002 GA- or brassino... 54 1e-005
gb|CX621760.1|CX621760 GABR1_60_B08.b1_A002 GA- or brassino... 54 1e-005
gb|CX621968.1|CX621968 GABR1_61_F03.b2_A002 GA- or brassino... 54 1e-005
gb|CX623165.1|CX623165 GABR1_68_C12.b1_A002 GA- or brassino... 54 1e-005
gb|CX623172.1|CX623172 GABR1_68_D07.b1_A002 GA- or brassino... 54 1e-005
gb|DN551794.1|DN551794 pSPR-RT-A-H1_B10_S100 pSPR Sorghum p... 54 1e-005
gb|DN552334.1|DN552334 pSPR-RT-A-H2_A01_C319 pSPR Sorghum p... 54 1e-005
gb|AF029858.1|AF029858 Sorghum bicolor cytochrome P450 CYP7... 54 1e-005
gb|CL153869.1|CL153869 104_338_10781006_114_31369_254 Sorgh... 52 6e-005
gb|CL166631.1|CL166631 104_362_10809500_114_31798_332 Sorgh... 52 6e-005
gb|CW122221.1|CW122221 104_501_11110531_116_34677_080 Sorgh... 52 6e-005
gb|CW122222.1|CW122222 104_501_11110531_148_34673_080 Sorgh... 52 6e-005
gb|CW186956.1|CW186956 104_605_11166836_148_36715_078 Sorgh... 52 6e-005
gb|CW350303.1|CW350303 fsbb001f011i17k0 Sorghum methylation... 52 6e-005
gb|CW449224.1|CW449224 fsbb001f183e06f0 Sorghum methylation... 52 6e-005
gb|CW497137.1|CW497137 fsbb001f289l15f0 Sorghum methylation... 52 6e-005
gb|CD233891.1|CD233891 SS1_5_B04.b1_A012 Salt-stressed seed... 52 6e-005
gb|CN132121.1|CN132121 OX1_4_E09.b1_A002 Oxidatively-stress... 52 6e-005
gb|CX617002.1|CX617002 GABR1_31_D06.b1_A002 GA- or brassino... 52 6e-005
gb|CL166632.1|CL166632 104_362_10809500_116_31799_332 Sorgh... 50 2e-004
gb|CW135370.1|CW135370 104_520_11117813_116_34836_031 Sorgh... 50 2e-004
gb|CW135371.1|CW135371 104_520_11117813_148_34832_031 Sorgh... 50 2e-004
gb|CW328046.1|CW328046 104_824_11479087_116_35987_032 Sorgh... 50 2e-004
gb|CW497138.1|CW497138 fsbb001f289l15k0 Sorghum methylation... 50 2e-004
gb|BG051954.1|BG051954 RHIZ2_7_A07.g1_A003 Rhizome2 (RHIZ2)... 50 2e-004
gb|CN144283.1|CN144283 WOUND1_21_F07.b1_A002 Wounded leaves... 50 2e-004
gb|CL188546.1|CL188546 104_405_10901677_116_32454_061 Sorgh... 48 9e-004
gb|CW146603.1|CW146603 104_539_11139081_116_34988_037 Sorgh... 48 9e-004
gb|CW495205.1|CW495205 fsbb001f286n22k0 Sorghum methylation... 48 9e-004
gb|BE360127.1|BE360127 DG1_61_D01.g1_A002 Dark Grown 1 (DG1... 48 9e-004
gb|BE360153.1|BE360153 DG1_61_D01.g2_A002 Dark Grown 1 (DG1... 48 9e-004
gb|CD223291.1|CD223291 CCC1_27_A10.b1_A007 Callus culture/c... 48 9e-004
gb|CN141771.1|CN141771 WOUND1_1_F03.g1_A002 Wounded leaves ... 48 9e-004
gb|BG049964.1|BG049964 FM1_68_F08.g1_A003 Floral-Induced Me... 46 0.003
gb|CN135339.1|CN135339 OX1_32_D04.b1_A002 Oxidatively-stres... 46 0.003
gb|CN135408.1|CN135408 OX1_32_D04.g1_A002 Oxidatively-stres... 46 0.003
gb|CN150613.1|CN150613 WOUND1_70_H03.b1_A002 Wounded leaves... 46 0.003
gb|CX611187.1|CX611187 ANR1_23_D08.b1_A002 Anaerobic roots ... 46 0.003
gb|CX611296.1|CX611296 ANR1_23_G09.g1_A002 Anaerobic roots ... 46 0.003
gb|BZ336357.1|BZ336357 hz33e08.g1 WGS-SbicolorF (JM107 adap... 44 0.013
gb|CW114112.1|CW114112 104_488_11105818_148_34562_035 Sorgh... 44 0.013
gb|CW229839.1|CW229839 104_671_11207529_148_37263_041 Sorgh... 44 0.013
gb|CW236515.1|CW236515 104_692_11215656_148_37499_088 Sorgh... 44 0.013
gb|CW328047.1|CW328047 104_824_11479087_148_35988_032 Sorgh... 44 0.013
gb|CW483941.1|CW483941 fsbb001f245n05k0 Sorghum methylation... 44 0.013
gb|CW492912.1|CW492912 fsbb001f283h01k0 Sorghum methylation... 44 0.013
gb|CW500161.1|CW500161 fsbb001f295f07k0 Sorghum methylation... 44 0.013
gb|CW500198.1|CW500198 fsbb001f295g07k0 Sorghum methylation... 44 0.013
gb|CD222278.1|CD222278 CCC1_21_H02.b1_A007 Callus culture/c... 44 0.013
gb|CD424025.1|CD424025 SA1_3_C01.b1_A002 Salicylic acid-tre... 44 0.013
gb|CD427026.1|CD427026 SA1_17_A11.b1_A002 Salicylic acid-tr... 44 0.013
gb|CD430773.1|CD430773 ETH1_5_E11.b1_A002 Ethylene-treated ... 44 0.013
gb|CD461441.1|CD461441 SA1_32_B08.b1_A002 Salicylic acid-tr... 44 0.013
gb|CN149498.1|CN149498 WOUND1_63_D05.b1_A002 Wounded leaves... 44 0.013
gb|CX613643.1|CX613643 GABR1_9_H05.b1_A002 GA- or brassinol... 44 0.013
gb|CL179129.1|CL179129 104_388_10895098_148_31909_010 Sorgh... 42 0.053
gb|CL187901.1|CL187901 104_403_10901215_116_32465_018 Sorgh... 42 0.053
gb|CW181209.1|CW181209 104_596_11163377_116_36647_077 Sorgh... 42 0.053
gb|CW232735.1|CW232735 104_685_11212981_116_37365_055 Sorgh... 42 0.053
gb|CW323131.1|CW323131 104_817_11476470_148_35959_027 Sorgh... 42 0.053
gb|CW328098.1|CW328098 104_824_11479113_148_35984_045 Sorgh... 42 0.053
gb|CN146986.1|CN146986 WOUND1_46_D06.b1_A002 Wounded leaves... 42 0.053
gb|CW032989.1|CW032989 104_262_10501703_114_30361 Sorghum m... 40 0.21
gb|CW257961.1|CW257961 104_723_11227618_116_35161_037 Sorgh... 40 0.21
gb|CW295328.1|CW295328 104_776_11460873_116_35616_037 Sorgh... 40 0.21
gb|CW323327.1|CW323327 104_817_11476573_116_35957_055 Sorgh... 40 0.21
gb|CW381852.1|CW381852 fsbb001f063h07f0 Sorghum methylation... 40 0.21
gb|CD429566.1|CD429566 ETH1_14_E05.b1_A002 Ethylene-treated... 40 0.21
gb|CN142916.1|CN142916 WOUND1_13_C09.b1_A002 Wounded leaves... 40 0.21
gb|CX614730.1|CX614730 GABR1_16_A01.b1_A002 GA- or brassino... 40 0.21
>gb|CW433885.1|CW433885 fsbb001f149f03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f149f03, DNA
sequence
Length = 502
Score = 504 bits (254), Expect = e-141
Identities = 351/383 (91%), Gaps = 3/383 (0%)
Strand = Plus / Plus
Query: 175 agtgggacacgaggggttgccaccaccaaaaggtcggaacgccgtggcgtagcaatccca 234
||||||||||||||| ||| |||||||||||||||||||||||||||| ||| ||||||
Sbjct: 109 agtgggacacgagggattggcaccaccaaaaggtcggaacgccgtggcacagcgatccca 168
Query: 235 aatgcctcggtcatgtccagctcctccgccgttagccctcccggcaaactccagtcgaag 294
|||||||||||||||||||||||||| |||| ||||| |||||||| ||||||||||||
Sbjct: 169 aatgcctcggtcatgtccagctcctcggccgcaagcccacccggcaagctccagtcgaag 228
Query: 295 tggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaacgtcatgccgggg 354
|||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||
Sbjct: 229 tggaacagcaacgccgcgagcgcgagctcgatgtgagccagcccgaacgtcatgccgggg 288
Query: 355 cagatccgccgcccggcaccgaacggtatgaactcgaagtctgcccccttgaagtccctg 414
||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||
Sbjct: 289 cagatccgccgcccggcaccgaacggtatgaactcgaagtcggcgcccctgaagtccctg 348
Query: 415 gt---actctgctcgaacctttccggcaagaacttgncgggctcgtcccagggggccggg 471
| |||||||||||||| ||||||||||||| | | || ||||||||| | ||||||
Sbjct: 349 ctgccgctctgctcgaacctctccggcaagaactcgtccggttcgtcccagtgcgccggg 408
Query: 472 tccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtacccg 531
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 409 tccctgccgatcgcccacgcattcacgatcaccgtcgtgcccgccggcacgtcgaacccg 468
Query: 532 agcacctggcacgcgctctggca 554
|||||||||||||||||||||||
Sbjct: 469 agcacctggcacgcgctctggca 491
>gb|CW071877.1|CW071877 104_324_10591880_116_30463 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10591880, DNA
sequence
Length = 199
Score = 182 bits (92), Expect = 2e-044
Identities = 149/168 (88%)
Strand = Plus / Plus
Query: 175 agtgggacacgaggggttgccaccaccaaaaggtcggaacgccgtggcgtagcaatccca 234
||||||||||||||| ||| |||||||||||||||||||||||||||| | | ||||||
Sbjct: 32 agtgggacacgagggattggcaccaccaaaaggtcggaacgccgtggcacatcgatccca 91
Query: 235 aatgcctcggtcatgtccagctcctccgccgttagccctcccggcaaactccagtcgaag 294
|||||||||||||||||||||||||| |||| ||||| |||||||| ||||| ||||||
Sbjct: 92 aatgcctcggtcatgtccagctcctcggccgcaagcccacccggcaagctccaatcgaag 151
Query: 295 tggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaac 342
||||||||| |||| ||||||||| || || |||||||||||||||
Sbjct: 152 tggaacagctacgcctcgagcgcgaggtctatgtgagccagcccgaac 199
>gb|CW485366.1|CW485366 fsbb001f248b06f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f248b06, DNA
sequence
Length = 690
Score = 83.8 bits (42), Expect = 2e-014
Identities = 45/46 (97%)
Strand = Plus / Plus
Query: 509 tgcccgccggcacgtcgtacccgagcacctggcacgcgctctggca 554
||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 9 tgcccgccggcacgtcgaacccgagcacctggcacgcgctctggca 54
>gb|CW389731.1|CW389731 fsbb001f075b04k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f075b04, DNA
sequence
Length = 506
Score = 79.8 bits (40), Expect = 2e-013
Identities = 90/107 (84%)
Strand = Plus / Plus
Query: 425 cgaacctttccggcaagaacttgncgggctcgtcccagggggccgggtccctgccgatcg 484
||||||| ||||| | ||||| |||| ||||||||| ||||||||||| |||||||
Sbjct: 277 cgaacctctccgggacgaactcctcggggtcgtcccagctcgccgggtccctcccgatcg 336
Query: 485 cccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtacccg 531
||||||||||||||| |||| | | | |||||||||||||||||||
Sbjct: 337 cccacgcgttcacgaacaccctcgtcctcgccggcacgtcgtacccg 383
>gb|CW231895.1|CW231895 104_681_11211369_148_37349_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11211369, DNA
sequence
Length = 606
Score = 77.8 bits (39), Expect = 1e-012
Identities = 72/83 (86%)
Strand = Plus / Plus
Query: 449 cgggctcgtcccagggggccgggtccctgccgatcgcccacgcgttcacgatcaccgtga 508
|||| ||||||||| ||||||||||| |||||||||||||||||||||| |||| |
Sbjct: 291 cggggtcgtcccagctcgccgggtccctcccgatcgcccacgcgttcacgaacaccctcg 350
Query: 509 tgcccgccggcacgtcgtacccg 531
| | |||||||||||||||||||
Sbjct: 351 tcctcgccggcacgtcgtacccg 373
>gb|CW084589.1|CW084589 104_427_10945885_116_32509_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10945885, DNA
sequence
Length = 605
Score = 73.8 bits (37), Expect = 2e-011
Identities = 46/49 (93%)
Strand = Plus / Plus
Query: 478 ccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgt 526
|||||||||||||||||||||| ||||||| ||||||| ||||||||||
Sbjct: 510 ccgatcgcccacgcgttcacgaacaccgtggtgcccgcgggcacgtcgt 558
>gb|CW150998.1|CW150998 104_551_11143708_148_36313_006 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11143708, DNA
sequence
Length = 459
Score = 73.8 bits (37), Expect = 2e-011
Identities = 46/49 (93%)
Strand = Plus / Minus
Query: 478 ccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgt 526
|||||||||||||||||||||| ||||||| ||||||| ||||||||||
Sbjct: 401 ccgatcgcccacgcgttcacgaacaccgtggtgcccgcgggcacgtcgt 353
>gb|AC169377.3| Sorghum bicolor clone SB_BBc0068O12, WORKING DRAFT SEQUENCE, 3
unordered pieces
Length = 105622
Score = 73.8 bits (37), Expect = 2e-011
Identities = 46/49 (93%)
Strand = Plus / Minus
Query: 478 ccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgt 526
|||||||||||||||||||||| ||||||| ||||||| ||||||||||
Sbjct: 78229 ccgatcgcccacgcgttcacgaacaccgtggtgcccgcgggcacgtcgt 78181
>gb|AC169379.4| Sorghum bicolor clone SB_BBc0088B22, complete sequence
Length = 105215
Score = 73.8 bits (37), Expect = 2e-011
Identities = 46/49 (93%)
Strand = Plus / Plus
Query: 478 ccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgt 526
|||||||||||||||||||||| ||||||| ||||||| ||||||||||
Sbjct: 27362 ccgatcgcccacgcgttcacgaacaccgtggtgcccgcgggcacgtcgt 27410
>gb|CW065653.1|CW065653 104_312_10523266_114_30129 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10523266, DNA
sequence
Length = 325
Score = 69.9 bits (35), Expect = 2e-010
Identities = 101/123 (82%)
Strand = Plus / Plus
Query: 285 ccagtcgaagtggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaacgt 344
|||||||||||||||||||| ||||||||||| ||||| | || ||||||||||
Sbjct: 36 ccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgttggcgagcccgaacga 95
Query: 345 catgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtctgccccctt 404
||| || ||||| |||| ||| ||||| |||||||| | || ||||||||| || |||||
Sbjct: 96 catccccgggcacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccctt 155
Query: 405 gaa 407
|||
Sbjct: 156 gaa 158
Score = 52.0 bits (26), Expect = 6e-005
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 491 cgttcacgatcaccgtgatgcccgccggcacgtcgtacccgagcac 536
|||| |||| ||| ||| ||||||||||||||||||| ||||||||
Sbjct: 254 cgttgacgagcacggtggtgcccgccggcacgtcgtagccgagcac 299
>gb|CW084588.1|CW084588 104_427_10945885_114_32505_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10945885, DNA
sequence
Length = 745
Score = 69.9 bits (35), Expect = 2e-010
Identities = 44/47 (93%)
Strand = Plus / Minus
Query: 480 gatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgt 526
|||||||||||||||||||| ||||||| ||||||| ||||||||||
Sbjct: 536 gatcgcccacgcgttcacgaacaccgtggtgcccgcgggcacgtcgt 490
>gb|CW235305.1|CW235305 104_690_11214911_116_37409_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214911, DNA
sequence
Length = 577
Score = 69.9 bits (35), Expect = 2e-010
Identities = 101/123 (82%)
Strand = Plus / Minus
Query: 285 ccagtcgaagtggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaacgt 344
|||||||||||||||||||| ||||||||||| ||||| | || ||||||||||
Sbjct: 549 ccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgttggcgagcccgaacga 490
Query: 345 catgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtctgccccctt 404
||| || ||||| |||| ||| ||||| |||||||| | || ||||||||| || |||||
Sbjct: 489 catccccgggcacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccctt 430
Query: 405 gaa 407
|||
Sbjct: 429 gaa 427
Score = 52.0 bits (26), Expect = 6e-005
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 491 cgttcacgatcaccgtgatgcccgccggcacgtcgtacccgagcac 536
|||| |||| ||| ||| ||||||||||||||||||| ||||||||
Sbjct: 331 cgttgacgagcacggtggtgcccgccggcacgtcgtagccgagcac 286
>gb|CW235306.1|CW235306 104_690_11214911_148_37413_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214911, DNA
sequence
Length = 571
Score = 69.9 bits (35), Expect = 2e-010
Identities = 101/123 (82%)
Strand = Plus / Plus
Query: 285 ccagtcgaagtggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaacgt 344
|||||||||||||||||||| ||||||||||| ||||| | || ||||||||||
Sbjct: 334 ccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgttggcgagcccgaacga 393
Query: 345 catgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtctgccccctt 404
||| || ||||| |||| ||| ||||| |||||||| | || ||||||||| || |||||
Sbjct: 394 catccccgggcacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccctt 453
Query: 405 gaa 407
|||
Sbjct: 454 gaa 456
>gb|CW350302.1|CW350302 fsbb001f011i17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f011i17, DNA
sequence
Length = 752
Score = 69.9 bits (35), Expect = 2e-010
Identities = 101/123 (82%)
Strand = Plus / Plus
Query: 285 ccagtcgaagtggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaacgt 344
|||||||||||||||||||| ||||||||||| ||||| | || ||||||||||
Sbjct: 387 ccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgttggcgagcccgaacga 446
Query: 345 catgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtctgccccctt 404
||| || ||||| |||| ||| ||||| |||||||| | || ||||||||| || |||||
Sbjct: 447 catccccgggcacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccctt 506
Query: 405 gaa 407
|||
Sbjct: 507 gaa 509
Score = 52.0 bits (26), Expect = 6e-005
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 491 cgttcacgatcaccgtgatgcccgccggcacgtcgtacccgagcac 536
|||| |||| ||| ||| ||||||||||||||||||| ||||||||
Sbjct: 605 cgttgacgagcacggtggtgcccgccggcacgtcgtagccgagcac 650
>gb|CL153870.1|CL153870 104_338_10781006_116_31370_254 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10781006, DNA
sequence
Length = 701
Score = 61.9 bits (31), Expect = 6e-008
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 352 gggcagatccgccgcccggcaccgaacggtatgaactcgaagt 394
||||||||||| || ||||| ||||||||||||||||||||||
Sbjct: 197 gggcagatccggcggccggccccgaacggtatgaactcgaagt 239
Score = 52.0 bits (26), Expect = 6e-005
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 466 gccgggtccctgccgatcgcccacgcgttcacga 499
||||||||||||||||| ||||||||||| ||||
Sbjct: 311 gccgggtccctgccgatggcccacgcgttgacga 344
>gb|CW253648.1|CW253648 104_717_11225217_148_35108_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11225217, DNA
sequence
Length = 388
Score = 61.9 bits (31), Expect = 6e-008
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 349 ccggggcagatccgccgcccggcaccgaacggtat 383
||||||||||||||||||||||| |||||||||||
Sbjct: 190 ccggggcagatccgccgcccggcgccgaacggtat 224
>gb|CL170464.1|CL170464 104_371_10813835_148_31790_155 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10813835, DNA
sequence
Length = 592
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| |||||||||| |||||||||| ||| | ||||||||||||||||| |
Sbjct: 269 gggtccctcgcgatcgcccaggcgttcacgaacacgatcgtgcccgccggcacgtcgaat 328
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 329 cccagcacctggca 342
>gb|CL171390.1|CL171390 104_373_10889394_148_31776_066 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10889394, DNA
sequence
Length = 749
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| |||||||||| |||||||||| ||| | ||||||||||||||||| |
Sbjct: 712 gggtccctcgcgatcgcccaggcgttcacgaacacgatcgtgcccgccggcacgtcgaat 653
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 652 cccagcacctggca 639
>gb|CL195525.1|CL195525 104_421_10942439_114_32308_096 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10942439, DNA
sequence
Length = 601
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| |||||||||| |||||||||| ||| | ||||||||||||||||| |
Sbjct: 360 gggtccctcgcgatcgcccaggcgttcacgaacacgatcgtgcccgccggcacgtcgaat 301
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 300 cccagcacctggca 287
>gb|CW294837.1|CW294837 104_775_11415396_116_36233_034 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11415396, DNA
sequence
Length = 703
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |
Sbjct: 361 gggtccctcccgatcgcccatgcgttcacgaacacgactgtgcccgccggcacgtcgaat 420
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 421 cccagcacctggca 434
Score = 42.1 bits (21), Expect = 0.053
Identities = 63/77 (81%)
Strand = Plus / Plus
Query: 334 agcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcgaag 393
||||| |||| |||||| ||||| |||| || || || |||||||| | | ||||||||
Sbjct: 226 agcccaaacgccatgcccgggcacatccttcgtcctgccccgaacggcacgtactcgaag 285
Query: 394 tctgcccccttgaagtc 410
|| | ||||||||||||
Sbjct: 286 tccgtccccttgaagtc 302
>gb|CW294838.1|CW294838 104_775_11415396_148_36234_034 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11415396, DNA
sequence
Length = 711
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |
Sbjct: 376 gggtccctcccgatcgcccatgcgttcacgaacacgactgtgcccgccggcacgtcgaat 317
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 316 cccagcacctggca 303
Score = 42.1 bits (21), Expect = 0.053
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 334 agcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcgaag 393
||||| |||| |||||| ||||| |||| || || || |||||||| | | ||||||||
Sbjct: 511 agcccaaacgccatgcccgggcacatccttcgtcctgccccgaacggcacgtactcgaag 452
Query: 394 tctgcccccttgaagtc 410
|| | ||||||||||||
Sbjct: 451 tccgtccccttgaagtc 435
>gb|CW345965.1|CW345965 104_849_11488777_116_36217_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11488777, DNA
sequence
Length = 605
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| |||||||||| |||||||||| ||| | ||||||||||||||||| |
Sbjct: 571 gggtccctcgcgatcgcccaggcgttcacgaacacgatcgtgcccgccggcacgtcgaat 512
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 511 cccagcacctggca 498
>gb|CW345966.1|CW345966 104_849_11488777_148_36218_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11488777, DNA
sequence
Length = 735
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Plus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| |||||||||| |||||||||| ||| | ||||||||||||||||| |
Sbjct: 393 gggtccctcgcgatcgcccaggcgttcacgaacacgatcgtgcccgccggcacgtcgaat 452
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 453 cccagcacctggca 466
>gb|BE366751.1|BE366751 PI1_3_F06.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 577
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |
Sbjct: 93 gggtccctcccgatcgcccatgcgttcacgaacacgactgtgcccgccggcacgtcgaat 34
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 33 cccagcacctggca 20
Score = 42.1 bits (21), Expect = 0.053
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 334 agcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcgaag 393
||||| |||| |||||| ||||| |||| || || || |||||||| | | ||||||||
Sbjct: 228 agcccaaacgccatgcccgggcacatccttcgtcctgccccgaacggcacgtactcgaag 169
Query: 394 tctgcccccttgaagtc 410
|| | ||||||||||||
Sbjct: 168 tccgtccccttgaagtc 152
>gb|BM318020.1|BM318020 PI1_36_E06.g9_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 631
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |
Sbjct: 160 gggtccctcccgatcgcccatgcgttcacgaacacgactgtgcccgccggcacgtcgaat 101
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 100 cccagcacctggca 87
Score = 42.1 bits (21), Expect = 0.053
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 334 agcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcgaag 393
||||| |||| |||||| ||||| |||| || || || |||||||| | | ||||||||
Sbjct: 295 agcccaaacgccatgcccgggcacatccttcgtcctgccccgaacggcacgtactcgaag 236
Query: 394 tctgcccccttgaagtc 410
|| | ||||||||||||
Sbjct: 235 tccgtccccttgaagtc 219
>gb|CF427182.1|CF427182 PH1_4_G10.b1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_4_G10_A002 3', mRNA sequence
Length = 579
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 469 gggtccctgccgatcgcccacgcgttcacgatcaccgtgatgcccgccggcacgtcgtac 528
|||||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |
Sbjct: 97 gggtccctcccgatcgcccatgcgttcacgaacacgactgtgcccgccggcacgtcgaat 38
Query: 529 ccgagcacctggca 542
|| |||||||||||
Sbjct: 37 cccagcacctggca 24
Score = 42.1 bits (21), Expect = 0.053
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 334 agcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcgaag 393
||||| |||| |||||| ||||| |||| || || || |||||||| | | ||||||||
Sbjct: 232 agcccaaacgccatgcccgggcacatccttcgtcctgccccgaacggcacgtactcgaag 173
Query: 394 tctgcccccttgaagtc 410
|| | ||||||||||||
Sbjct: 172 tccgtccccttgaagtc 156
>gb|CN126076.1|CN126076 RHOH1_15_B06.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_15_B06_A002 3', mRNA sequence
Length = 816
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtc 395
|||||||||||||||| ||| ||||| |||||||| | ||||||||||||
Sbjct: 493 atgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtc 444
>gb|CX608661.1|CX608661 ANR1_40_A09.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_40_A09_A002 3', mRNA sequence
Length = 587
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtc 395
|||||||||||||||| ||| ||||| |||||||| | ||||||||||||
Sbjct: 261 atgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtc 212
>gb|CX610538.1|CX610538 ANR1_19_G09.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_19_G09_A002 3', mRNA sequence
Length = 743
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtc 395
|||||||||||||||| ||| ||||| |||||||| | ||||||||||||
Sbjct: 431 atgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtc 382
>gb|CX611043.1|CX611043 ANR1_22_G05.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_22_G05_A002 3', mRNA sequence
Length = 777
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtc 395
|||||||||||||||| ||| ||||| |||||||| | ||||||||||||
Sbjct: 455 atgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtc 406
>gb|CX611163.1|CX611163 ANR1_23_B06.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_23_B06_A002 3', mRNA sequence
Length = 778
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtc 395
|||||||||||||||| ||| ||||| |||||||| | ||||||||||||
Sbjct: 514 atgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtc 465
>gb|CX622143.1|CX622143 GABR1_62_F09.b2_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_62_F09_A002 3', mRNA sequence
Length = 735
Score = 60.0 bits (30), Expect = 2e-007
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtc 395
|||||||||||||||| ||| ||||| |||||||| | ||||||||||||
Sbjct: 391 atgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtc 342
>gb|CL181970.1|CL181970 104_393_10897108_148_31921_100 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10897108, DNA
sequence
Length = 718
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 321 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 262
Query: 391 aagtc 395
|||||
Sbjct: 261 aagtc 257
>gb|CW157844.1|CW157844 104_561_11147739_116_36391_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11147739, DNA
sequence
Length = 744
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 341 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 400
Query: 391 aagtc 395
|||||
Sbjct: 401 aagtc 405
>gb|CW157845.1|CW157845 104_561_11147739_148_36392_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11147739, DNA
sequence
Length = 733
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 454 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 395
Query: 391 aagtc 395
|||||
Sbjct: 394 aagtc 390
>gb|CW184987.1|CW184987 104_602_11165826_116_36692_071 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11165826, DNA
sequence
Length = 707
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 472 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 531
Query: 391 aagtc 395
|||||
Sbjct: 532 aagtc 536
>gb|CW184988.1|CW184988 104_602_11165826_148_36691_071 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11165826, DNA
sequence
Length = 668
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 332 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 273
Query: 391 aagtc 395
|||||
Sbjct: 272 aagtc 268
>gb|CW251951.1|CW251951 104_714_11224220_148_35073_068 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11224220, DNA
sequence
Length = 621
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 84 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 25
Query: 391 aagtc 395
|||||
Sbjct: 24 aagtc 20
>gb|CW314688.1|CW314688 104_805_11471961_148_35819_039 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11471961, DNA
sequence
Length = 682
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 395 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 454
Query: 391 aagtc 395
|||||
Sbjct: 455 aagtc 459
>gb|CW483692.1|CW483692 fsbb001f245h06f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f245h06, DNA
sequence
Length = 815
Score = 58.0 bits (29), Expect = 9e-007
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 331 gccagcccgaacgtcatgccggggcagatccgccgcccggcaccgaacggtatgaactcg 390
|||| |||||||||||| || ||||||||||||| ||||| || ||||| ||||||||
Sbjct: 489 gccaacccgaacgtcatcccagggcagatccgcctcccggagccaaacgggatgaactca 430
Query: 391 aagtc 395
|||||
Sbjct: 429 aagtc 425
>gb|CW119823.1|CW119823 104_497_11108979_116_34640_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11108979, DNA
sequence
Length = 599
Score = 56.0 bits (28), Expect = 4e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatga 385
|||||||||||||||| ||||||||| |||||||| ||||
Sbjct: 529 atgccggggcagatcctccgcccggcgccgaacgggatga 490
>gb|AW565784.1|AW565784 LG1_349_C06.g1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 651
Score = 56.0 bits (28), Expect = 4e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 346 atgccggggcagatccgccgcccggcaccgaacggtatga 385
|||||||||||||||| ||||||||| |||||||| ||||
Sbjct: 317 atgccggggcagatcctccgcccggcgccgaacgggatga 278
>gb|BZ693496.1|BZ693496 SP__Ba0035C24.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0035C24 3', DNA sequence
Length = 1146
Score = 54.0 bits (27), Expect = 1e-005
Identities = 99/123 (80%)
Strand = Plus / Plus
Query: 285 ccagtcgaagtggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaacgt 344
||||||||||||| |||||| ||| |||||| | | ||| || ||| || ||||||
Sbjct: 476 ccagtcgaagtggtacagcatcgccgcgagcaccagctccatgctggcctgcgcgaacgc 535
Query: 345 catgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtctgccccctt 404
|||||||||||| |||| || ||||| |||||||| |||| |||||||| || |||||
Sbjct: 536 catgccggggcacatcctgcgaccggctccgaacggcgtgaattcgaagtcggcgccctt 595
Query: 405 gaa 407
|||
Sbjct: 596 gaa 598
>gb|CL151818.1|CL151818 104_334_10779515_114_31361_299 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10779515, DNA
sequence
Length = 616
Score = 54.0 bits (27), Expect = 1e-005
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 352 gggcagatccgccgcccggcaccgaacggtatgaactcgaagt 394
||||||||||| || ||||| ||||||||||||| ||||||||
Sbjct: 412 gggcagatccggcggccggccccgaacggtatgagctcgaagt 454
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 466 gccgggtccctgccgatcgcccacgcgttcacga 499
||||||||||||||||| ||||| ||||| ||||
Sbjct: 526 gccgggtccctgccgatggcccaggcgttgacga 559
>gb|CW138607.1|CW138607 104_528_11134785_116_34890_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11134785, DNA
sequence
Length = 696
Score = 54.0 bits (27), Expect = 1e-005
Identities = 39/43 (90%)
Strand = Plus / Plus
Query: 352 gggcagatccgccgcccggcaccgaacggtatgaactcgaagt 394
||||||||||| || ||||| ||||||||||||| ||||||||
Sbjct: 473 gggcagatccggcggccggccccgaacggtatgagctcgaagt 515
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 466 gccgggtccctgccgatcgcccacgcgttcacga 499
||||||||||||||||| ||||| ||||| ||||
Sbjct: 587 gccgggtccctgccgatggcccaggcgttgacga 620
>gb|CW138608.1|CW138608 104_528_11134785_148_34894_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11134785, DNA
sequence
Length = 665
Score = 54.0 bits (27), Expect = 1e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 352 gggcagatccgccgcccggcaccgaacggtatgaactcgaagt 394
||||||||||| || ||||| ||||||||||||| ||||||||
Sbjct: 512 gggcagatccggcggccggccccgaacggtatgagctcgaagt 470
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 466 gccgggtccctgccgatcgcccacgcgttcacga 499
||||||||||||||||| ||||| ||||| ||||
Sbjct: 398 gccgggtccctgccgatggcccaggcgttgacga 365
>gb|CW207268.1|CW207268 104_636_11188037_116_36971_025 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188037, DNA
sequence
Length = 469
Score = 54.0 bits (27), Expect = 1e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 352 gggcagatccgccgcccggcaccgaacggtatgaactcgaagt 394
||||||||||| || ||||| ||||||||||||| ||||||||
Sbjct: 384 gggcagatccggcggccggccccgaacggtatgagctcgaagt 342
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 466 gccgggtccctgccgatcgcccacgcgttcacga 499
||||||||||||||||| ||||| ||||| ||||
Sbjct: 270 gccgggtccctgccgatggcccaggcgttgacga 237
>gb|CW312225.1|CW312225 104_802_11470645_148_35778_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11470645, DNA
sequence
Length = 673
Score = 54.0 bits (27), Expect = 1e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 352 gggcagatccgccgcccggcaccgaacggtatgaactcgaagt 394
||||||||||| || ||||| ||||||||||||| ||||||||
Sbjct: 437 gggcagatccggcggccggccccgaacggtatgagctcgaagt 395
Score = 44.1 bits (22), Expect = 0.013
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 466 gccgggtccctgccgatcgcccacgcgttcacga 499
||||||||||||||||| ||||| ||||| ||||
Sbjct: 323 gccgggtccctgccgatggcccaggcgttgacga 290
>gb|CW787486.1|CW787486 SP__Ba0035C24.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0035C24 3', DNA sequence
Length = 862
Score = 54.0 bits (27), Expect = 1e-005
Identities = 99/123 (80%)
Strand = Plus / Plus
Query: 285 ccagtcgaagtggaacagcaacgcggcgagcgcgatctcgatatgagccagcccgaacgt 344
||||||||||||| |||||| ||| |||||| | | ||| || ||| || ||||||
Sbjct: 461 ccagtcgaagtggtacagcatcgccgcgagcaccagctccatgctggcctgcgcgaacgc 520
Query: 345 catgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtctgccccctt 404
|||||||||||| |||| || ||||| |||||||| |||| |||||||| || |||||
Sbjct: 521 catgccggggcacatcctgcgaccggctccgaacggcgtgaattcgaagtcggcgccctt 580
Query: 405 gaa 407
|||
Sbjct: 581 gaa 583
>gb|BE355653.1|BE355653 DG1_115_B08.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 550
Score = 54.0 bits (27), Expect = 1e-005
Identities = 39/43 (90%)
Strand = Plus / Minus
Query: 352 gggcagatccgccgcccggcaccgaacggtatgaactcgaagt 394
||||||||||| || ||||| ||||||||||||| ||||||||
Sbjct: 140 gggcagatccggcggccggccccgaacggtatgagctcgaagt 98
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 130,869
Number of Sequences: 832831
Number of extensions: 130869
Number of successful extensions: 37701
Number of sequences better than 0.5: 226
Number of HSP's better than 0.5 without gapping: 226
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37179
Number of HSP's gapped (non-prelim): 508
length of query: 554
length of database: 491,359,669
effective HSP length: 19
effective length of query: 535
effective length of database: 475,535,880
effective search space: 254411695800
effective search space used: 254411695800
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)