BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3042337.2.1
(945 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW034873.1|CW034873 104_265_10502820_114_30378 Sorghum m... 502 e-140
gb|CW253791.1|CW253791 104_717_11225292_148_35107_038 Sorgh... 478 e-133
gb|CW253790.1|CW253790 104_717_11225292_116_35111_038 Sorgh... 474 e-132
gb|CW263276.1|CW263276 104_731_11230595_116_35213_042 Sorgh... 236 3e-060
gb|CW355674.1|CW355674 fsbb001f020g14k0 Sorghum methylation... 210 2e-052
gb|BE357860.1|BE357860 DG1_22_C12.g1_A002 Dark Grown 1 (DG1... 198 7e-049
gb|BE355191.1|BE355191 DG1_10_D02.g1_A002 Dark Grown 1 (DG1... 192 4e-047
gb|CW156276.1|CW156276 104_559_11146598_116_36378_061 Sorgh... 184 1e-044
gb|CW156277.1|CW156277 104_559_11146598_148_36377_061 Sorgh... 184 1e-044
gb|BE362029.1|BE362029 DG1_83_E01.g1_A002 Dark Grown 1 (DG1... 172 4e-041
gb|BE360028.1|BE360028 DG1_60_C08.g2_A002 Dark Grown 1 (DG1... 168 6e-040
gb|BE363286.1|BE363286 WS1_61_D09.g1_A002 Water-stressed 1 ... 168 6e-040
gb|CD226055.1|CD226055 CCC1_43_F04.b1_A007 Callus culture/c... 165 9e-039
gb|CX613643.1|CX613643 GABR1_9_H05.b1_A002 GA- or brassinol... 161 1e-037
gb|CW256586.1|CW256586 104_721_11226871_116_35138_020 Sorgh... 153 4e-035
gb|CF430593.1|CF430593 NIT1_3_A05.b1_A002 Nitrogen-deficien... 153 4e-035
gb|CW192718.1|CW192718 104_615_11179178_148_36775_011 Sorgh... 151 1e-034
gb|CW193504.1|CW193504 104_616_11179600_148_36779_058 Sorgh... 151 1e-034
gb|BE357452.1|BE357452 DG1_15_A08.b2_A002 Dark Grown 1 (DG1... 139 5e-031
gb|CW256587.1|CW256587 104_721_11226871_148_35142_020 Sorgh... 137 2e-030
gb|CX610228.1|CX610228 ANR1_17_H06.b1_A002 Anaerobic roots ... 137 2e-030
gb|CD464006.1|CD464006 ETH1_48_F01.b1_A002 Ethylene-treated... 129 5e-028
gb|AW922538.1|AW922538 DG1_20_D10.g1_A002 Dark Grown 1 (DG1... 119 5e-025
gb|CW442457.1|CW442457 fsbb001f162c05k0 Sorghum methylation... 105 7e-021
gb|BZ779926.1|BZ779926 ii35e07.g1 WGS-SbicolorF (DH5a methy... 103 3e-020
gb|CW188052.1|CW188052 104_607_11172812_116_36728_070 Sorgh... 103 3e-020
gb|AW679544.1|AW679544 WS1_29_D01.g1_A002 Water-stressed 1 ... 103 3e-020
gb|CB924446.1|CB924446 ABA1_21_F08.b1_A012 Abscisic acid-tr... 103 3e-020
gb|CD205908.1|CD205908 HS1_19_B08.b1_A012 Heat-shocked seed... 103 3e-020
gb|CD212860.1|CD212860 HS1_17_H04.b1_A012 Heat-shocked seed... 103 3e-020
gb|CD427023.1|CD427023 SA1_17_C08.b1_A002 Salicylic acid-tr... 103 3e-020
gb|CN147616.1|CN147616 WOUND1_50_G10.g1_A002 Wounded leaves... 103 3e-020
gb|CW171706.1|CW171706 104_582_11155886_116_36528_053 Sorgh... 98 2e-018
gb|CF770824.1|CF770824 DSBF1_10_B04.g1_A010 Drought-stresse... 98 2e-018
gb|CW171707.1|CW171707 104_582_11155886_148_36527_053 Sorgh... 90 4e-016
gb|AW922289.1|AW922289 DG1_17_H09.g1_A002 Dark Grown 1 (DG1... 90 4e-016
gb|CW193503.1|CW193503 104_616_11179600_116_36780_058 Sorgh... 86 7e-015
gb|BE363200.1|BE363200 WS1_61_D09.b1_A002 Water-stressed 1 ... 86 7e-015
gb|BG933110.1|BG933110 WS1_29_D01.b1_A002 Water-stressed 1 ... 86 7e-015
gb|CW091332.1|CW091332 104_453_10998487_116_33032_028 Sorgh... 78 2e-012
gb|CW177194.1|CW177194 104_590_11158892_148_36596_074 Sorgh... 78 2e-012
gb|CW393838.1|CW393838 fsbb001f081b07f0 Sorghum methylation... 78 2e-012
gb|BE125962.1|BE125962 DG1_60_C08.b1_A002 Dark Grown 1 (DG1... 78 2e-012
gb|CD222314.1|CD222314 CCC1_21_E10.b1_A007 Callus culture/c... 78 2e-012
gb|CW213799.1|CW213799 104_645_11191755_116_37038_008 Sorgh... 74 3e-011
gb|CW239662.1|CW239662 104_698_11217778_148_37424_047 Sorgh... 74 3e-011
gb|CW458248.1|CW458248 fsbb001f204h03k0 Sorghum methylation... 74 3e-011
gb|CD424723.1|CD424723 SA1_7_D01.b1_A002 Salicylic acid-tre... 72 1e-010
gb|CW239661.1|CW239661 104_698_11217778_116_37423_047 Sorgh... 70 4e-010
gb|CW051043.1|CW051043 104_291_10515016_115_30196 Sorghum m... 66 6e-009
gb|CL184034.1|CL184034 104_397_10898577_116_32364_047 Sorgh... 64 3e-008
gb|BG464757.1|BG464757 EM1_33_G01.g1_A002 Embryo 1 (EM1) So... 64 3e-008
gb|BG464759.1|BG464759 EM1_33_G05.g1_A002 Embryo 1 (EM1) So... 64 3e-008
gb|BG464902.1|BG464902 EM1_35_G06.g1_A002 Embryo 1 (EM1) So... 64 3e-008
gb|CN140087.1|CN140087 OX1_34_B02.b1_A002 Oxidatively-stres... 64 3e-008
gb|CL152904.1|CL152904 104_336_10780327_114_31365_343 Sorgh... 58 2e-006
gb|CL157508.1|CL157508 104_345_10783630_114_31477_190 Sorgh... 58 2e-006
gb|CW278490.1|CW278490 104_752_11406575_148_35682_082 Sorgh... 58 2e-006
gb|CW304080.1|CW304080 104_788_11465588_116_35692_066 Sorgh... 58 2e-006
gb|CW304081.1|CW304081 104_788_11465588_148_35696_066 Sorgh... 58 2e-006
gb|CW465569.1|CW465569 fsbb001f216g11f0 Sorghum methylation... 58 2e-006
gb|BE360873.1|BE360873 DG1_67_A09.g1_A002 Dark Grown 1 (DG1... 58 2e-006
gb|CW428466.1|CW428466 fsbb001f141c22k0 Sorghum methylation... 50 4e-004
gb|CW485737.1|CW485737 fsbb001f248k03f0 Sorghum methylation... 50 4e-004
gb|CD211905.1|CD211905 HS1_67_A06.b1_A012 Heat-shocked seed... 50 4e-004
gb|CL194618.1|CL194618 104_419_10941771_114_32294_012 Sorgh... 48 0.001
gb|CL194619.1|CL194619 104_419_10941771_116_32298_012 Sorgh... 48 0.001
gb|CW091292.1|CW091292 104_453_10998465_114_33030_045 Sorgh... 48 0.001
gb|CW177043.1|CW177043 104_590_11158813_116_36590_059 Sorgh... 48 0.001
gb|CW229154.1|CW229154 104_670_11207152_148_37257_058 Sorgh... 48 0.001
gb|CW229763.1|CW229763 104_671_11207486_148_37296_059 Sorgh... 48 0.001
gb|CW233821.1|CW233821 104_687_11213650_116_37384_043 Sorgh... 48 0.001
gb|CW259437.1|CW259437 104_725_11228422_116_35183_083 Sorgh... 48 0.001
gb|CW259438.1|CW259438 104_725_11228422_148_35179_083 Sorgh... 48 0.001
gb|CW317710.1|CW317710 104_809_11473558_148_35864_085 Sorgh... 48 0.001
gb|CW345226.1|CW345226 104_848_11488374_116_36208_027 Sorgh... 48 0.001
gb|CW345227.1|CW345227 104_848_11488374_148_36207_027 Sorgh... 48 0.001
gb|CN126076.1|CN126076 RHOH1_15_B06.b1_A002 Acid- and alkal... 48 0.001
gb|CX608661.1|CX608661 ANR1_40_A09.b1_A002 Anaerobic roots ... 48 0.001
gb|CX610538.1|CX610538 ANR1_19_G09.b1_A002 Anaerobic roots ... 48 0.001
gb|CX611043.1|CX611043 ANR1_22_G05.b1_A002 Anaerobic roots ... 48 0.001
gb|CX611163.1|CX611163 ANR1_23_B06.b1_A002 Anaerobic roots ... 48 0.001
gb|CX622143.1|CX622143 GABR1_62_F09.b2_A002 GA- or brassino... 48 0.001
gb|CW118551.1|CW118551 104_495_11108272_116_34625_062 Sorgh... 46 0.006
gb|CW357545.1|CW357545 fsbb001f024e02k0 Sorghum methylation... 46 0.006
gb|CW492088.1|CW492088 fsbb001f282d15f0 Sorghum methylation... 46 0.006
gb|CW117635.1|CW117635 104_493_11107760_148_34613_020 Sorgh... 44 0.023
gb|CL171620.1|CL171620 104_373_10889555_148_31776_227 Sorgh... 40 0.36
gb|CW058223.1|CW058223 104_300_10518620_5_30082 Sorghum met... 40 0.36
gb|CW205469.1|CW205469 104_633_11187083_116_36925_034 Sorgh... 40 0.36
gb|CW219906.1|CW219906 104_654_11197052_148_37151_076 Sorgh... 40 0.36
gb|CW230265.1|CW230265 104_671_11207756_116_37270_066 Sorgh... 40 0.36
gb|CW230266.1|CW230266 104_671_11207756_148_37266_066 Sorgh... 40 0.36
gb|CW236166.1|CW236166 104_692_11215470_116_37502_031 Sorgh... 40 0.36
gb|CW314277.1|CW314277 104_804_11471744_148_35799_018 Sorgh... 40 0.36
gb|CW343014.1|CW343014 104_845_11487189_148_36182_093 Sorgh... 40 0.36
gb|CW344414.1|CW344414 104_847_11487942_116_36200_029 Sorgh... 40 0.36
gb|CW391370.1|CW391370 fsbb001f077h16f0 Sorghum methylation... 40 0.36
gb|CW394976.1|CW394976 fsbb001f082n03k0 Sorghum methylation... 40 0.36
gb|CW397751.1|CW397751 fsbb001f086o08k0 Sorghum methylation... 40 0.36
gb|CW441697.1|CW441697 fsbb001f160p13k0 Sorghum methylation... 40 0.36
gb|CW450143.1|CW450143 fsbb001f188k06k0 Sorghum methylation... 40 0.36
gb|CW495032.1|CW495032 fsbb001f286j17f0 Sorghum methylation... 40 0.36
gb|BG048807.1|BG048807 OV1_23_C08.b1_A002 Ovary 1 (OV1) Sor... 40 0.36
gb|BG054207.1|BG054207 OV2_2_G06.b1_A002 Ovary 2 (OV2) Sorg... 40 0.36
gb|BG273642.1|BG273642 OV2_28_B10.b1_A002 Ovary 2 (OV2) Sor... 40 0.36
gb|CD205108.1|CD205108 HS1_12_G09.b1_A012 Heat-shocked seed... 40 0.36
gb|CD209121.1|CD209121 HS1_46_E10.b1_A012 Heat-shocked seed... 40 0.36
gb|CD224783.1|CD224783 CCC1_36_H09.b1_A007 Callus culture/c... 40 0.36
gb|CD231858.1|CD231858 SS1_30_G02.b1_A012 Salt-stressed see... 40 0.36
gb|CD233294.1|CD233294 SS1_13_G10.b1_A012 Salt-stressed see... 40 0.36
gb|CD461752.1|CD461752 SA1_35_F10.b1_A002 Salicylic acid-tr... 40 0.36
gb|CN136721.1|CN136721 OX1_53_A04.b1_A002 Oxidatively-stres... 40 0.36
gb|AF029857.1|AF029857 Sorghum bicolor cytochrome P450 CYP9... 40 0.36
>gb|CW034873.1|CW034873 104_265_10502820_114_30378 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10502820, DNA
sequence
Length = 635
Score = 502 bits (253), Expect = e-140
Identities = 324/347 (93%), Gaps = 3/347 (0%)
Strand = Plus / Plus
Query: 268 gctcacagtcccttgaggacgccaagcatagcatggcgcggcttgcagatggcctccaga 327
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||
Sbjct: 280 gctcacagtcccttgaggacctcaagcatagcatggcgcggcttgcagatggcctcgaga 339
Query: 328 gggacagccctcgggagcgtgattccgcccccttcggccatatcgacctcggcgccgccg 387
||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||
Sbjct: 340 gggacagccctcgggagcgtgatgccgaccccttcggccatgtcgacctcggcgccgccg 399
Query: 388 accgtgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagc 447
|| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 400 acggtctcccagtcgaagcactggatcaacgtgcccaggaccagccccagcgtccgcagc 459
Query: 448 gcgagggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccg 507
|||||||||||||||||||| || |||| |||||||||||||||||||| |||||||||
Sbjct: 460 gcgagggcctctccggggcacttgcgccgtcccatcccgaacggcatcatgaacagccct 519
Query: 508 tcggcacg---gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatc 564
| ||| || |||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 520 tgggctcggccgccgtcctcgaaccgctccggcctgaacgcggctgggtccgccccagtc 579
Query: 565 gcggggtccctgtggatggcgtacacgttgacgaggagcatcgtccc 611
||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 580 gcggggtccctgtggatggcgtacacgttgacgagcagcatcgtccc 626
>gb|CW253791.1|CW253791 104_717_11225292_148_35107_038 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11225292, DNA
sequence
Length = 660
Score = 478 bits (241), Expect = e-133
Identities = 309/331 (93%), Gaps = 3/331 (0%)
Strand = Plus / Plus
Query: 268 gctcacagtcccttgaggacgccaagcatagcatggcgcggcttgcagatggcctccaga 327
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||
Sbjct: 330 gctcacagtcccttgaggacctcaagcatagcatggcgcggcttgcagatggcctcgaga 389
Query: 328 gggacagccctcgggagcgtgattccgcccccttcggccatatcgacctcggcgccgccg 387
||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||
Sbjct: 390 gggacagccctcgggagcgtgatgccgaccccttcggccatgtcgacctcggcgccgccg 449
Query: 388 accgtgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagc 447
|| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 450 acggtctcccagtcgaagcactggatcaacgtgcccaggaccagccccagcgtccgcagc 509
Query: 448 gcgagggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccg 507
|||||||||||||||||||| || |||| |||||||||||||||||||| |||||||||
Sbjct: 510 gcgagggcctctccggggcacttgcgccgtcccatcccgaacggcatcatgaacagccct 569
Query: 508 tcggcacggc---cgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatc 564
| ||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 570 tgggctcggccgtcgtcctcgaaccgctccggcctgaacgcggctgggtccgcccaggtc 629
Query: 565 gcggggtccctgtggatggcgtacacgttga 595
||||||||||||||||||||| |||||||||
Sbjct: 630 gcggggtccctgtggatggcgaacacgttga 660
>gb|CW253790.1|CW253790 104_717_11225292_116_35111_038 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11225292, DNA
sequence
Length = 634
Score = 474 bits (239), Expect = e-132
Identities = 302/323 (93%)
Strand = Plus / Minus
Query: 563 tcgcggggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacac 622
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 631 tcgcggggtccctgtggatggcgtacacgttgacgagcagcatcgtcccgctcggcacgt 572
Query: 623 ggtggccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccg 682
|||||||||||||||||||||| || |||||||||||||| |||||||||||||| ||||
Sbjct: 571 ggtggccgccgaccgtgcagtccgccgtggactcgtgcggcaccagcgtcggcaccaccg 512
Query: 683 ggtacagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgt 742
|||||||||| ||||||||| |||||||||| |||||||||||||| ||||||| |||||
Sbjct: 511 ggtacagccggagggtctcggtgacgatgcactggaggtagccgagccgcggcacgtcgt 452
Query: 743 cggcgccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctcca 802
||||||||||||| |||||||||||| |||||||||| || |||||||||||||||| ||
Sbjct: 451 cggcgccgagcaggcgggagtgccccacggacgcgtcgatttccgcctgcgctttcttca 392
Query: 803 gaacatcggggtggcttagcagcagcgacatcgcccattccgccgtcgtcgccgttgttt 862
|||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 391 gaacgtccgggtggcttagcagcagtgacatcgcccattccgccgtcgtcgccgttgttt 332
Query: 863 cagaacccccagcgaacatgctc 885
| |||||||||||||||||||||
Sbjct: 331 cggaacccccagcgaacatgctc 309
>gb|CW263276.1|CW263276 104_731_11230595_116_35213_042 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11230595, DNA
sequence
Length = 668
Score = 236 bits (119), Expect = 3e-060
Identities = 242/283 (85%)
Strand = Plus / Minus
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
|||| |||||||||||||||||||||||||||| ||||| ||||| ||| ||||||||
Sbjct: 311 gccgccctcgaaccgctccggcctgaacgcggccgggtctgcccacgccgccgggtccct 252
Query: 576 gtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgac 635
||||||||||| |||| ||||| ||||||||||| | ||| || |||||||||||||
Sbjct: 251 atggatggcgtaggcgttcacgagcagcatcgtccctcgcgggacgtggtggccgccgac 192
Query: 636 cgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcag 695
|| |||||| |||||||||||||||| |||||| ||||||| | ||||||||||| ||
Sbjct: 191 cgagcagtctacggtggactcgtgcggcaccagcagcggcacggcggggtacagccggag 132
Query: 696 ggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcgccgagcag 755
| |||| |||||| ||| || ||||| ||||||||||||| |||| |||||| ||||||
Sbjct: 131 cgcctcggtgacgacgcactgcaggtacccgaggcgcggcacgtcggcggcgctgagcag 72
Query: 756 ccgggagtgccccgcggacgcgtcaatctccgcctgcgctttc 798
||||||| |||| |||| ||||| ||||||||||||||||||
Sbjct: 71 ccgggagctccccacggaggcgtctatctccgcctgcgctttc 29
Score = 121 bits (61), Expect = 1e-025
Identities = 121/141 (85%)
Strand = Plus / Minus
Query: 356 ccccttcggccatatcgacctcggcgccgccgaccgtgtcccagtcgaagcactggatca 415
||||||||||||| || |||| | || |||||||| ||||||||||||||||||||| |
Sbjct: 495 ccccttcggccatgtcaacctggtcgtcgccgaccctgtcccagtcgaagcactggacga 436
Query: 416 acgtccccaggaccagccccagcgtccgcagcgcgagggcctctccggggcatttccgcc 475
|||||||| |||| |||||||||||||||||||| | ||| |||||||| || ||||
Sbjct: 435 gggtccccagaaccaagcccagcgtccgcagcgcgagcgtctcgccggggcacttgcgcc 376
Query: 476 ttcccatcccgaacggcatca 496
|||||| ||||||||| ||||
Sbjct: 375 ttcccaacccgaacgggatca 355
>gb|CW355674.1|CW355674 fsbb001f020g14k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f020g14, DNA
sequence
Length = 563
Score = 210 bits (106), Expect = 2e-052
Identities = 235/278 (84%)
Strand = Plus / Plus
Query: 577 tggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgacc 636
||||||||||| |||| ||||| ||||||||||| | ||| || ||||||||||||||
Sbjct: 1 tggatggcgtaggcgttcacgagcagcatcgtccctcgcgggacgtggtggccgccgacc 60
Query: 637 gtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcagg 696
| |||||| |||||||||||||||| |||||| ||||||| | ||||||||||| ||
Sbjct: 61 gagcagtctacggtggactcgtgcggcaccagcagcggcacggcggggtacagccggagc 120
Query: 697 gtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcgccgagcagc 756
| |||| |||||| ||| || ||||| ||||||||||||| |||| |||||| |||||||
Sbjct: 121 gcctcggtgacgacgcactgcaggtacccgaggcgcggcacgtcggcggcgctgagcagc 180
Query: 757 cgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaacatcggggtgg 816
|||||| |||| |||| ||||| |||||||||||||||||| ||| | || ||||||
Sbjct: 181 cgggagctccccacggaggcgtctatctccgcctgcgctttcctcaggatctccgggtgg 240
Query: 817 cttagcagcagcgacatcgcccattccgccgtcgtcgc 854
| |||||||||||||| ||||||||||||| ||||||
Sbjct: 241 ttcagcagcagcgacatggcccattccgccgccgtcgc 278
Score = 56.0 bits (28), Expect = 6e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 885 cgagcacagagccatgatcatggtatccgtgtacacctccggttctgacttctgca 940
||||||||||| |||||||| ||| || ||||| | |||||| |||||||||||||
Sbjct: 401 cgagcacagagacatgatcacggtgtcggtgtatatctccggctctgacttctgca 456
>gb|BE357860.1|BE357860 DG1_22_C12.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 695
Score = 198 bits (100), Expect = 7e-049
Identities = 304/372 (81%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||| ||||||||||| ||| || || |||||||| | |||||||||||||
Sbjct: 415 tgtcccagtcgatgcactggatcagcgtgccgagcaccagcccgacggtccgcagcgcga 356
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| |||||||| || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 355 gcgtctccccggggcacttgcgccgccccatcccgaacggcatcagcagccgcccctcgg 296
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||||||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 295 ccttgccgtcctcgaaccgctccggcctgaactcggccgggtcctcccacaccgcggggt 236
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 235 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 176
Query: 632 cgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagcc 691
||||| ||||||| || | ||||||||||| | ||| |||| || | ||||||| |
Sbjct: 175 cgaccttgcagtccgccgccgactcgtgcggcaggagcagcggcgcggcagggtacatgc 116
Query: 692 gcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcgccga 751
||||||||||| ||| || ||| || |||||||||||||| |||| ||| || ||| ||
Sbjct: 115 gcagggtctcgttgatgacgcactgcaggtagccgaggcgaggcacgtcttctgcggtga 56
Query: 752 gcagccgggagt 763
|||||||||||
Sbjct: 55 tcagccgggagt 44
>gb|BE355191.1|BE355191 DG1_10_D02.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 594
Score = 192 bits (97), Expect = 4e-047
Identities = 283/345 (82%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||| ||||||||||| ||| || || |||||||| | |||||||||||||
Sbjct: 358 tgtcccagtcgatgcactggatcagcgtgccgagcaccagcccgacggtccgcagcgcga 299
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| |||||||| || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 298 gcgtctccccggggcacttgcgccgccccatcccgaacggcatcagcagccgcccctcgg 239
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||||||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 238 ccttgccgtcctcgaaccgctccggcctgaactcggccgggtcctcccacaccgcggggt 179
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 178 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 119
Query: 632 cgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagcc 691
||||| ||||||| || | ||||||||||| | ||| |||| || | ||||||| |
Sbjct: 118 cgaccttgcagtccgccgccgactcgtgcggcaggagcagcggcgcggcagggtacatgc 59
Query: 692 gcagggtctcgctgacgatgcagtggaggtagccgaggcgcggca 736
||||||||||| ||| || ||| || |||||||||||||| ||||
Sbjct: 58 gcagggtctcgttgatgacgcactgcaggtagccgaggcgaggca 14
>gb|CW156276.1|CW156276 104_559_11146598_116_36378_061 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11146598, DNA
sequence
Length = 724
Score = 184 bits (93), Expect = 1e-044
Identities = 282/345 (81%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||||||||||||||| ||||| || ||||| || | |||||||||||||
Sbjct: 458 tgtcccagtcgaagcactggatcagtgtcccgagcaccaggccgacagtccgcagcgcga 399
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| ||||| || || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 398 gtgtctccccgggacactttcgccgccccatcccgaacggcatcagcagccgcccctcgg 339
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||| ||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 338 ccttgccgtcctcgaagcgctccggcctgaactcggccgggtcctcccacaccgcggggt 279
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 278 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 219
Query: 632 cgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagcc 691
|||| ||||||| |||| ||||||||||| | ||| |||| || | ||||||| |
Sbjct: 218 cgacgttgcagtccgcggacgactcgtgcggcaggagcagcggcgcggcagggtacatgc 159
Query: 692 gcagggtctcgctgacgatgcagtggaggtagccgaggcgcggca 736
||||||||||| ||| || |||||| |||||||||||||| ||||
Sbjct: 158 gcagggtctcgttgatgacgcagtgcaggtagccgaggcggggca 114
>gb|CW156277.1|CW156277 104_559_11146598_148_36377_061 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11146598, DNA
sequence
Length = 720
Score = 184 bits (93), Expect = 1e-044
Identities = 282/345 (81%)
Strand = Plus / Plus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||||||||||||||| ||||| || ||||| || | |||||||||||||
Sbjct: 279 tgtcccagtcgaagcactggatcagtgtcccgagcaccaggccgacagtccgcagcgcga 338
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| ||||| || || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 339 gtgtctccccgggacactttcgccgccccatcccgaacggcatcagcagccgcccctcgg 398
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||| ||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 399 ccttgccgtcctcgaagcgctccggcctgaactcggccgggtcctcccacaccgcggggt 458
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 459 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 518
Query: 632 cgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagcc 691
|||| ||||||| |||| ||||||||||| | ||| |||| || | ||||||| |
Sbjct: 519 cgacgttgcagtccgcggacgactcgtgcggcaggagcagcggcgcggcagggtacatgc 578
Query: 692 gcagggtctcgctgacgatgcagtggaggtagccgaggcgcggca 736
||||||||||| ||| || |||||| |||||||||||||| ||||
Sbjct: 579 gcagggtctcgttgatgacgcagtgcaggtagccgaggcggggca 623
>gb|BE362029.1|BE362029 DG1_83_E01.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 654
Score = 172 bits (87), Expect = 4e-041
Identities = 255/311 (81%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||| ||||||||||| ||| || || |||||||| | |||||||||||||
Sbjct: 325 tgtcccagtcgatgcactggatcagcgtgccgagcaccagcccgacggtccgcagcgcga 266
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| |||||||| || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 265 gcgtctccccggggcacttgcgccgccccatcccgaacggcatcagcagccgcccctcgg 206
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||||||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 205 ccttgccgtcctcgaaccgctccggcctgaactcggccgggtcctcccacaccgcggggt 146
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 145 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 86
Query: 632 cgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagcc 691
||||| ||||||| || | ||||||||||| | ||| |||| || | ||||||| |
Sbjct: 85 cgaccttgcagtccgccgccgactcgtgcggcaggagcagcggcgcggcagggtacatgc 26
Query: 692 gcagggtctcg 702
|||||||||||
Sbjct: 25 gcagggtctcg 15
>gb|BE360028.1|BE360028 DG1_60_C08.g2_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 634
Score = 168 bits (85), Expect = 6e-040
Identities = 211/253 (83%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||| ||||||||||| ||| || || |||||||| | |||||||||||||
Sbjct: 265 tgtcccagtcgatgcactggatcagcgtgccgagcaccagcccgacggtccgcagcgcga 206
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| |||||||| || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 205 gcgtctccccggggcacttgcgccgccccatcccgaacggcatcagcagccgcccctcgg 146
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||||||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 145 ccttgccgtcctcgaaccgctccggcctgaactcggccgggtcctcccacaccgcggggt 86
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 85 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 26
Query: 632 cgaccgtgcagtc 644
||||| |||||||
Sbjct: 25 cgaccttgcagtc 13
>gb|BE363286.1|BE363286 WS1_61_D09.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 501
Score = 168 bits (85), Expect = 6e-040
Identities = 211/253 (83%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||| ||||||||||| ||| || || |||||||| | |||||||||||||
Sbjct: 265 tgtcccagtcgatgcactggatcagcgtgccgagcaccagcccgacggtccgcagcgcga 206
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| |||||||| || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 205 gcgtctccccggggcacttgcgccgccccatcccgaacggcatcagcagccgcccctcgg 146
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||||||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 145 ccttgccgtcctcgaaccgctccggcctgaactcggccgggtcctcccacaccgcggggt 86
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 85 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 26
Query: 632 cgaccgtgcagtc 644
||||| |||||||
Sbjct: 25 cgaccttgcagtc 13
>gb|CD226055.1|CD226055 CCC1_43_F04.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_43_F04_A007 3', mRNA sequence
Length = 636
Score = 165 bits (83), Expect = 9e-039
Identities = 254/311 (81%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||| ||||||||||||| ||||| || |||||||| | |||||||||||||
Sbjct: 318 tgtcccagtcaaagcactggatcagtgtcccgagcaccagcccgacagtccgcagcgcga 259
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| |||||||| || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 258 gcgtctccccggggcacttgcgccgccccatcccgaacggcatcagcagccgcccctcgg 199
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||| ||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 198 ccttgccgtcctcgaagcgctccggcctgaactcggccgggtcctcccacaccgcggggt 139
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
|||||||||| |||||| |||| |||| |||| ||| |||| ||||| || |||||
Sbjct: 138 ccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgc 79
Query: 632 cgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagcc 691
|||| ||||||| |||| ||||||||||| | ||| |||| || | ||||||| |
Sbjct: 78 cgacgttgcagtccgcggacgactcgtgcggcaggagcagcggcgcggcagggtacatgc 19
Query: 692 gcagggtctcg 702
|||||||||||
Sbjct: 18 gcagggtctcg 8
>gb|CX613643.1|CX613643 GABR1_9_H05.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_9_H05_A002 3', mRNA sequence
Length = 604
Score = 161 bits (81), Expect = 1e-037
Identities = 279/345 (80%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||||||||||||||| ||||| || ||||| || | |||||||||||||
Sbjct: 378 tgtcccagtcgaagcactggatcagtgtcccgagcaccaggccgacagtccgcagcgcga 319
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| ||||| || || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 318 gtgtctccccgggacactttcgccgccccatcccgaacggcatcagcagccgcccctcgg 259
Query: 512 cacggccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggt 571
| |||||||||||| ||||||||||||||| |||| |||||| |||| | ||||||||
Sbjct: 258 ccttgccgtcctcgaagcgctccggcctgaactcggccgggtcctcccacaccgcggggt 199
Query: 572 ccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgc 631
||||| |||| |||||| |||| |||| |||| ||| |||| ||||| || ||||
Sbjct: 198 ccctgcggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtaaccgc 139
Query: 632 cgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagcc 691
|||| ||||||| |||| ||||||||||| | ||| |||| || | ||||||| |
Sbjct: 138 cgacgttgcagtccgcggacgactcgtgcggcaggagcagcggcgcggcagggtacatgc 79
Query: 692 gcagggtctcgctgacgatgcagtggaggtagccgaggcgcggca 736
||||||||||| ||| || ||| || |||||||||||||| ||||
Sbjct: 78 gcagggtctcgttgatgacgcaatgcaggtagccgaggcggggca 34
>gb|CW256586.1|CW256586 104_721_11226871_116_35138_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226871, DNA
sequence
Length = 535
Score = 153 bits (77), Expect = 4e-035
Identities = 152/177 (85%)
Strand = Plus / Plus
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
|||| |||||||||||||||||||||||||||| ||||| ||||| ||| ||||||||
Sbjct: 345 gccgccctcgaaccgctccggcctgaacgcggccgggtctgcccacgccgccgggtccct 404
Query: 576 gtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgac 635
||||||||||| |||| ||||| ||||||||||| | ||| || |||||||||||||
Sbjct: 405 atggatggcgtaggcgttcacgagcagcatcgtccctcgcgggacgtggtggccgccgac 464
Query: 636 cgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccg 692
|| |||||| |||||||||||||||| |||||| ||||||| | |||||||||||
Sbjct: 465 cgagcagtctacggtggactcgtgcggcaccagcagcggcacggcggggtacagccg 521
Score = 121 bits (61), Expect = 1e-025
Identities = 121/141 (85%)
Strand = Plus / Plus
Query: 356 ccccttcggccatatcgacctcggcgccgccgaccgtgtcccagtcgaagcactggatca 415
||||||||||||| || |||| | || |||||||| ||||||||||||||||||||| |
Sbjct: 161 ccccttcggccatgtcaacctggtcgtcgccgaccctgtcccagtcgaagcactggacga 220
Query: 416 acgtccccaggaccagccccagcgtccgcagcgcgagggcctctccggggcatttccgcc 475
|||||||| |||| |||||||||||||||||||| | ||| |||||||| || ||||
Sbjct: 221 gggtccccagaaccaagcccagcgtccgcagcgcgagcgtctcgccggggcacttgcgcc 280
Query: 476 ttcccatcccgaacggcatca 496
|||||| ||||||||| ||||
Sbjct: 281 ttcccaacccgaacgggatca 301
>gb|CF430593.1|CF430593 NIT1_3_A05.b1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_3_A05_A002 3', mRNA sequence
Length = 531
Score = 153 bits (77), Expect = 4e-035
Identities = 152/177 (85%)
Strand = Plus / Minus
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
|||| |||||||||||||||||||||||||||| ||||| ||||| ||| ||||||||
Sbjct: 185 gccgccctcgaaccgctccggcctgaacgcggccgggtctgcccacgccgccgggtccct 126
Query: 576 gtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgac 635
||||||||||| |||| ||||| ||||||||||| | ||| || |||||||||||||
Sbjct: 125 atggatggcgtaggcgttcacgagcagcatcgtccctcgcgggacgtggtggccgccgac 66
Query: 636 cgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccg 692
|| |||||| |||||||||||||||| |||||| ||||||| | |||||||||||
Sbjct: 65 cgagcagtctacggtggactcgtgcggcaccagcagcggcacggcggggtacagccg 9
Score = 121 bits (61), Expect = 1e-025
Identities = 121/141 (85%)
Strand = Plus / Minus
Query: 356 ccccttcggccatatcgacctcggcgccgccgaccgtgtcccagtcgaagcactggatca 415
||||||||||||| || |||| | || |||||||| ||||||||||||||||||||| |
Sbjct: 369 ccccttcggccatgtcaacctggtcgtcgccgaccctgtcccagtcgaagcactggacga 310
Query: 416 acgtccccaggaccagccccagcgtccgcagcgcgagggcctctccggggcatttccgcc 475
|||||||| |||| |||||||||||||||||||| | ||| |||||||| || ||||
Sbjct: 309 gggtccccagaaccaagcccagcgtccgcagcgcgagcgtctcgccggggcacttgcgcc 250
Query: 476 ttcccatcccgaacggcatca 496
|||||| ||||||||| ||||
Sbjct: 249 ttcccaacccgaacgggatca 229
>gb|CW192718.1|CW192718 104_615_11179178_148_36775_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179178, DNA
sequence
Length = 730
Score = 151 bits (76), Expect = 1e-034
Identities = 431/546 (78%), Gaps = 5/546 (0%)
Strand = Plus / Minus
Query: 303 gcgcggcttgcagatggcctccagagggacagccctcgggagcgtgattccgcccccttc 362
|||||||||||| | ||||||||| ||||| ||||| || | || | ||||| | ||
Sbjct: 590 gcgcggcttgcacagggcctccagcgggacggccctgggcatggtcagcccgccgctctc 531
Query: 363 ggccatatcgacctcggcgccgccgaccgtgtcccagtcgaagcactggatcaacgtccc 422
|||||| |||||||| | || | ||| |||||||||||||||||||||||| ||| ||
Sbjct: 530 ggccatgtcgacctcaactccatcaaccctgtcccagtcgaagcactggatcagcgtgcc 471
Query: 423 caggaccagccccagcgtccgcagcgcgagggcctctccggggcatttccgccttcccat 482
|| |||||||| | |||||||||||||| ||||| |||||||| || |||| |||||
Sbjct: 470 gagcaccagcccgacggtccgcagcgcgagcgcctccccggggcacttgcgccgccccat 411
Query: 483 cccgaacggcatcacgaacagcccgtcggcacg---gccgtcctcgaaccgctccggcct 539
|||||||||||||| | | |||| ||||| | |||||||||||||||||||||| |
Sbjct: 410 cccgaacggcatcagcagccgcccctcggcctgcttgccgtcctcgaaccgctccggcat 351
Query: 540 gaacgcggct-gggtccgcccatatcgcggggtccctgtggatggcgtacacgttgacga 598
||| | ||| || || |||| | | ||||||||||||||| |||| |||||| || |
Sbjct: 350 gaa-tctgctcggttcttcccagaccacggggtccctgtggaccgcgtgcacgttcacca 292
Query: 599 ggagcatcgtcccgctcggcacacggtggccgccgaccgtgcagtcggcggtggactcgt 658
| |||||||| |||| ||||| || |||||||||| ||||||| |||| ||||||||
Sbjct: 291 gcagcatcgtgccgcggggcacgtcgtagccgccgaccttgcagtctgcggaggactcgt 232
Query: 659 gcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgcagtgga 718
|||| | |||| |||| || | |||| ||| ||||| |||||| ||| |||||| || |
Sbjct: 231 gcggcagcagcagcggcgcggctgggtgcaggcgcagcgtctcgttgatgatgcactgca 172
Query: 719 ggtagccgaggcgcggcaggtcgtcggcgccgagcagccgggagtgccccgcggacgcgt 778
||||| |||||| | || |||||| ||| | ||| |||||| ||| ||| ||||
Sbjct: 171 ggtaggtgaggcgagacacgtcgtccgcggtcaccaggcgggaggtgcccacggcggcgt 112
Query: 779 caatctccgcctgcgctttctccagaacatcggggtggcttagcagcagcgacatcgccc 838
| ||||| |||||||| |||| || || || |||||| | ||||| |||||||| ||||
Sbjct: 111 cgatctcggcctgcgccttcttgaggacctccgggtggttcagcaggagcgacatggccc 52
Query: 839 attccg 844
||||||
Sbjct: 51 attccg 46
>gb|CW193504.1|CW193504 104_616_11179600_148_36779_058 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179600, DNA
sequence
Length = 697
Score = 151 bits (76), Expect = 1e-034
Identities = 431/546 (78%), Gaps = 5/546 (0%)
Strand = Plus / Plus
Query: 303 gcgcggcttgcagatggcctccagagggacagccctcgggagcgtgattccgcccccttc 362
|||||||||||| | ||||||||| ||||| ||||| || | || | ||||| | ||
Sbjct: 153 gcgcggcttgcacagggcctccagcgggacggccctgggcatggtcagcccgccgctctc 212
Query: 363 ggccatatcgacctcggcgccgccgaccgtgtcccagtcgaagcactggatcaacgtccc 422
|||||| |||||||| | || | ||| |||||||||||||||||||||||| ||| ||
Sbjct: 213 ggccatgtcgacctcaactccatcaaccctgtcccagtcgaagcactggatcagcgtgcc 272
Query: 423 caggaccagccccagcgtccgcagcgcgagggcctctccggggcatttccgccttcccat 482
|| |||||||| | |||||||||||||| ||||| |||||||| || |||| |||||
Sbjct: 273 gagcaccagcccgacggtccgcagcgcgagcgcctccccggggcacttgcgccgccccat 332
Query: 483 cccgaacggcatcacgaacagcccgtcggcacg---gccgtcctcgaaccgctccggcct 539
|||||||||||||| | | |||| ||||| | |||||||||||||||||||||| |
Sbjct: 333 cccgaacggcatcagcagccgcccctcggcctgcttgccgtcctcgaaccgctccggcat 392
Query: 540 gaacgcggct-gggtccgcccatatcgcggggtccctgtggatggcgtacacgttgacga 598
||| | ||| || || |||| | | ||||||||||||||| |||| |||||| || |
Sbjct: 393 gaa-tctgctcggttcttcccagaccacggggtccctgtggaccgcgtgcacgttcacca 451
Query: 599 ggagcatcgtcccgctcggcacacggtggccgccgaccgtgcagtcggcggtggactcgt 658
| |||||||| |||| ||||| || |||||||||| ||||||| |||| ||||||||
Sbjct: 452 gcagcatcgtgccgcggggcacgtcgtagccgccgaccttgcagtctgcggaggactcgt 511
Query: 659 gcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgcagtgga 718
|||| | |||| |||| || | |||| ||| ||||| |||||| ||| |||||| || |
Sbjct: 512 gcggcagcagcagcggcgcggctgggtgcaggcgcagcgtctcgttgatgatgcactgca 571
Query: 719 ggtagccgaggcgcggcaggtcgtcggcgccgagcagccgggagtgccccgcggacgcgt 778
||||| |||||| | || |||||| ||| | ||| |||||| ||| ||| ||||
Sbjct: 572 ggtaggtgaggcgagacacgtcgtccgcggtcaccaggcgggaggtgcccacggcggcgt 631
Query: 779 caatctccgcctgcgctttctccagaacatcggggtggcttagcagcagcgacatcgccc 838
| ||||| |||||||| |||| || || || |||||| | ||||| |||||||| ||||
Sbjct: 632 cgatctcggcctgcgccttcttgaggacctccgggtggttcagcaggagcgacatggccc 691
Query: 839 attccg 844
||||||
Sbjct: 692 attccg 697
>gb|BE357452.1|BE357452 DG1_15_A08.b2_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 602
Score = 139 bits (70), Expect = 5e-031
Identities = 262/326 (80%)
Strand = Plus / Minus
Query: 517 ccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccctg 576
||||||||||||||||||||||||||| |||| |||||| |||| | |||||||||||||
Sbjct: 602 ccgtcctcgaaccgctccggcctgaactcggccgggtcctcccacaccgcggggtccctg 543
Query: 577 tggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgacc 636
||||| |||||| |||| |||| |||| ||| |||| ||||| || ||||||||||
Sbjct: 542 tggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtcgtagccgccgacc 483
Query: 637 gtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcagg 696
||||||| || | ||||||||||| | ||| |||| || | ||||||| ||||||
Sbjct: 482 ttgcagtccgccgccgactcgtgcggcaggagcagcggcgcggcagggtacatgcgcagg 423
Query: 697 gtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggcgccgagcagc 756
|||||| ||| || ||| || |||||||||||||| |||| ||| || ||| || ||||
Sbjct: 422 gtctcgttgatgacgcactgcaggtagccgaggcgaggcacgtcttctgcggtgatcagc 363
Query: 757 cgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaacatcggggtgg 816
||||||| ||| || |||||| ||||| ||||| || |||| ||| | || ||||||
Sbjct: 362 cgggagttgcccacgaccgcgtcgatctctgcctgtgccttcttcagcgcctccgggtgg 303
Query: 817 cttagcagcagcgacatcgcccattc 842
| || || |||||||| ||||||||
Sbjct: 302 ttcagaagaagcgacatggcccattc 277
Score = 77.8 bits (39), Expect = 2e-012
Identities = 48/51 (94%)
Strand = Plus / Minus
Query: 895 gccatgatcatggtatccgtgtacacctccggttctgacttctgcagtgag 945
||||||||||||||||||||||||| |||||| ||||||||||||| ||||
Sbjct: 224 gccatgatcatggtatccgtgtacagctccggctctgacttctgcaatgag 174
>gb|CW256587.1|CW256587 104_721_11226871_148_35142_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226871, DNA
sequence
Length = 620
Score = 137 bits (69), Expect = 2e-030
Identities = 147/173 (84%)
Strand = Plus / Minus
Query: 682 gggtacagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcg 741
||||||||||| || | |||| |||||| ||| || ||||| ||||||||||||| ||||
Sbjct: 619 gggtacagccggagcgcctcggtgacgacgcactgcaggtacccgaggcgcggcacgtcg 560
Query: 742 tcggcgccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctcc 801
|||||| ||||||||||||| |||| |||| ||||| |||||||||||||||||| |
Sbjct: 559 gcggcgctgagcagccgggagctccccacggaggcgtctatctccgcctgcgctttcctc 500
Query: 802 agaacatcggggtggcttagcagcagcgacatcgcccattccgccgtcgtcgc 854
|| | || |||||| | |||||||||||||| ||||||||||||| ||||||
Sbjct: 499 aggatctccgggtggttcagcagcagcgacatggcccattccgccgccgtcgc 447
Score = 56.0 bits (28), Expect = 6e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 885 cgagcacagagccatgatcatggtatccgtgtacacctccggttctgacttctgca 940
||||||||||| |||||||| ||| || ||||| | |||||| |||||||||||||
Sbjct: 324 cgagcacagagacatgatcacggtgtcggtgtatatctccggctctgacttctgca 269
>gb|CX610228.1|CX610228 ANR1_17_H06.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_17_H06_A002 3', mRNA sequence
Length = 734
Score = 137 bits (69), Expect = 2e-030
Identities = 429/546 (78%), Gaps = 5/546 (0%)
Strand = Plus / Minus
Query: 303 gcgcggcttgcagatggcctccagagggacagccctcgggagcgtgattccgcccccttc 362
|||||||||||| | ||||||||| ||||| ||||| || | || | ||||| | ||
Sbjct: 548 gcgcggcttgcacagggcctccagcgggacggccctgggcatggtcagcccgccgctctc 489
Query: 363 ggccatatcgacctcggcgccgccgaccgtgtcccagtcgaagcactggatcaacgtccc 422
|||||| |||||||| | || | ||| |||||||||||||||||||||||| ||| ||
Sbjct: 488 ggccatgtcgacctcaactccatcaaccctgtcccagtcgaagcactggatcagcgtgcc 429
Query: 423 caggaccagccccagcgtccgcagcgcgagggcctctccggggcatttccgccttcccat 482
|| |||||||| | |||||||||||||| ||||| |||||||| || |||| |||||
Sbjct: 428 gagcaccagcccgacggtccgcagcgcgagcgcctccccggggcacttgcgccgccccat 369
Query: 483 cccgaacggcatcacgaacagcccgtcggcacg---gccgtcctcgaaccgctccggcct 539
|||||||||||||| | | |||| ||||| | |||||||||||||||||||||| |
Sbjct: 368 cccgaacggcatcagcagccgcccctcggcctgcttgccgtcctcgaaccgctccggcat 309
Query: 540 gaacgcggct-gggtccgcccatatcgcggggtccctgtggatggcgtacacgttgacga 598
||| | ||| || || |||| | | ||||||||||||||| |||| |||||| || |
Sbjct: 308 gaa-tctgctcggttcttcccagaccacggggtccctgtggaccgcgtgcacgttcacca 250
Query: 599 ggagcatcgtcccgctcggcacacggtggccgccgaccgtgcagtcggcggtggactcgt 658
| |||||||| |||| ||||| || ||||||||| ||||||| |||| ||||||||
Sbjct: 249 gcagcatcgtgccgcggggcacgtcgtaaccgccgaccttgcagtctgcggaggactcgt 190
Query: 659 gcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgcagtgga 718
|||| | |||| |||| || | |||| ||| |||| |||||| ||| |||||| || |
Sbjct: 189 gcggcagcagcagcggcgcggctgggtgcaggcgcancgtctcgttgatgatgcactgca 130
Query: 719 ggtagccgaggcgcggcaggtcgtcggcgccgagcagccgggagtgccccgcggacgcgt 778
||||| |||||| | || |||||| ||| | ||| |||||| ||| ||| ||||
Sbjct: 129 ggtaggtgaggcgagacacgtcgtccgcggtcaccaggcgggaggtgcccacggcggcgt 70
Query: 779 caatctccgcctgcgctttctccagaacatcggggtggcttagcagcagcgacatcgccc 838
| ||||| |||||||| |||| || || || |||||| | ||||| |||||||| ||||
Sbjct: 69 cgatctcggcctgcgccttcttgaggacctccgggtggttcagcaggagcgacatggccc 10
Query: 839 attccg 844
||||||
Sbjct: 9 attccg 4
>gb|CD464006.1|CD464006 ETH1_48_F01.b1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_48_F01_A002 3', mRNA sequence
Length = 565
Score = 129 bits (65), Expect = 5e-028
Identities = 330/415 (79%), Gaps = 5/415 (1%)
Strand = Plus / Minus
Query: 303 gcgcggcttgcagatggcctccagagggacagccctcgggagcgtgattccgcccccttc 362
|||||||||||| | ||||||||| ||||| ||||| || | || | ||||| | ||
Sbjct: 417 gcgcggcttgcacagggcctccagcgggacggccctgggcatggtcagcccgccgctctc 358
Query: 363 ggccatatcgacctcggcgccgccgaccgtgtcccagtcgaagcactggatcaacgtccc 422
|||||| |||||||| | || | ||| |||||||||||||||||||||||| ||| ||
Sbjct: 357 ggccatgtcgacctcaactccatcaaccctgtcccagtcgaagcactggatcagcgtgcc 298
Query: 423 caggaccagccccagcgtccgcagcgcgagggcctctccggggcatttccgccttcccat 482
|| |||||||| | |||||||||||||| ||||| |||||||| || |||| |||||
Sbjct: 297 gagcaccagcccgacggtccgcagcgcgagcgcctccccggggcacttgcgccgccccat 238
Query: 483 cccgaacggcatcacgaacagcccgtcggcacg---gccgtcctcgaaccgctccggcct 539
||||||| |||||| | | |||| ||||| | |||||||||||||||||||||| |
Sbjct: 237 cccgaacagcatcagcagccgcccctcggcctgcttgccgtcctcgaaccgctccggcat 178
Query: 540 gaacgcggct-gggtccgcccatatcgcggggtccctgtggatggcgtacacgttgacga 598
||| | ||| || || |||| | | ||||||||||||||| |||| |||||| || |
Sbjct: 177 gaa-tctgctcggttcttcccagaccacggggtccctgtggaccgcgtgcacgttcacca 119
Query: 599 ggagcatcgtcccgctcggcacacggtggccgccgaccgtgcagtcggcggtggactcgt 658
| |||||||| |||| ||||| || |||||||||| ||||||| |||| ||||||||
Sbjct: 118 gcagcatcgtgccgcggggcacgtcgtagccgccgaccttgcagtctgcggaggactcgt 59
Query: 659 gcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgca 713
|||| | |||| |||| || | |||| ||| ||||| |||||| ||| ||||||
Sbjct: 58 gcggcagcagcagcggcgcggctgggtgcaggcgcagcgtctcgttgatgatgca 4
>gb|AW922538.1|AW922538 DG1_20_D10.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 430
Score = 119 bits (60), Expect = 5e-025
Identities = 129/152 (84%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||| ||||||||||| ||| || || |||||||| | |||||||||||||
Sbjct: 156 tgtcccagtcgatgcactggatcagcgtgccgagcaccagcccgacggtccgcagcgcga 97
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcgg 511
| | ||| |||||||| || |||| ||||||||||||||||||| | | |||| ||||
Sbjct: 96 gcgtctccccggggcacttgcgccgccccatcccgaacggcatcagcagccgcccctcgg 37
Query: 512 cacggccgtcctcgaaccgctccggcctgaac 543
| ||||||||||||||||||||||||||||
Sbjct: 36 ccttgccgtcctcgaaccgctccggcctgaac 5
>gb|CW442457.1|CW442457 fsbb001f162c05k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f162c05, DNA
sequence
Length = 554
Score = 105 bits (53), Expect = 7e-021
Identities = 164/201 (81%)
Strand = Plus / Minus
Query: 524 cgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccctgtggatgg 583
|||||||||||||||||||| || | || ||| |||| | ||| ||||||||||||||||
Sbjct: 430 cgaaccgctccggcctgaactcgccgggttcctcccacaccgccgggtccctgtggatgg 371
Query: 584 cgtacacgttgacgaggagcatcgtcccgctcggcacacggtggccgccgaccgtgcagt 643
||||| ||||||||| |||| ||| |||| ||||| || ||||||||| | |||||
Sbjct: 370 cgtacgcgttgacgaacagcagcgtgccgcggggcacgtcgtagccgccgacggcgcagt 311
Query: 644 cggcggtggactcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgc 703
| || | ||||||||||| | |||| |||| | ||||||||||| ||||| |||||||
Sbjct: 310 ccgccgccgactcgtgcggcagcagcagcggcgccaccgggtacaggcgcagcgtctcgc 251
Query: 704 tgacgatgcagtggaggtagc 724
||| || ||| || |||||||
Sbjct: 250 tgatgacgcactgcaggtagc 230
Score = 54.0 bits (27), Expect = 2e-005
Identities = 48/55 (87%)
Strand = Plus / Minus
Query: 439 gtccgcagcgcgagggcctctccggggcatttccgccttcccatcccgaacggca 493
|||||||||||||||| ||| |||||||| | |||| ||||||||||||||||
Sbjct: 536 gtccgcagcgcgagggtctccccggggcacctgcgccgccccatcccgaacggca 482
>gb|BZ779926.1|BZ779926 ii35e07.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ii35e07, DNA sequence
Length = 688
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Plus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 133 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 192
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 193 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 252
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 253 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 312
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 313 gtggatggcgtacgcattgacaaggatcatcg 344
Score = 50.1 bits (25), Expect = 4e-004
Identities = 58/69 (84%)
Strand = Plus / Plus
Query: 654 ctcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgca 713
||||||||| | ||| ||||| || ||||||| || || || |||||||||| ||||||
Sbjct: 391 ctcgtgcggcagtagcatcggcgcggccgggtagaggcgaagcgtctcgctgatgatgca 450
Query: 714 gtggaggta 722
|||||||||
Sbjct: 451 gtggaggta 459
>gb|CW188052.1|CW188052 104_607_11172812_116_36728_070 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11172812, DNA
sequence
Length = 667
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Plus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 187 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 246
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 247 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 306
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 307 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 366
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 367 gtggatggcgtacgcattgacaaggatcatcg 398
Score = 50.1 bits (25), Expect = 4e-004
Identities = 58/69 (84%)
Strand = Plus / Plus
Query: 654 ctcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgca 713
||||||||| | ||| ||||| || ||||||| || || || |||||||||| ||||||
Sbjct: 445 ctcgtgcggcagtagcatcggcgcggccgggtagaggcgaagcgtctcgctgatgatgca 504
Query: 714 gtggaggta 722
|||||||||
Sbjct: 505 gtggaggta 513
>gb|AW679544.1|AW679544 WS1_29_D01.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 556
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 289 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 230
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 229 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 170
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 169 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 110
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 109 gtggatggcgtacgcattgacaaggatcatcg 78
>gb|CB924446.1|CB924446 ABA1_21_F08.b1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_21_F08_A012 3', mRNA sequence
Length = 623
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 290 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 231
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 230 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 171
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 170 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 111
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 110 gtggatggcgtacgcattgacaaggatcatcg 79
>gb|CD205908.1|CD205908 HS1_19_B08.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_19_B08_A012 3', mRNA sequence
Length = 556
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 317 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 258
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 257 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 198
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 197 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 138
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 137 gtggatggcgtacgcattgacaaggatcatcg 106
>gb|CD212860.1|CD212860 HS1_17_H04.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_17_H04_A012 3', mRNA sequence
Length = 540
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 355 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 296
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 295 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 236
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 235 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 176
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 175 gtggatggcgtacgcattgacaaggatcatcg 144
Score = 50.1 bits (25), Expect = 4e-004
Identities = 58/69 (84%)
Strand = Plus / Minus
Query: 654 ctcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgca 713
||||||||| | ||| ||||| || ||||||| || || || |||||||||| ||||||
Sbjct: 97 ctcgtgcggcagtagcatcggcgcggccgggtagaggcgaagcgtctcgctgatgatgca 38
Query: 714 gtggaggta 722
|||||||||
Sbjct: 37 gtggaggta 29
>gb|CD427023.1|CD427023 SA1_17_C08.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_17_C08_A002 3', mRNA sequence
Length = 679
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 447 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 388
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 387 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 328
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 327 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 268
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 267 gtggatggcgtacgcattgacaaggatcatcg 236
Score = 50.1 bits (25), Expect = 4e-004
Identities = 58/69 (84%)
Strand = Plus / Minus
Query: 654 ctcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgca 713
||||||||| | ||| ||||| || ||||||| || || || |||||||||| ||||||
Sbjct: 189 ctcgtgcggcagtagcatcggcgcggccgggtagaggcgaagcgtctcgctgatgatgca 130
Query: 714 gtggaggta 722
|||||||||
Sbjct: 129 gtggaggta 121
>gb|CN147616.1|CN147616 WOUND1_50_G10.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_50_G10_A002 5', mRNA sequence
Length = 789
Score = 103 bits (52), Expect = 3e-020
Identities = 172/212 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 638 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 579
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 578 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 519
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 518 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 459
Query: 576 gtggatggcgtacacgttgacgaggagcatcg 607
||||||||||||| | ||||| |||| |||||
Sbjct: 458 gtggatggcgtacgcattgacaaggatcatcg 427
Score = 50.1 bits (25), Expect = 4e-004
Identities = 58/69 (84%)
Strand = Plus / Minus
Query: 654 ctcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgca 713
||||||||| | ||| ||||| || ||||||| || || || |||||||||| ||||||
Sbjct: 380 ctcgtgcggcagtagcatcggcgcggccgggtagaggcgaagcgtctcgctgatgatgca 321
Query: 714 gtggaggta 722
|||||||||
Sbjct: 320 gtggaggta 312
>gb|CW171706.1|CW171706 104_582_11155886_116_36528_053 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11155886, DNA
sequence
Length = 672
Score = 97.6 bits (49), Expect = 2e-018
Identities = 58/61 (95%)
Strand = Plus / Minus
Query: 885 cgagcacagagccatgatcatggtatccgtgtacacctccggttctgacttctgcagtga 944
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||
Sbjct: 266 cgagcacagagccatgatcgtggtatccgtgtacacctccggctctgacttctgcaatga 207
Query: 945 g 945
|
Sbjct: 206 g 206
>gb|CF770824.1|CF770824 DSBF1_10_B04.g1_A010 Drought-stressed before flowering Sorghum
bicolor cDNA clone DSBF1_10_B04_A010 3', mRNA sequence
Length = 576
Score = 97.6 bits (49), Expect = 2e-018
Identities = 157/193 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 200 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 141
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 140 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 81
Query: 516 gccgtcctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccct 575
||||| |||||||| ||||||||||||| | | |||||| ||||| |||| || |||||
Sbjct: 80 gccgtgctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccct 21
Query: 576 gtggatggcgtac 588
|||||||||||||
Sbjct: 20 gtggatggcgtac 8
>gb|CW171707.1|CW171707 104_582_11155886_148_36527_053 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11155886, DNA
sequence
Length = 663
Score = 89.7 bits (45), Expect = 4e-016
Identities = 48/49 (97%)
Strand = Plus / Plus
Query: 837 ccattccgccgtcgtcgccgttgtttcagaacccccagcgaacatgctc 885
||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1 ccattccgccgtcgtcgccgttgtttcggaacccccagcgaacatgctc 49
>gb|AW922289.1|AW922289 DG1_17_H09.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 535
Score = 89.7 bits (45), Expect = 4e-016
Identities = 90/105 (85%)
Strand = Plus / Minus
Query: 392 tgtcccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcga 451
|||||||||||| ||||||||||| ||| || || |||||||| | |||||||||||||
Sbjct: 117 tgtcccagtcgatgcactggatcagcgtgccgagcaccagcccgacggtccgcagcgcga 58
Query: 452 gggcctctccggggcatttccgccttcccatcccgaacggcatca 496
| | ||| |||||||| || |||| |||||||||||||||||||
Sbjct: 57 gcgtctccccggggcacttgcgccgccccatcccgaacggcatca 13
>gb|CW193503.1|CW193503 104_616_11179600_116_36780_058 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179600, DNA
sequence
Length = 650
Score = 85.7 bits (43), Expect = 7e-015
Identities = 220/279 (78%)
Strand = Plus / Minus
Query: 566 cggggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggt 625
||||||||||||||| |||| |||||| || || |||||||| |||| ||||| ||
Sbjct: 643 cggggtccctgtggaccgcgtgcacgttcaccagcagcatcgtgccgcggggcacgtcgt 584
Query: 626 ggccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggt 685
|||||||||| ||||||| |||| |||||||||||| | |||| |||| || | ||||
Sbjct: 583 agccgccgaccttgcagtctgcggaggactcgtgcggcagcagcagcggcgcggctgggt 524
Query: 686 acagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcgg 745
||| ||||| |||||| ||| |||||| || |||||| |||||| | || |||||| |
Sbjct: 523 gcaggcgcagcgtctcgttgatgatgcactgcaggtaggtgaggcgagacacgtcgtccg 464
Query: 746 cgccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaa 805
|| | ||| |||||| ||| ||| ||||| ||||| |||||||| |||| || |
Sbjct: 463 cggtcaccaggcgggaggtgcccacggcggcgtcgatctcggcctgcgccttcttgagga 404
Query: 806 catcggggtggcttagcagcagcgacatcgcccattccg 844
| || |||||| | ||||| |||||||| ||||||||||
Sbjct: 403 cctccgggtggttcagcaggagcgacatggcccattccg 365
>gb|BE363200.1|BE363200 WS1_61_D09.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 495
Score = 85.7 bits (43), Expect = 7e-015
Identities = 220/279 (78%)
Strand = Plus / Minus
Query: 564 cgcggggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacg 623
|||||||||||||||||| |||||| |||| |||| |||| ||| |||| |||||
Sbjct: 483 cgcggggtccctgtggatcgcgtacgcgttcacgatcagcagcgtgccgcggggcacgtc 424
Query: 624 gtggccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgg 683
|| |||||||||| ||||||| || | ||||||||||| | ||| |||| || | ||
Sbjct: 423 gtagccgccgaccttgcagtccgccgccgactcgtgcggcaggagcagcggcgcggcagg 364
Query: 684 gtacagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtc 743
||||| |||||||||||| ||| || ||| || |||||||||||||| |||| ||| ||
Sbjct: 363 gtacatgcgcagggtctcgttgatgacgcactgcaggtagccgaggcgaggcacgtcttc 304
Query: 744 ggcgccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccag 803
||| || ||||||||||| ||| || |||||| ||||| ||||| || |||| |||
Sbjct: 303 tgcggtgatcagccgggagttgcccacgaccgcgtcgatctctgcctgtgccttcttcag 244
Query: 804 aacatcggggtggcttagcagcagcgacatcgcccattc 842
| || |||||| | || || |||||||| ||||||||
Sbjct: 243 cgcctccgggtggttcagaagaagcgacatggcccattc 205
Score = 77.8 bits (39), Expect = 2e-012
Identities = 48/51 (94%)
Strand = Plus / Minus
Query: 895 gccatgatcatggtatccgtgtacacctccggttctgacttctgcagtgag 945
||||||||||||||||||||||||| |||||| ||||||||||||| ||||
Sbjct: 152 gccatgatcatggtatccgtgtacagctccggctctgacttctgcaatgag 102
>gb|BG933110.1|BG933110 WS1_29_D01.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 507
Score = 85.7 bits (43), Expect = 7e-015
Identities = 165/206 (80%)
Strand = Plus / Minus
Query: 402 gaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggcctctcc 461
|||||| |||| || || || |||||||||||||| || |||| |||||| ||| ||
Sbjct: 507 gaagcattggagcagcgcccncaggaccagccccatggttcgcatcgcgagattctcacc 448
Query: 462 ggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacggccgtc 521
|||||| | ||||| |||||||| || ||||||| ||| ||| || || | |||||
Sbjct: 447 ggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctctgccgtg 388
Query: 522 ctcgaaccgctccggcctgaacgcggctgggtccgcccatatcgcggggtccctgtggat 581
|||||||| ||||||||||||| | | |||||| ||||| |||| || |||||||||||
Sbjct: 387 ctcgaacctctccggcctgaactcctccgggtcctcccatgtcgccggatccctgtggat 328
Query: 582 ggcgtacacgttgacgaggagcatcg 607
||||||| | ||||| |||| |||||
Sbjct: 327 ggcgtacgcattgacaaggatcatcg 302
Score = 50.1 bits (25), Expect = 4e-004
Identities = 58/69 (84%)
Strand = Plus / Minus
Query: 654 ctcgtgcgggaccagcgtcggcacgaccgggtacagccgcagggtctcgctgacgatgca 713
||||||||| | ||| ||||| || ||||||| || || || |||||||||| ||||||
Sbjct: 255 ctcgtgcggcagtagcatcggcgcggccgggtagaggcgaagcgtctcgctgatgatgca 196
Query: 714 gtggaggta 722
|||||||||
Sbjct: 195 gtggaggta 187
>gb|CW091332.1|CW091332 104_453_10998487_116_33032_028 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10998487, DNA
sequence
Length = 671
Score = 77.8 bits (39), Expect = 2e-012
Identities = 48/51 (94%)
Strand = Plus / Plus
Query: 895 gccatgatcatggtatccgtgtacacctccggttctgacttctgcagtgag 945
||||||||||||||||||||||||| |||||| ||||||||||||| ||||
Sbjct: 269 gccatgatcatggtatccgtgtacagctccggctctgacttctgcaatgag 319
>gb|CW177194.1|CW177194 104_590_11158892_148_36596_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11158892, DNA
sequence
Length = 524
Score = 77.8 bits (39), Expect = 2e-012
Identities = 48/51 (94%)
Strand = Plus / Plus
Query: 895 gccatgatcatggtatccgtgtacacctccggttctgacttctgcagtgag 945
||||||||||||||||||||||||| |||||| ||||||||||||| ||||
Sbjct: 224 gccatgatcatggtatccgtgtacagctccggctctgacttctgcaatgag 274
>gb|CW393838.1|CW393838 fsbb001f081b07f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f081b07, DNA
sequence
Length = 634
Score = 77.8 bits (39), Expect = 2e-012
Identities = 48/51 (94%)
Strand = Plus / Minus
Query: 895 gccatgatcatggtatccgtgtacacctccggttctgacttctgcagtgag 945
||||||||||||||||||||||||| |||||| ||||||||||||| ||||
Sbjct: 69 gccatgatcatggtatccgtgtacagctccggctctgacttctgcaatgag 19
Score = 63.9 bits (32), Expect = 3e-008
Identities = 170/216 (78%)
Strand = Plus / Minus
Query: 627 gccgccgaccgtgcagtcggcggtggactcgtgcgggaccagcgtcggcacgaccgggta 686
|||||||||| ||||||| || | ||||||||||| | ||| |||| || | |||||
Sbjct: 597 gccgccgaccttgcagtccgccgccgactcgtgcggcaggagcagcggcgcggcagggta 538
Query: 687 cagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggtcgtcggc 746
|| |||||||||||| ||| || ||| || |||||||||||||| |||| ||| || ||
Sbjct: 537 catgcgcagggtctcgttgatgacgcactgcaggtagccgaggcgaggcacgtcttctgc 478
Query: 747 gccgagcagccgggagtgccccgcggacgcgtcaatctccgcctgcgctttctccagaac 806
| || ||||||||||| ||| || |||||| ||||| ||||| || |||| ||| |
Sbjct: 477 ggtgatcagccgggagttgcccacgaccgcgtcgatctctgcctgtgccttcttcagcgc 418
Query: 807 atcggggtggcttagcagcagcgacatcgcccattc 842
|| |||||| | || || |||||||| ||||||||
Sbjct: 417 ctccgggtggttcagaagaagcgacatggcccattc 382
>gb|BE125962.1|BE125962 DG1_60_C08.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 268
Score = 77.8 bits (39), Expect = 2e-012
Identities = 48/51 (94%)
Strand = Plus / Minus
Query: 895 gccatgatcatggtatccgtgtacacctccggttctgacttctgcagtgag 945
||||||||||||||||||||||||| |||||| ||||||||||||| ||||
Sbjct: 176 gccatgatcatggtatccgtgtacagctccggctctgacttctgcaatgag 126
>gb|CD222314.1|CD222314 CCC1_21_E10.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_21_E10_A007 3', mRNA sequence
Length = 655
Score = 77.8 bits (39), Expect = 2e-012
Identities = 48/51 (94%)
Strand = Plus / Minus
Query: 895 gccatgatcatggtatccgtgtacacctccggttctgacttctgcagtgag 945
||||||||||||||||||||||||| |||||| ||||||||||||| ||||
Sbjct: 96 gccatgatcatggtatccgtgtacagctccggctctgacttctgcaatgag 46
Score = 56.0 bits (28), Expect = 6e-006
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 680 ccgggtacagccgcagggtctcgctgacgatgcagtggaggtagccgaggcgcggcaggt 739
||||||||| |||||||||||| ||| || ||| || |||||||||||||| |||| ||
Sbjct: 311 ccgggtacatgcgcagggtctcgttgatgacgcactgcaggtagccgaggcggggcacgt 252
Query: 740 cgtcggcgccgagcagccgggagt 763
| || ||| || |||||||||||
Sbjct: 251 cttctgcggtgatcagccgggagt 228
>gb|CW213799.1|CW213799 104_645_11191755_116_37038_008 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11191755, DNA
sequence
Length = 609
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 888 gcacagagccatgatcatggtatccgtgtacacctccggttctgacttctgca 940
|||||| |||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 123 gcacagtgccatgatcatggtgtccgtgtacacgtccggctctgacttctgca 175
>gb|CW239662.1|CW239662 104_698_11217778_148_37424_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11217778, DNA
sequence
Length = 631
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Minus
Query: 888 gcacagagccatgatcatggtatccgtgtacacctccggttctgacttctgca 940
|||||| |||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 528 gcacagtgccatgatcatggtgtccgtgtacacgtccggctctgacttctgca 476
>gb|CW458248.1|CW458248 fsbb001f204h03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f204h03, DNA
sequence
Length = 438
Score = 73.8 bits (37), Expect = 3e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 888 gcacagagccatgatcatggtatccgtgtacacctccggttctgacttctgca 940
|||||| |||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 201 gcacagtgccatgatcatggtgtccgtgtacacgtccggctctgacttctgca 253
>gb|CD424723.1|CD424723 SA1_7_D01.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_7_D01_A002 3', mRNA sequence
Length = 529
Score = 71.9 bits (36), Expect = 1e-010
Identities = 120/148 (81%)
Strand = Plus / Minus
Query: 396 ccagtcgaagcactggatcaacgtccccaggaccagccccagcgtccgcagcgcgagggc 455
|||||||||||| |||| || || ||||||||||||||||| || |||| ||||||
Sbjct: 169 ccagtcgaagcattggagcagcgcccccaggaccagccccatggttcgcatcgcgagatt 110
Query: 456 ctctccggggcatttccgccttcccatcccgaacggcatcacgaacagcccgtcggcacg 515
||| |||||||| | ||||| |||||||| || ||||||| ||| ||| || || |
Sbjct: 109 ctcaccggggcacctgcgcctccccatcccaaatggcatcataaacttcccctctgctct 50
Query: 516 gccgtcctcgaaccgctccggcctgaac 543
||||| |||||||| |||||||||||||
Sbjct: 49 gccgtgctcgaacctctccggcctgaac 22
>gb|CW239661.1|CW239661 104_698_11217778_116_37423_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11217778, DNA
sequence
Length = 583
Score = 69.9 bits (35), Expect = 4e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 890 acagagccatgatcatggtatccgtgtacacctccggttctgacttctgca 940
|||| |||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 309 acagtgccatgatcatggtgtccgtgtacacgtccggctctgacttctgca 359
>gb|CW051043.1|CW051043 104_291_10515016_115_30196 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515016, DNA
sequence
Length = 202
Score = 65.9 bits (33), Expect = 6e-009
Identities = 81/97 (83%)
Strand = Plus / Minus
Query: 566 cggggtccctgtggatggcgtacacgttgacgaggagcatcgtcccgctcggcacacggt 625
||||||||||||||| |||| |||||| || || |||||||| |||| ||||| ||
Sbjct: 110 cggggtccctgtggaccgcgtgcacgttcaccagcagcatcgtgccgcggggcacgtcgt 51
Query: 626 ggccgccgaccgtgcagtcggcggtggactcgtgcgg 662
|||||||||| ||||||| |||| ||||||||||||
Sbjct: 50 agccgccgaccttgcagtctgcggaggactcgtgcgg 14
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 256,006
Number of Sequences: 832831
Number of extensions: 256006
Number of successful extensions: 74036
Number of sequences better than 0.5: 114
Number of HSP's better than 0.5 without gapping: 114
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73794
Number of HSP's gapped (non-prelim): 198
length of query: 945
length of database: 491,359,669
effective HSP length: 20
effective length of query: 925
effective length of database: 474,703,049
effective search space: 439100320325
effective search space used: 439100320325
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)