BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071667.2.1
(597 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE362145.1|BE362145 DG1_84_D03.g1_A002 Dark Grown 1 (DG1... 523 e-147
gb|CL177395.1|CL177395 104_384_10893805_116_31916_253 Sorgh... 464 e-129
gb|CL177396.1|CL177396 104_384_10893805_148_31915_253 Sorgh... 464 e-129
gb|CW137973.1|CW137973 104_525_11119958_148_34875_055 Sorgh... 464 e-129
gb|CW276375.1|CW276375 104_750_11405455_116_35396_032 Sorgh... 464 e-129
gb|CW282858.1|CW282858 104_759_11408938_148_35474_045 Sorgh... 464 e-129
gb|CW380051.1|CW380051 fsbb001f059k11k0 Sorghum methylation... 464 e-129
gb|CW405552.1|CW405552 fsbb001f098c18k0 Sorghum methylation... 464 e-129
gb|CW430773.1|CW430773 fsbb001f144k09f0 Sorghum methylation... 252 3e-065
gb|AW923753.1|AW923753 DG1_59_B06.g1_A002 Dark Grown 1 (DG1... 204 7e-051
gb|CW276376.1|CW276376 104_750_11405455_148_35400_032 Sorgh... 192 3e-047
gb|CW430774.1|CW430774 fsbb001f144k09k0 Sorghum methylation... 192 3e-047
gb|CW244572.1|CW244572 104_705_11220673_116_37585_005 Sorgh... 178 4e-043
gb|CW282855.1|CW282855 104_759_11408937_116_35477_045 Sorgh... 127 1e-027
gb|CL193104.1|CL193104 104_416_10940701_116_32269_055 Sorgh... 121 8e-026
gb|CW405551.1|CW405551 fsbb001f098c18f0 Sorghum methylation... 86 4e-015
gb|CW072978.1|CW072978 104_330_10777970_116_31354_290 Sorgh... 82 7e-014
gb|BE356223.1|BE356223 DG1_123_E04.g1_A002 Dark Grown 1 (DG... 82 7e-014
gb|BE359268.1|BE359268 DG1_39_A07.g1_A002 Dark Grown 1 (DG1... 82 7e-014
gb|BE360262.1|BE360262 DG1_62_B04.b1_A002 Dark Grown 1 (DG1... 82 7e-014
gb|BE362147.1|BE362147 DG1_84_D06.g1_A002 Dark Grown 1 (DG1... 82 7e-014
gb|BG356773.1|BG356773 OV2_9_G07.g1_A002 Ovary 2 (OV2) Sorg... 82 7e-014
gb|CB926564.1|CB926564 ABA1_2_A01.b1_A012 Abscisic acid-tre... 82 7e-014
gb|CD207558.1|CD207558 HS1_33_F04.b1_A012 Heat-shocked seed... 82 7e-014
gb|CF761302.1|CF761302 DSAF1_73_E08.b1_A011 Drought-stresse... 82 7e-014
gb|CN124342.1|CN124342 RHOH1_4_D05.b1_A002 Acid- and alkali... 82 7e-014
gb|CW040137.1|CW040137 104_273_10505918_114_30266 Sorghum m... 80 3e-013
gb|BI098006.1|BI098006 IP1_30_H05.g1_A002 Immature pannicle... 80 3e-013
gb|CD231584.1|CD231584 SS1_22_D07.b1_A012 Salt-stressed see... 80 3e-013
gb|CN127948.1|CN127948 RHOH1_26_C08.b1_A002 Acid- and alkal... 74 2e-011
gb|BG052626.1|BG052626 RHIZ2_27_C02.g1_A003 Rhizome2 (RHIZ2... 64 2e-008
gb|CW380050.1|CW380050 fsbb001f059k11f0 Sorghum methylation... 56 4e-006
gb|BE359575.1|BE359575 DG1_54_D04.g2_A002 Dark Grown 1 (DG1... 50 2e-004
gb|BG356871.1|BG356871 OV2_11_A07.g1_A002 Ovary 2 (OV2) Sor... 50 2e-004
gb|BE362939.2|BE362939 DG1_91_C11.g1_A002 Dark Grown 1 (DG1... 50 2e-004
gb|BZ368348.1|BZ368348 id12g11.b1 WGS-SbicolorF (JM107 adap... 48 0.001
gb|CW090470.1|CW090470 104_436_10949298_114_32605_073 Sorgh... 48 0.001
gb|CW317755.1|CW317755 104_809_11473583_116_35861_086 Sorgh... 48 0.001
gb|CW317757.1|CW317757 104_809_11473584_116_35862_086 Sorgh... 48 0.001
gb|CW424062.1|CW424062 fsbb001f134d10f0 Sorghum methylation... 48 0.001
gb|AW681193.1|AW681193 WS1_9_D05.g1_A002 Water-stressed 1 (... 48 0.001
gb|AW922462.1|AW922462 DG1_19_G06.g1_A002 Dark Grown 1 (DG1... 48 0.001
gb|BE356391.1|BE356391 DG1_124_E05.g1_A002 Dark Grown 1 (DG... 48 0.001
gb|BE359607.1|BE359607 DG1_54_F08.g2_A002 Dark Grown 1 (DG1... 48 0.001
gb|BE593873.1|BE593873 WS1_103_D07.g1_A002 Water-stressed 1... 48 0.001
gb|BE594190.1|BE594190 WS1_103_D07.b1_A002 Water-stressed 1... 48 0.001
gb|BE600332.1|BE600332 PI1_95_B04.g1_A002 Pathogen induced ... 48 0.001
gb|BG049524.1|BG049524 EM1_5_B08.g1_A002 Embryo 1 (EM1) Sor... 48 0.001
gb|BG556571.1|BG556571 EM1_38_H10.g1_A002 Embryo 1 (EM1) So... 48 0.001
gb|CB925894.1|CB925894 ABA1_30_G05.b1_A012 Abscisic acid-tr... 48 0.001
gb|CD204822.1|CD204822 HS1_10_F05.b1_A012 Heat-shocked seed... 48 0.001
gb|CD205748.1|CD205748 HS1_18_E05.b1_A012 Heat-shocked seed... 48 0.001
gb|CD205771.1|CD205771 HS1_18_E04.b1_A012 Heat-shocked seed... 48 0.001
gb|CD210390.1|CD210390 HS1_51_G05.b1_A012 Heat-shocked seed... 48 0.001
gb|CD224755.1|CD224755 CCC1_36_C01.b1_A007 Callus culture/c... 48 0.001
gb|CD427393.1|CD427393 SA1_30_D09.b1_A002 Salicylic acid-tr... 48 0.001
gb|CN131929.1|CN131929 OX1_3_C10.b1_A002 Oxidatively-stress... 48 0.001
gb|DN551903.1|DN551903 pSPR-RT-MR-H1_F09_S174 pSPR Sorghum ... 48 0.001
dbj|AB084897.1| Sorghum bicolor ALDH2a mRNA for mitochondri... 48 0.001
gb|BE125725.1|BE125725 DG1_54_F08.g1_A002 Dark Grown 1 (DG1... 46 0.004
gb|BG558573.1|BG558573 RHIZ2_57_F01.g1_A003 Rhizome2 (RHIZ2... 46 0.004
gb|CL148574.1|CL148574 104_328_10593192_116_31783_316 Sorgh... 40 0.23
gb|CL148575.1|CL148575 104_328_10593192_148_31782_316 Sorgh... 40 0.23
gb|CL153273.1|CL153273 104_337_10780603_116_31368_235 Sorgh... 40 0.23
gb|CL175956.1|CL175956 104_382_10892804_148_31762_020 Sorgh... 40 0.23
gb|CL184837.1|CL184837 104_398_10899128_116_32371_024 Sorgh... 40 0.23
gb|CW204419.1|CW204419 104_632_11186533_148_36922_057 Sorgh... 40 0.23
gb|CW391797.1|CW391797 fsbb001f078b22k0 Sorghum methylation... 40 0.23
>gb|BE362145.1|BE362145 DG1_84_D03.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 703
Score = 523 bits (264), Expect = e-147
Identities = 303/316 (95%)
Strand = Plus / Minus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 402
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 401 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 342
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 341 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 282
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 281 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 222
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccgtcttgaacttcatgagggacat 581
| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||
Sbjct: 221 cttggtgcagttggccttctcgatcacctcatcaaccgacctgaacttcatgagggacat 162
Query: 582 gacggggccgaagatc 597
||||||||||||||||
Sbjct: 161 gacggggccgaagatc 146
>gb|CL177395.1|CL177395 104_384_10893805_116_31916_253 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10893805, DNA
sequence
Length = 731
Score = 464 bits (234), Expect = e-129
Identities = 267/278 (96%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 180
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 181 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 240
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 241 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 300
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 301 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 360
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccg 559
| ||||||||||||||||||||||||||||||||||||
Sbjct: 361 cttggtgcagttggccttctcgatcacctcatcaaccg 398
Score = 69.9 bits (35), Expect = 3e-010
Identities = 35/35 (100%)
Strand = Plus / Plus
Query: 563 tgaacttcatgagggacatgacggggccgaagatc 597
|||||||||||||||||||||||||||||||||||
Sbjct: 526 tgaacttcatgagggacatgacggggccgaagatc 560
>gb|CL177396.1|CL177396 104_384_10893805_148_31915_253 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10893805, DNA
sequence
Length = 743
Score = 464 bits (234), Expect = e-129
Identities = 267/278 (96%)
Strand = Plus / Minus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 739 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 680
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 679 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 620
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 619 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 560
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 559 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 500
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccg 559
| ||||||||||||||||||||||||||||||||||||
Sbjct: 499 cttggtgcagttggccttctcgatcacctcatcaaccg 462
Score = 69.9 bits (35), Expect = 3e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 563 tgaacttcatgagggacatgacggggccgaagatc 597
|||||||||||||||||||||||||||||||||||
Sbjct: 334 tgaacttcatgagggacatgacggggccgaagatc 300
>gb|CW137973.1|CW137973 104_525_11119958_148_34875_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11119958, DNA
sequence
Length = 593
Score = 464 bits (234), Expect = e-129
Identities = 267/278 (96%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 298 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 357
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 358 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 417
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 418 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 477
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 478 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 537
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccg 559
| ||||||||||||||||||||||||||||||||||||
Sbjct: 538 cttggtgcagttggccttctcgatcacctcatcaaccg 575
>gb|CW276375.1|CW276375 104_750_11405455_116_35396_032 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11405455, DNA
sequence
Length = 691
Score = 464 bits (234), Expect = e-129
Identities = 267/278 (96%)
Strand = Plus / Minus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 464
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 463 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 404
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 403 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 344
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 343 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 284
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccg 559
| ||||||||||||||||||||||||||||||||||||
Sbjct: 283 cttggtgcagttggccttctcgatcacctcatcaaccg 246
Score = 69.9 bits (35), Expect = 3e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 563 tgaacttcatgagggacatgacggggccgaagatc 597
|||||||||||||||||||||||||||||||||||
Sbjct: 118 tgaacttcatgagggacatgacggggccgaagatc 84
>gb|CW282858.1|CW282858 104_759_11408938_148_35474_045 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11408938, DNA
sequence
Length = 718
Score = 464 bits (234), Expect = e-129
Identities = 267/278 (96%)
Strand = Plus / Minus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 550 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 491
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 490 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 431
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 430 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 371
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 370 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 311
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccg 559
| ||||||||||||||||||||||||||||||||||||
Sbjct: 310 cttggtgcagttggccttctcgatcacctcatcaaccg 273
Score = 69.9 bits (35), Expect = 3e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 563 tgaacttcatgagggacatgacggggccgaagatc 597
|||||||||||||||||||||||||||||||||||
Sbjct: 145 tgaacttcatgagggacatgacggggccgaagatc 111
>gb|CW380051.1|CW380051 fsbb001f059k11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f059k11, DNA
sequence
Length = 723
Score = 464 bits (234), Expect = e-129
Identities = 267/278 (96%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 446 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 505
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 506 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 565
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 566 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 625
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 626 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 685
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccg 559
| ||||||||||||||||||||||||||||||||||||
Sbjct: 686 cttggtgcagttggccttctcgatcacctcatcaaccg 723
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Plus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 177 tgaatttataaaacactaaatagtttatatggtgtacttagcata 221
>gb|CW405552.1|CW405552 fsbb001f098c18k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f098c18, DNA
sequence
Length = 759
Score = 464 bits (234), Expect = e-129
Identities = 267/278 (96%)
Strand = Plus / Minus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 323
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccgaa 401
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 322 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccgaa 263
Query: 402 gggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgcaccga 461
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 262 aggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgcaccga 203
Query: 462 ccgggacacccgattggcgacgtccaggctcttggtcacgatcccggcggcgagcccgta 521
||| |||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||
Sbjct: 202 ccgcgacacccggttggcgatgtccaggctcttggtcacgatgccggcggcgagcccgta 143
Query: 522 cctggtgcagttggccttctcgatcacctcatcaaccg 559
| ||||||||||||||||||||||||||||||||||||
Sbjct: 142 cttggtgcagttggccttctcgatcacctcatcaaccg 105
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Minus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 651 tgaatttataaaacactaaatagtttatatggtgtacttagcata 607
>gb|CW430773.1|CW430773 fsbb001f144k09f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f144k09, DNA
sequence
Length = 690
Score = 252 bits (127), Expect = 3e-065
Identities = 155/163 (95%), Gaps = 1/163 (0%)
Strand = Plus / Minus
Query: 398 cgaagggcgcgtccgggtcgaaggcgaagtagcagttcacccacacggtgccggcgcgca 457
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 690 cgaaaggcgcgtccgggtcgaaggcgtagtagcagttcacccacacggtgccggcgcgca 631
Query: 458 ccgaccgggacaccc-gattggcgacgtccaggctcttggtcacgatcccggcggcgagc 516
||||||| ||||||| | ||||||| ||||||||||||||||||||| ||||||||||||
Sbjct: 630 ccgaccgcgacacccnggttggcgatgtccaggctcttggtcacgatgccggcggcgagc 571
Query: 517 ccgtacctggtgcagttggccttctcgatcacctcatcaaccg 559
|||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 570 ccgtacttggtgcagttggccttctcgatcacctcatcaaccg 528
Score = 69.9 bits (35), Expect = 3e-010
Identities = 35/35 (100%)
Strand = Plus / Minus
Query: 563 tgaacttcatgagggacatgacggggccgaagatc 597
|||||||||||||||||||||||||||||||||||
Sbjct: 400 tgaacttcatgagggacatgacggggccgaagatc 366
>gb|AW923753.1|AW923753 DG1_59_B06.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 378
Score = 204 bits (103), Expect = 7e-051
Identities = 115/119 (96%)
Strand = Plus / Minus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 119 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 60
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacccgccga 400
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 59 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacccgccga 1
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 87 agtttatatggtgtacttaacata 110
||||||||||||||||||| ||||
Sbjct: 367 agtttatatggtgtacttagcata 344
>gb|CW276376.1|CW276376 104_750_11405455_148_35400_032 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11405455, DNA
sequence
Length = 729
Score = 192 bits (97), Expect = 3e-047
Identities = 109/113 (96%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 617 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 676
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacc 394
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 677 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacc 729
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Plus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 348 tgaatttataaaacactaaatagtttatatggtgtacttagcata 392
>gb|CW430774.1|CW430774 fsbb001f144k09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f144k09, DNA
sequence
Length = 761
Score = 192 bits (97), Expect = 3e-047
Identities = 109/113 (96%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 649 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 708
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatcttgtacc 394
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 709 cttgtccatggccgccagcccctggtcccggccgaatccgctcatcttgtacc 761
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Plus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 380 tgaatttataaaacactaaatagtttatatggtgtacttagcata 424
>gb|CW244572.1|CW244572 104_705_11220673_116_37585_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220673, DNA
sequence
Length = 612
Score = 178 bits (90), Expect = 4e-043
Identities = 102/106 (96%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 507 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 566
Query: 342 cttgtccatggctgccagcccctggtcccggccgaagccgctcatc 387
|||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 567 cttgtccatggccgccagcccctggtcccggccgaatccgctcatc 612
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Plus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 238 tgaatttataaaacactaaatagtttatatggtgtacttagcata 282
>gb|CW282855.1|CW282855 104_759_11408937_116_35477_045 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11408937, DNA
sequence
Length = 621
Score = 127 bits (64), Expect = 1e-027
Identities = 70/72 (97%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 546 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 605
Query: 342 cttgtccatggc 353
||||||||||||
Sbjct: 606 cttgtccatggc 617
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Plus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 277 tgaatttataaaacactaaatagtttatatggtgtacttagcata 321
>gb|CL193104.1|CL193104 104_416_10940701_116_32269_055 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10940701, DNA
sequence
Length = 633
Score = 121 bits (61), Expect = 8e-026
Identities = 67/69 (97%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 341
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 565 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgacctgcaggta 624
Query: 342 cttgtccat 350
|||||||||
Sbjct: 625 cttgtccat 633
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Plus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 296 tgaatttataaaacactaaatagtttatatggtgtacttagcata 340
>gb|CW405551.1|CW405551 fsbb001f098c18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f098c18, DNA
sequence
Length = 808
Score = 85.7 bits (43), Expect = 4e-015
Identities = 49/51 (96%)
Strand = Plus / Plus
Query: 282 ctcaactcaataccatggcgagtccgggagcgcggtgatgacgctcttgac 332
||||| ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 758 ctcaagtcaataccacggcgagtccgggagcgcggtgatgacgctcttgac 808
Score = 40.1 bits (20), Expect = 0.23
Identities = 39/45 (86%), Gaps = 4/45 (8%)
Strand = Plus / Plus
Query: 70 tgaatttataaaac----aagagtttatatggtgtacttaacata 110
|||||||||||||| || ||||||||||||||||||| ||||
Sbjct: 489 tgaatttataaaacactaaatagtttatatggtgtacttagcata 533
>gb|CW072978.1|CW072978 104_330_10777970_116_31354_290 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10777970, DNA
sequence
Length = 87
Score = 81.8 bits (41), Expect = 7e-014
Identities = 56/61 (91%)
Strand = Plus / Plus
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
||||| |||||||||||||| || |||||||||||||||||||||||||||| ||||||
Sbjct: 1 acgatgccggcggcgagcccccacttggtgcagttggccttctcgatcacctcctcaacc 60
Query: 559 g 559
|
Sbjct: 61 g 61
>gb|BE356223.1|BE356223 DG1_123_E04.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 432
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 265 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 206
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 205 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 146
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 145 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 86
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 85 gtcttgaatttcatgag 69
>gb|BE359268.1|BE359268 DG1_39_A07.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 247
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 223 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 164
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 163 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 104
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 103 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 44
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 43 gtcttgaatttcatgag 27
>gb|BE360262.1|BE360262 DG1_62_B04.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 587
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Plus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 106 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 165
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 166 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 225
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 226 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 285
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 286 gtcttgaatttcatgag 302
>gb|BE362147.1|BE362147 DG1_84_D06.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 643
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 563 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 504
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 503 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 444
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 443 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 384
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 383 gtcttgaatttcatgag 367
>gb|BG356773.1|BG356773 OV2_9_G07.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA sequence
Length = 656
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 387 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 328
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 327 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 268
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 267 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 208
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 207 gtcttgaatttcatgag 191
>gb|CB926564.1|CB926564 ABA1_2_A01.b1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_2_A01_A012 3', mRNA sequence
Length = 645
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 365 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 306
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 305 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 246
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 245 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 186
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 185 gtcttgaatttcatgag 169
>gb|CD207558.1|CD207558 HS1_33_F04.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_33_F04_A012 3', mRNA sequence
Length = 603
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 487 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 428
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 427 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 368
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 367 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 308
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 307 gtcttgaatttcatgag 291
>gb|CF761302.1|CF761302 DSAF1_73_E08.b1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_73_E08_A011 5', mRNA sequence
Length = 420
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 374 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 315
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 314 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 255
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 254 acaattccagctgctaggccgtaccgggtgttgtttgctttctgaatcacctcctcaacc 195
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 194 gtcttgaatttcatgag 178
>gb|CN124342.1|CN124342 RHOH1_4_D05.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_4_D05_A002 3', mRNA sequence
Length = 661
Score = 81.8 bits (41), Expect = 7e-014
Identities = 158/197 (80%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| | |
Sbjct: 547 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagttgatc 488
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 487 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 428
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 427 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 368
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 367 gtcttgaatttcatgag 351
>gb|CW040137.1|CW040137 104_273_10505918_114_30266 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10505918, DNA
sequence
Length = 546
Score = 79.8 bits (40), Expect = 3e-013
Identities = 52/56 (92%)
Strand = Plus / Plus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagtt 434
||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 139 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagtt 194
>gb|BI098006.1|BI098006 IP1_30_H05.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 496
Score = 79.8 bits (40), Expect = 3e-013
Identities = 52/56 (92%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagtt 434
||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 205 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagtt 150
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 544 atcacctcatcaaccgtcttgaacttcatgag 575
|||||||| |||||||||||||| ||||||||
Sbjct: 40 atcacctcctcaaccgtcttgaatttcatgag 9
>gb|CD231584.1|CD231584 SS1_22_D07.b1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_22_D07_A012 3', mRNA sequence
Length = 588
Score = 79.8 bits (40), Expect = 3e-013
Identities = 52/56 (92%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagtt 434
||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 474 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtagcagtt 419
>gb|CN127948.1|CN127948 RHOH1_26_C08.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_26_C08_A002 3', mRNA sequence
Length = 736
Score = 73.8 bits (37), Expect = 2e-011
Identities = 157/197 (79%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagttcacc 438
||||||||||||||||| ||||| |||||||| |||||||| |||||||| ||||| | |
Sbjct: 447 ccgctcatcttgtaccccccgaatggcgcgtcggggtcgaatgcgaagtaacagttgatc 388
Query: 439 cacacggtgccggcgcgcaccgaccgggacacccgattggcgacgtccaggctcttggtc 498
|| | || || || || | ||||| || ||| ||||||| ||| | | ||||||||
Sbjct: 387 cagatggcacctgcacggatggaccgcgataccgtgttggcgatgtcgatgttcttggtc 328
Query: 499 acgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacctcatcaacc 558
|| || || || || || ||||||| |||| ||| || |||| |||||||| ||||||
Sbjct: 327 acaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacctcctcaacc 268
Query: 559 gtcttgaacttcatgag 575
|||||||| ||||||||
Sbjct: 267 gtcttgaatttcatgag 251
>gb|BG052626.1|BG052626 RHIZ2_27_C02.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 416
Score = 63.9 bits (32), Expect = 2e-008
Identities = 50/56 (89%)
Strand = Plus / Minus
Query: 379 ccgctcatcttgtacccgccgaagggcgcgtccgggtcgaaggcgaagtagcagtt 434
||||||||||||||||| ||||| ||||| || |||||||| |||||||| |||||
Sbjct: 142 ccgctcatcttgtaccccccgaatggcgcatcggggtcgaatgcgaagtatcagtt 87
>gb|CW380050.1|CW380050 fsbb001f059k11f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f059k11, DNA
sequence
Length = 742
Score = 56.0 bits (28), Expect = 4e-006
Identities = 35/36 (97%), Gaps = 1/36 (2%)
Strand = Plus / Minus
Query: 563 tgaacttcatgagggacatgac-ggggccgaagatc 597
|||||||||||||||||||||| |||||||||||||
Sbjct: 659 tgaacttcatgagggacatgacgggggccgaagatc 624
>gb|BE359575.1|BE359575 DG1_54_D04.g2_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 417
Score = 50.1 bits (25), Expect = 2e-004
Identities = 70/85 (82%)
Strand = Plus / Minus
Query: 491 tcttggtcacgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacct 550
|||||||||| || || || || || ||||||| |||| ||| || |||| |||||||
Sbjct: 365 tcttggtcacaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacct 306
Query: 551 catcaaccgtcttgaacttcatgag 575
| |||||||||||||| ||||||||
Sbjct: 305 cctcaaccgtcttgaatttcatgag 281
>gb|BG356871.1|BG356871 OV2_11_A07.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 485
Score = 50.1 bits (25), Expect = 2e-004
Identities = 70/85 (82%)
Strand = Plus / Minus
Query: 491 tcttggtcacgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacct 550
|||||||||| || || || || || ||||||| |||| ||| || |||| |||||||
Sbjct: 428 tcttggtcacaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacct 369
Query: 551 catcaaccgtcttgaacttcatgag 575
| |||||||||||||| ||||||||
Sbjct: 368 cctcaaccgtcttgaatttcatgag 344
>gb|BE362939.2|BE362939 DG1_91_C11.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 430
Score = 50.1 bits (25), Expect = 2e-004
Identities = 70/85 (82%)
Strand = Plus / Minus
Query: 491 tcttggtcacgatcccggcggcgagcccgtacctggtgcagttggccttctcgatcacct 550
|||||||||| || || || || || ||||||| |||| ||| || |||| |||||||
Sbjct: 421 tcttggtcacaattccagctgctaggccgtaccgggtgttgttcgctttctgaatcacct 362
Query: 551 catcaaccgtcttgaacttcatgag 575
| |||||||||||||| ||||||||
Sbjct: 361 cctcaaccgtcttgaatttcatgag 337
>gb|BZ368348.1|BZ368348 id12g11.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone id12g11 5', DNA sequence
Length = 374
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 191 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 148
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 244 ccgacgccgctcatcttgtagccgccgaa 216
>gb|CW090470.1|CW090470 104_436_10949298_114_32605_073 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10949298, DNA
sequence
Length = 762
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 420 ggcgaagtagcagttcacccacacggtgccggcgcgcaccgacc 463
||||||||||||||| |||||||| ||||||||||||||||
Sbjct: 331 ggcgaagtagcagttgacccacaccaccccggcgcgcaccgacc 288
Score = 42.1 bits (21), Expect = 0.057
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 561 cttgaacttcatgagggacatgacggggccgaagatc 597
||||||||| || ||| ||||||| ||||||||||||
Sbjct: 58 cttgaacttgatcaggcacatgacagggccgaagatc 22
>gb|CW317755.1|CW317755 104_809_11473583_116_35861_086 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11473583, DNA
sequence
Length = 703
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 367 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 324
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 420 ccgacgccgctcatcttgtagccgccgaa 392
>gb|CW317757.1|CW317757 104_809_11473584_116_35862_086 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11473584, DNA
sequence
Length = 688
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 367 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 324
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 420 ccgacgccgctcatcttgtagccgccgaa 392
>gb|CW424062.1|CW424062 fsbb001f134d10f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f134d10, DNA
sequence
Length = 611
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 224 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 267
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 171 ccgacgccgctcatcttgtagccgccgaa 199
>gb|AW681193.1|AW681193 WS1_9_D05.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 547
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 342 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 299
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 395 ccgacgccgctcatcttgtagccgccgaa 367
>gb|AW922462.1|AW922462 DG1_19_G06.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 568
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 373 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 330
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 426 ccgacgccgctcatcttgtagccgccgaa 398
>gb|BE356391.1|BE356391 DG1_124_E05.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 591
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 441 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 398
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 494 ccgacgccgctcatcttgtagccgccgaa 466
>gb|BE359607.1|BE359607 DG1_54_F08.g2_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 383
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 342 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 299
>gb|BE593873.1|BE593873 WS1_103_D07.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 336
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 168 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 125
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 221 ccgacgccgctcatcttgtagccgccgaa 193
>gb|BE594190.1|BE594190 WS1_103_D07.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 394
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 168 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 125
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 221 ccgacgccgctcatcttgtagccgccgaa 193
>gb|BE600332.1|BE600332 PI1_95_B04.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 596
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 419 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 376
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 472 ccgacgccgctcatcttgtagccgccgaa 444
>gb|BG049524.1|BG049524 EM1_5_B08.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 548
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 346 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 303
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 399 ccgacgccgctcatcttgtagccgccgaa 371
>gb|BG556571.1|BG556571 EM1_38_H10.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 527
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 371 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 328
Score = 42.1 bits (21), Expect = 0.057
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 373 ccgaagccgctcatcttgtacccgccgaa 401
|||| ||||||||||||||| ||||||||
Sbjct: 424 ccgacgccgctcatcttgtagccgccgaa 396
>gb|CB925894.1|CB925894 ABA1_30_G05.b1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_30_G05_A012 3', mRNA sequence
Length = 582
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 426 gtagcagttcacccacacggtgccggcgcgcaccgaccgggaca 469
|||||||||||||||||| ||||| || |||| || ||||||||
Sbjct: 378 gtagcagttcacccacaccgtgcccgcccgcagcgcccgggaca 335
Score = 46.1 bits (23), Expect = 0.004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 367 tcccggccgaagccgctcatcttgtacccgccgaa 401
||||| |||| ||||||||||||||| ||||||||
Sbjct: 437 tcccgcccgacgccgctcatcttgtagccgccgaa 403
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 156,809
Number of Sequences: 832831
Number of extensions: 156809
Number of successful extensions: 44032
Number of sequences better than 0.5: 68
Number of HSP's better than 0.5 without gapping: 68
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43866
Number of HSP's gapped (non-prelim): 162
length of query: 597
length of database: 491,359,669
effective HSP length: 19
effective length of query: 578
effective length of database: 475,535,880
effective search space: 274859738640
effective search space used: 274859738640
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)