BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3185308.2.2
(697 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG412450.1|BG412450 OV2_34_C12.g1_A002 Ovary 2 (OV2) Sor... 517 e-145
gb|BG412749.1|BG412749 OV2_34_C12.b1_A002 Ovary 2 (OV2) Sor... 234 9e-060
gb|CL195140.1|CL195140 104_420_10942159_114_32302_028 Sorgh... 155 6e-036
gb|CW136107.1|CW136107 104_521_11118204_116_34845_048 Sorgh... 147 2e-033
gb|CL177978.1|CL177978 104_385_10894229_116_31914_293 Sorgh... 54 2e-005
gb|CW038341.1|CW038341 104_270_10504868_114_30385 Sorghum m... 54 2e-005
gb|CW075930.1|CW075930 104_363_10809810_114_31800_258 Sorgh... 54 2e-005
gb|CW325048.1|CW325048 104_819_11477484_116_35915_034 Sorgh... 54 2e-005
gb|CW416233.1|CW416233 fsbb001f116l03k0 Sorghum methylation... 54 2e-005
gb|CW426483.1|CW426483 fsbb001f137o10k0 Sorghum methylation... 54 2e-005
gb|CW479320.1|CW479320 fsbb001f237l21f0 Sorghum methylation... 54 2e-005
gb|CD231880.1|CD231880 SS1_30_D11.g1_A012 Salt-stressed see... 54 2e-005
gb|CF430353.1|CF430353 PH1_27_A08.g1_A002 Phosphorous-defic... 54 2e-005
gb|CN136158.1|CN136158 OX1_41_D05.b1_A002 Oxidatively-stres... 54 2e-005
gb|CN136232.1|CN136232 OX1_41_D05.g1_A002 Oxidatively-stres... 54 2e-005
gb|CX606996.1|CX606996 ANR1_6_C12.b1_A002 Anaerobic roots S... 54 2e-005
gb|CX607081.1|CX607081 ANR1_6_C12.g1_A002 Anaerobic roots S... 54 2e-005
gb|CX610991.1|CX610991 ANR1_22_B08.b1_A002 Anaerobic roots ... 54 2e-005
gb|CX611078.1|CX611078 ANR1_22_B08.g1_A002 Anaerobic roots ... 54 2e-005
gb|CW075931.1|CW075931 104_363_10809810_116_31801_258 Sorgh... 50 3e-004
gb|DN551840.1|DN551840 pSPR-RT-A-H2_G06_S131 pSPR Sorghum p... 46 0.004
gb|CW392760.1|CW392760 fsbb001f079i10f0 Sorghum methylation... 42 0.067
gb|CW471241.1|CW471241 fsbb001f225a12f0 Sorghum methylation... 42 0.067
gb|CL169669.1|CL169669 104_368_10812804_116_31809_276 Sorgh... 40 0.27
gb|CL169670.1|CL169670 104_368_10812804_148_31808_276 Sorgh... 40 0.27
gb|CW058402.1|CW058402 104_300_10518712_1_30028 Sorghum met... 40 0.27
gb|CW058403.1|CW058403 104_300_10518712_5_30082 Sorghum met... 40 0.27
gb|CW131207.1|CW131207 104_514_11115547_116_34786_080 Sorgh... 40 0.27
gb|CW326697.1|CW326697 104_822_11478355_116_35971_078 Sorgh... 40 0.27
gb|CW326698.1|CW326698 104_822_11478355_148_35970_078 Sorgh... 40 0.27
gb|CW332606.1|CW332606 104_830_11481506_116_36037_009 Sorgh... 40 0.27
gb|CW478119.1|CW478119 fsbb001f235n04f0 Sorghum methylation... 40 0.27
gb|CX623191.1|CX623191 GABR1_68_F03.b1_A002 GA- or brassino... 40 0.27
>gb|BG412450.1|BG412450 OV2_34_C12.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 657
Score = 517 bits (261), Expect = e-145
Identities = 365/404 (90%)
Strand = Plus / Minus
Query: 182 gatccgaccctagaagttcttggtggcctggtacgttttgccgaactgccagtcgcgggg 241
||||||| ||||||||||||||||||||||||| |||||| || ||| ||||||||||||
Sbjct: 604 gatccgatcctagaagttcttggtggcctggtatgttttgtcgtacttccagtcgcgggg 545
Query: 242 cgtgacgtgccaggaggtagccttgcggtggtcggcggtcatgacgcggaacgtcagcga 301
|| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||
Sbjct: 544 cgcgacgtgccaggaggtggccttgcggtggtcgccggtcatgacgcggaacgtcagcga 485
Query: 302 ctcgccggtgaggtcgacctccgtggtccagagctggccccagctgcgcttcatcggcgt 361
|||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||
Sbjct: 484 ctcgccggtgaggttgacctccgtgatccagagctgtccccagctgcgcttcatcggcgt 425
Query: 362 ccacttgacgcgcttgttgcccttcacccacagcgccaccacgtccccggcgccgcccac 421
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 424 ccacttgacgcgcttgttgcccttcaccgacagcgccaccacgtccccggcgccgcccac 365
Query: 422 gttggtcaccttcacctcgctgtagtgctggttccctgtgatcgtgtaccggatgccgcc 481
|||||||||| ||||| | |||||| | ||||||| ||||| |||||||||||||||||
Sbjct: 364 gttggtcaccatcaccatgttgtagttcgggttccccgtgatggtgtaccggatgccgcc 305
Query: 482 tttccnnncgcacgccaccttgcggtaggtgatgggcacgatgccggccttnncctnngc 541
|| || |||||||||||||||| |||||||||||||| ||||||||||| ||| |
Sbjct: 304 ttgcctcgcgcacgccaccttgcgataggtgatgggcacaatgccggccttctcctcgtc 245
Query: 542 gatcttgaggaacgccngtatgnnnagnncaaagtgctcgccct 585
|||||||||||||||| | ||| || | |||||||||||||
Sbjct: 244 gatcttgaggaacgccggcatggtgaggtcgaagtgctcgccct 201
>gb|BG412749.1|BG412749 OV2_34_C12.b1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 607
Score = 234 bits (118), Expect = 9e-060
Identities = 189/217 (87%)
Strand = Plus / Minus
Query: 369 acgcgcttgttgcccttcacccacagcgccaccacgtccccggcgccgcccacgttggtc 428
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 607 acgcgcttgttgcccttcaccgacagcgccaccacgtccccggcgccgcccacgttggtc 548
Query: 429 accttcacctcgctgtagtgctggttccctgtgatcgtgtaccggatgccgcctttccnn 488
||| ||||| | |||||| | ||||||| ||||| ||||||||||||||||||| ||
Sbjct: 547 accatcaccatgttgtagttcgggttccccgtgatggtgtaccggatgccgccttgcctc 488
Query: 489 ncgcacgccaccttgcggtaggtgatgggcacgatgccggccttnncctnngcgatcttg 548
|||||||||||||||| |||||||||||||| ||||||||||| ||| ||||||||
Sbjct: 487 gcgcacgccaccttgcgataggtgatgggcacaatgccggccttctcctcgtcgatcttg 428
Query: 549 aggaacgccngtatgnnnagnncaaagtgctcgccct 585
||||||||| | ||| || | |||||||||||||
Sbjct: 427 aggaacgccggcatggtgaggtcgaagtgctcgccct 391
>gb|CL195140.1|CL195140 104_420_10942159_114_32302_028 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10942159, DNA
sequence
Length = 654
Score = 155 bits (78), Expect = 6e-036
Identities = 182/219 (83%)
Strand = Plus / Plus
Query: 339 ccccagctgcgcttcatcggcgtccacttgacgcgcttgttgcccttcacccacagcgcc 398
|||||| ||||||||| | ||||||||||||||||||| | ||||||||| ||| ||||
Sbjct: 307 ccccagttgcgcttcagctccgtccacttgacgcgcttgctccccttcaccgacaccgcc 366
Query: 399 accacgtccccggcgccgcccacgttggtcaccttcacctcgctgtagtgctggttccct 458
||||||| |||||||||||||||||||| ||| ||||| | || ||| || ||||||
Sbjct: 367 gccacgtcgccggcgccgcccacgttggtgaccgtcaccatgttgaagtacttgttcccg 426
Query: 459 gtgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggc 518
| ||| | ||||||||||||||| | || ||||||||||| ||||||| || ||||
Sbjct: 427 gcgatggcgtaccggatgccgccctgcctcgcgcacgccacccgccggtaggagacgggc 486
Query: 519 acgatgccggccttnncctnngcgatcttgaggaacgcc 557
|||||||||||||| ||| ||||||| ||||||||||
Sbjct: 487 acgatgccggccttctcctccgcgatctggaggaacgcc 525
Score = 91.7 bits (46), Expect = 8e-017
Identities = 108/126 (85%), Gaps = 2/126 (1%)
Strand = Plus / Plus
Query: 192 tagaagttcttggtggcctggtacgttttgccgaactgccagtcg-cggggcgtgacgtg 250
||||||||||||| ||||||||||| |||||||| |||||| ||||| | ||||||
Sbjct: 160 tagaagttcttggacgcctggtacgtgacgccgaacttccagtcctcggggag-gacgtg 218
Query: 251 ccaggaggtagccttgcggtggtcggcggtcatgacgcggaacgtcagcgactcgccggt 310
||| || || ||||||||||||||| ||||||| || | ||||||||||||||||| |||
Sbjct: 219 ccacgacgtggccttgcggtggtcgccggtcatcaccctgaacgtcagcgactcgcaggt 278
Query: 311 gaggtc 316
||||||
Sbjct: 279 gaggtc 284
>gb|CW136107.1|CW136107 104_521_11118204_116_34845_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11118204, DNA
sequence
Length = 597
Score = 147 bits (74), Expect = 2e-033
Identities = 181/219 (82%)
Strand = Plus / Plus
Query: 339 ccccagctgcgcttcatcggcgtccacttgacgcgcttgttgcccttcacccacagcgcc 398
|||||| ||||||||| | ||||||||||||||||||| | ||||||||| ||| ||||
Sbjct: 352 ccccagttgcgcttcagctccgtccacttgacgcgcttgctccccttcaccgacaccgcc 411
Query: 399 accacgtccccggcgccgcccacgttggtcaccttcacctcgctgtagtgctggttccct 458
||||||| |||||||||||||||||||| ||| ||||| | || ||| || ||||||
Sbjct: 412 gccacgtcgccggcgccgcccacgttggtgaccgtcaccatgttgaagtacttgttcccg 471
Query: 459 gtgatcgtgtaccggatgccgcctttccnnncgcacgccaccttgcggtaggtgatgggc 518
| ||| | ||||||||||||||| | || ||||||||||| ||||||| || ||||
Sbjct: 472 gcgatggcgtaccggatgccgccctgcctcgcgcacgccacccgccggtaggagacgggc 531
Query: 519 acgatgccggccttnncctnngcgatcttgaggaacgcc 557
|||||||||||||| ||| ||||||| || |||||||
Sbjct: 532 acgatgccggccttctcctccgcgatctggaagaacgcc 570
Score = 91.7 bits (46), Expect = 8e-017
Identities = 108/126 (85%), Gaps = 2/126 (1%)
Strand = Plus / Plus
Query: 192 tagaagttcttggtggcctggtacgttttgccgaactgccagtcg-cggggcgtgacgtg 250
||||||||||||| ||||||||||| |||||||| |||||| ||||| | ||||||
Sbjct: 205 tagaagttcttggacgcctggtacgtgacgccgaacttccagtcctcggggag-gacgtg 263
Query: 251 ccaggaggtagccttgcggtggtcggcggtcatgacgcggaacgtcagcgactcgccggt 310
||| || || ||||||||||||||| ||||||| || | ||||||||||||||||| |||
Sbjct: 264 ccacgacgtggccttgcggtggtcgccggtcatcaccctgaacgtcagcgactcgcaggt 323
Query: 311 gaggtc 316
||||||
Sbjct: 324 gaggtc 329
>gb|CL177978.1|CL177978 104_385_10894229_116_31914_293 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894229, DNA
sequence
Length = 704
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||||||||||||||||||
Sbjct: 240 cacgtcgccggcgccgcccacgttggtcacc 210
>gb|CW038341.1|CW038341 104_270_10504868_114_30385 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10504868, DNA
sequence
Length = 715
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 378 cacgtccccggcgccggccacgttggtcacc 408
>gb|CW075930.1|CW075930 104_363_10809810_114_31800_258 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809810, DNA
sequence
Length = 719
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 503 cacgtccccggcgccggccacgttggtcacc 473
>gb|CW325048.1|CW325048 104_819_11477484_116_35915_034 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11477484, DNA
sequence
Length = 612
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||||||||||||||||||
Sbjct: 147 cacgtcgccggcgccgcccacgttggtcacc 117
>gb|CW416233.1|CW416233 fsbb001f116l03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f116l03, DNA
sequence
Length = 215
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||||||||||||||||||
Sbjct: 209 cacgtcgccggcgccgcccacgttggtcacc 179
>gb|CW426483.1|CW426483 fsbb001f137o10k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f137o10, DNA
sequence
Length = 727
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||| ||||||||||||||||||||||||
Sbjct: 134 cacgtcgccggcgccgcccacgttggtcacc 104
>gb|CW479320.1|CW479320 fsbb001f237l21f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f237l21, DNA
sequence
Length = 522
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 373 cacgtccccggcgccggccacgttggtcacc 343
>gb|CD231880.1|CD231880 SS1_30_D11.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_30_D11_A012 5', mRNA sequence
Length = 691
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 637 cacgtccccggcgccggccacgttggtcacc 607
>gb|CF430353.1|CF430353 PH1_27_A08.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_27_A08_A002 5', mRNA sequence
Length = 787
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 637 cacgtccccggcgccggccacgttggtcacc 607
>gb|CN136158.1|CN136158 OX1_41_D05.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_41_D05_A002 3', mRNA sequence
Length = 725
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 298 cacgtccccggcgccggccacgttggtcacc 268
>gb|CN136232.1|CN136232 OX1_41_D05.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_41_D05_A002 5', mRNA sequence
Length = 840
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 633 cacgtccccggcgccggccacgttggtcacc 603
>gb|CX606996.1|CX606996 ANR1_6_C12.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_6_C12_A002 3', mRNA sequence
Length = 699
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 36 cacgtccccggcgccggccacgttggtcacc 6
>gb|CX607081.1|CX607081 ANR1_6_C12.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_6_C12_A002 5', mRNA sequence
Length = 705
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 620 cacgtccccggcgccggccacgttggtcacc 590
>gb|CX610991.1|CX610991 ANR1_22_B08.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_22_B08_A002 3', mRNA sequence
Length = 731
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 80 cacgtccccggcgccggccacgttggtcacc 50
>gb|CX611078.1|CX611078 ANR1_22_B08.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_22_B08_A002 5', mRNA sequence
Length = 605
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgttggtcacc 431
|||||||||||||||| ||||||||||||||
Sbjct: 505 cacgtccccggcgccggccacgttggtcacc 475
>gb|CW075931.1|CW075931 104_363_10809810_116_31801_258 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809810, DNA
sequence
Length = 503
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 403 cgtccccggcgccgcccacgttggtcacc 431
|||||||||||||| ||||||||||||||
Sbjct: 357 cgtccccggcgccggccacgttggtcacc 385
>gb|DN551840.1|DN551840 pSPR-RT-A-H2_G06_S131 pSPR Sorghum propinquum cDNA, mRNA sequence
Length = 861
Score = 46.1 bits (23), Expect = 0.004
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 399 accacgtccccggcgccgcccacgttg 425
|||||||| ||||||||||||||||||
Sbjct: 711 accacgtcgccggcgccgcccacgttg 685
>gb|CW392760.1|CW392760 fsbb001f079i10f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f079i10, DNA
sequence
Length = 564
Score = 42.1 bits (21), Expect = 0.067
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 411 gcgccgcccacgttggtcacc 431
|||||||||||||||||||||
Sbjct: 564 gcgccgcccacgttggtcacc 544
>gb|CW471241.1|CW471241 fsbb001f225a12f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f225a12, DNA
sequence
Length = 507
Score = 42.1 bits (21), Expect = 0.067
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 129 gctgcatgcatatatatacat 149
|||||||||||||||||||||
Sbjct: 359 gctgcatgcatatatatacat 379
>gb|CL169669.1|CL169669 104_368_10812804_116_31809_276 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10812804, DNA
sequence
Length = 730
Score = 40.1 bits (20), Expect = 0.27
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 131 tgcatgcatatatatacata 150
||||||||||||||||||||
Sbjct: 454 tgcatgcatatatatacata 435
>gb|CL169670.1|CL169670 104_368_10812804_148_31808_276 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10812804, DNA
sequence
Length = 751
Score = 40.1 bits (20), Expect = 0.27
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 131 tgcatgcatatatatacata 150
||||||||||||||||||||
Sbjct: 577 tgcatgcatatatatacata 596
>gb|CW058402.1|CW058402 104_300_10518712_1_30028 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10518712, DNA
sequence
Length = 607
Score = 40.1 bits (20), Expect = 0.27
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 131 tgcatgcatatatatacata 150
||||||||||||||||||||
Sbjct: 596 tgcatgcatatatatacata 577
>gb|CW058403.1|CW058403 104_300_10518712_5_30082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10518712, DNA
sequence
Length = 523
Score = 40.1 bits (20), Expect = 0.27
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 131 tgcatgcatatatatacata 150
||||||||||||||||||||
Sbjct: 399 tgcatgcatatatatacata 418
>gb|CW131207.1|CW131207 104_514_11115547_116_34786_080 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11115547, DNA
sequence
Length = 597
Score = 40.1 bits (20), Expect = 0.27
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 131 tgcatgcatatatatacata 150
||||||||||||||||||||
Sbjct: 41 tgcatgcatatatatacata 60
>gb|CW326697.1|CW326697 104_822_11478355_116_35971_078 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11478355, DNA
sequence
Length = 559
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 129 gctgcatgcatatatatacatata 152
|||||||||||||||||| |||||
Sbjct: 389 gctgcatgcatatatatatatata 412
>gb|CW326698.1|CW326698 104_822_11478355_148_35970_078 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11478355, DNA
sequence
Length = 716
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 129 gctgcatgcatatatatacatata 152
|||||||||||||||||| |||||
Sbjct: 667 gctgcatgcatatatatatatata 644
>gb|CW332606.1|CW332606 104_830_11481506_116_36037_009 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11481506, DNA
sequence
Length = 652
Score = 40.1 bits (20), Expect = 0.27
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 130 ctgcatgcatatatatacat 149
||||||||||||||||||||
Sbjct: 527 ctgcatgcatatatatacat 546
>gb|CW478119.1|CW478119 fsbb001f235n04f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f235n04, DNA
sequence
Length = 664
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 124 aatccgctgcatgcatatatatac 147
||||| ||||||||||||||||||
Sbjct: 640 aatcccctgcatgcatatatatac 663
>gb|CX623191.1|CX623191 GABR1_68_F03.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_68_F03_A002 3', mRNA sequence
Length = 680
Score = 40.1 bits (20), Expect = 0.27
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 401 cacgtccccggcgccgcccacgtt 424
|||||||||||||||| |||||||
Sbjct: 24 cacgtccccggcgccggccacgtt 1
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 159,412
Number of Sequences: 832831
Number of extensions: 159412
Number of successful extensions: 48933
Number of sequences better than 0.5: 33
Number of HSP's better than 0.5 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48857
Number of HSP's gapped (non-prelim): 74
length of query: 697
length of database: 491,359,669
effective HSP length: 20
effective length of query: 677
effective length of database: 474,703,049
effective search space: 321373964173
effective search space used: 321373964173
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)