BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115190.2.1
(656 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF484914.1|CF484914 POL1_28_G06.b1_A002 Pollen Sorghum b... 202 3e-050
gb|CW198850.1|CW198850 104_623_11183195_116_36840_036 Sorgh... 186 2e-045
gb|BZ350471.1|BZ350471 ht56g09.g1 WGS-SbicolorF (JM107 adap... 62 7e-008
gb|CW198851.1|CW198851 104_623_11183195_148_36841_036 Sorgh... 62 7e-008
gb|CW401009.1|CW401009 fsbb001f091j18f0 Sorghum methylation... 62 7e-008
gb|CW461444.1|CW461444 fsbb001f209b20f0 Sorghum methylation... 46 0.004
gb|BE918829.1|BE918829 FM1_2_E02.g1_A003 Floral-Induced Mer... 46 0.004
gb|CW333050.1|CW333050 104_830_11481737_116_36040_065 Sorgh... 44 0.016
gb|BF656908.1|BF656908 OV2_22_E07.g1_A002 Ovary 2 (OV2) Sor... 44 0.016
gb|CL189041.1|CL189041 104_406_10902014_114_32468_063 Sorgh... 42 0.063
gb|CW266971.1|CW266971 104_737_11400437_148_35293_031 Sorgh... 42 0.063
gb|BG560336.1|BG560336 RHIZ2_73_B09.b1_A003 Rhizome2 (RHIZ2... 42 0.063
>gb|CF484914.1|CF484914 POL1_28_G06.b1_A002 Pollen Sorghum bicolor cDNA clone
POL1_28_G06_A002 3', mRNA sequence
Length = 601
Score = 202 bits (102), Expect = 3e-050
Identities = 197/228 (86%), Gaps = 3/228 (1%)
Strand = Plus / Minus
Query: 373 tcagcacggcttgcccgtgcagcaggacagtgggccggagaagcgggtgagccttgtaac 432
|||||||||||||| | |||||||||||| || ||| |||||||| ||||||||||| ||
Sbjct: 228 tcagcacggcttgctcatgcagcaggacaatgtgcccgagaagcgcgtgagccttgtcac 169
Query: 433 gtaggttcctggcttgggctttacccactcgttggtgtcgacctgcttgggg---gcgcc 489
||| || |||||||||||||| |||||||||||| ||| || |||| | | || ||
Sbjct: 168 gtacgtccctggcttgggcttcacccactcgttgctgttgatctgcctctgcaccgcccc 109
Query: 490 gccggacggattgaagatggcgccgttcatgaacaggtcgtcctccgtgtgccacaccca 549
|| ||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 108 tcccgacggctcgaagatggctccgttcatgaacaggtcgtcctccgtgtgccacaccca 49
Query: 550 gttcttccacacgccttcttccgcgtagggcttggggatcactttggc 597
|||||||||| | || |||||||||||| |||||| ||||||||||||
Sbjct: 48 gttcttccactccccctcttccgcgtagtgcttggtgatcactttggc 1
Score = 61.9 bits (31), Expect = 7e-008
Identities = 40/43 (93%)
Strand = Plus / Minus
Query: 71 accaatcgcaaacagaggtggttcatgttatacaaactgtata 113
|||||||||| ||||||||||||| |||||||||| |||||||
Sbjct: 558 accaatcgcagacagaggtggttcctgttatacaacctgtata 516
>gb|CW198850.1|CW198850 104_623_11183195_116_36840_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11183195, DNA
sequence
Length = 729
Score = 186 bits (94), Expect = 2e-045
Identities = 189/220 (85%), Gaps = 3/220 (1%)
Strand = Plus / Minus
Query: 373 tcagcacggcttgcccgtgcagcaggacagtgggccggagaagcgggtgagccttgtaac 432
|||||||||||||| | |||||||||||| || ||| |||||||| ||||||||||| ||
Sbjct: 226 tcagcacggcttgctcatgcagcaggacaatgtgcccgagaagcgcgtgagccttgtcac 167
Query: 433 gtaggttcctggcttgggctttacccactcgttggtgtcgacctgcttgggg---gcgcc 489
||| || |||||||||||||| |||||||||||| ||| || |||| | | || ||
Sbjct: 166 gtacgtccctggcttgggcttcacccactcgttgctgttgatctgcctctgcaccgcccc 107
Query: 490 gccggacggattgaagatggcgccgttcatgaacaggtcgtcctccgtgtgccacaccca 549
|| ||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 106 tcccgacggctcgaagatggctccgttcatgaacaggtcgtcctccgtgtgccacaccca 47
Query: 550 gttcttccacacgccttcttccgcgtagggcttggggatc 589
|||||||||| | || |||||||||||| |||||| ||||
Sbjct: 46 gttcttccactccccctcttccgcgtagtgcttggtgatc 7
Score = 61.9 bits (31), Expect = 7e-008
Identities = 40/43 (93%)
Strand = Plus / Minus
Query: 71 accaatcgcaaacagaggtggttcatgttatacaaactgtata 113
|||||||||| ||||||||||||| |||||||||| |||||||
Sbjct: 556 accaatcgcagacagaggtggttcctgttatacaacctgtata 514
>gb|BZ350471.1|BZ350471 ht56g09.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ht56g09 5', DNA sequence
Length = 596
Score = 61.9 bits (31), Expect = 7e-008
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 517 catgaacaggtcgtcctccgtgtgccacacccagttcttccac 559
|||||| ||||||| ||||| ||||||||||||||||||||||
Sbjct: 423 catgaagaggtcgttctccgagtgccacacccagttcttccac 465
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 621 agcggttgccctggctgatgatggttggcgc 651
||||||| ||||||||||||||||| |||||
Sbjct: 530 agcggttcccctggctgatgatggtcggcgc 560
>gb|CW198851.1|CW198851 104_623_11183195_148_36841_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11183195, DNA
sequence
Length = 672
Score = 61.9 bits (31), Expect = 7e-008
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 71 accaatcgcaaacagaggtggttcatgttatacaaactgtata 113
|||||||||| ||||||||||||| |||||||||| |||||||
Sbjct: 312 accaatcgcagacagaggtggttcctgttatacaacctgtata 354
Score = 42.1 bits (21), Expect = 0.063
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 373 tcagcacggcttgcccgtgcagcaggaca 401
|||||||||||||| | ||||||||||||
Sbjct: 642 tcagcacggcttgctcatgcagcaggaca 670
>gb|CW401009.1|CW401009 fsbb001f091j18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f091j18, DNA
sequence
Length = 684
Score = 61.9 bits (31), Expect = 7e-008
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 517 catgaacaggtcgtcctccgtgtgccacacccagttcttccac 559
|||||| ||||||| ||||| ||||||||||||||||||||||
Sbjct: 338 catgaagaggtcgttctccgagtgccacacccagttcttccac 380
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 621 agcggttgccctggctgatgatggttggcgc 651
||||||| ||||||||||||||||| |||||
Sbjct: 445 agcggttcccctggctgatgatggtcggcgc 475
>gb|CW461444.1|CW461444 fsbb001f209b20f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f209b20, DNA
sequence
Length = 495
Score = 46.1 bits (23), Expect = 0.004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 611 ggggctatgaagcggttgccctggctgatgatggt 645
||||| ||||| ||||| |||||||||||||||||
Sbjct: 134 ggggcgatgaaccggttcccctggctgatgatggt 168
>gb|BE918829.1|BE918829 FM1_2_E02.g1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 539
Score = 46.1 bits (23), Expect = 0.004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 611 ggggctatgaagcggttgccctggctgatgatggt 645
||||| ||||| ||||| |||||||||||||||||
Sbjct: 114 ggggcgatgaaccggttcccctggctgatgatggt 80
>gb|CW333050.1|CW333050 104_830_11481737_116_36040_065 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11481737, DNA
sequence
Length = 653
Score = 44.1 bits (22), Expect = 0.016
Identities = 55/66 (83%)
Strand = Plus / Plus
Query: 486 cgccgccggacggattgaagatggcgccgttcatgaacaggtcgtcctccgtgtgccaca 545
||||||||||| | ||||||| ||| || || | |||||||||||||| || | |||||
Sbjct: 231 cgccgccggactggttgaagaaggccccattgaggaacaggtcgtcctgcgacttccaca 290
Query: 546 cccagt 551
||||||
Sbjct: 291 cccagt 296
>gb|BF656908.1|BF656908 OV2_22_E07.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 539
Score = 44.1 bits (22), Expect = 0.016
Identities = 55/66 (83%)
Strand = Plus / Minus
Query: 486 cgccgccggacggattgaagatggcgccgttcatgaacaggtcgtcctccgtgtgccaca 545
||||||||||| | ||||||| ||| || || | |||||||||||||| || | |||||
Sbjct: 283 cgccgccggactggttgaagaaggccccattgaggaacaggtcgtcctgcgacttccaca 224
Query: 546 cccagt 551
||||||
Sbjct: 223 cccagt 218
>gb|CL189041.1|CL189041 104_406_10902014_114_32468_063 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10902014, DNA
sequence
Length = 660
Score = 42.1 bits (21), Expect = 0.063
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 621 agcggttgccctggctgatgatggt 645
||||||||||||||||| |||||||
Sbjct: 315 agcggttgccctggctgttgatggt 339
>gb|CW266971.1|CW266971 104_737_11400437_148_35293_031 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11400437, DNA
sequence
Length = 670
Score = 42.1 bits (21), Expect = 0.063
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 621 agcggttgccctggctgatgatggt 645
||||||||||||||||| |||||||
Sbjct: 33 agcggttgccctggctgttgatggt 57
>gb|BG560336.1|BG560336 RHIZ2_73_B09.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 557
Score = 42.1 bits (21), Expect = 0.063
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 621 agcggttgccctggctgatgatggt 645
||||||||||||||||| |||||||
Sbjct: 205 agcggttgccctggctgttgatggt 181
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 178,718
Number of Sequences: 832831
Number of extensions: 178718
Number of successful extensions: 48179
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48153
Number of HSP's gapped (non-prelim): 26
length of query: 656
length of database: 491,359,669
effective HSP length: 19
effective length of query: 637
effective length of database: 475,535,880
effective search space: 302916355560
effective search space used: 302916355560
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)