BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2921718.2.1
(649 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CD219527.1|CD219527 CCC1_57_C08.b1_A007 Callus culture/c... 551 e-155
gb|CX616870.1|CX616870 GABR1_30_H12.b1_A002 GA- or brassino... 551 e-155
gb|CD424085.1|CD424085 SA1_3_E09.b1_A002 Salicylic acid-tre... 541 e-152
gb|CD210669.1|CD210669 HS1_49_C03.b1_A012 Heat-shocked seed... 517 e-145
gb|CD221819.1|CD221819 CCC1_71_E09.b1_A007 Callus culture/c... 486 e-135
gb|CW379734.1|CW379734 fsbb001f059c14f0 Sorghum methylation... 74 2e-011
gb|CW448133.1|CW448133 fsbb001f181j18f0 Sorghum methylation... 74 2e-011
gb|BG049329.1|BG049329 OV1_18_E11.g1_A002 Ovary 1 (OV1) Sor... 74 2e-011
gb|BI075102.1|BI075102 IP1_19_G10.g1_A002 Immature pannicle... 74 2e-011
gb|BM328918.1|BM328918 PIC1_31_C01.g1_A002 Pathogen-infecte... 74 2e-011
gb|CN135824.1|CN135824 OX1_39_D11.b1_A002 Oxidatively-stres... 74 2e-011
gb|BM328644.1|BM328644 PIC1_24_G06.g1_A002 Pathogen-infecte... 66 4e-009
gb|BM328738.1|BM328738 PIC1_26_A02.g1_A002 Pathogen-infecte... 54 2e-005
gb|BZ332218.1|BZ332218 hx26b07.g1 WGS-SbicolorF (JM107 adap... 52 6e-005
gb|CW242793.1|CW242793 104_702_11219534_116_37562_053 Sorgh... 52 6e-005
gb|CW265724.1|CW265724 104_735_11232038_116_35272_061 Sorgh... 52 6e-005
gb|CW265725.1|CW265725 104_735_11232038_148_35268_061 Sorgh... 52 6e-005
gb|CW476185.1|CW476185 fsbb001f232o20f0 Sorghum methylation... 52 6e-005
gb|CW476186.1|CW476186 fsbb001f232o20k0 Sorghum methylation... 52 6e-005
gb|CW099507.1|CW099507 104_466_11003587_148_34376_072 Sorgh... 50 3e-004
gb|CW305089.1|CW305089 104_790_11466133_116_37439_059 Sorgh... 50 3e-004
gb|CW140160.1|CW140160 104_530_11135636_116_34913_070 Sorgh... 48 0.001
gb|CW140161.1|CW140161 104_530_11135636_148_34917_070 Sorgh... 48 0.001
gb|CW787911.1|CW787911 SP__Ba0039O18.f SP__Ba Sorghum propi... 48 0.001
gb|BZ345198.1|BZ345198 hr47b01.b1 WGS-SbicolorF (JM107 adap... 46 0.004
gb|CL154627.1|CL154627 104_340_10781550_114_31469_030 Sorgh... 46 0.004
gb|CW053125.1|CW053125 104_293_10515788_114_30185 Sorghum m... 46 0.004
gb|CW053335.1|CW053335 104_293_10515906_114_30185 Sorghum m... 46 0.004
gb|CW213394.1|CW213394 104_644_11191518_148_37032_017 Sorgh... 46 0.004
gb|CW222516.1|CW222516 104_658_11202416_116_37184_032 Sorgh... 46 0.004
gb|CW222517.1|CW222517 104_658_11202416_148_37183_032 Sorgh... 46 0.004
gb|CW224266.1|CW224266 104_660_11203357_116_37193_055 Sorgh... 46 0.004
gb|CW225652.1|CW225652 104_663_11204470_116_37210_089 Sorgh... 46 0.004
gb|CW248300.1|CW248300 104_709_11222225_148_35025_069 Sorgh... 46 0.004
gb|CW269139.1|CW269139 104_740_11401699_148_35314_076 Sorgh... 46 0.004
gb|CW294121.1|CW294121 104_774_11415021_116_35773_081 Sorgh... 46 0.004
gb|CW294122.1|CW294122 104_774_11415021_148_35772_081 Sorgh... 46 0.004
gb|CW344600.1|CW344600 104_847_11488040_116_36200_026 Sorgh... 46 0.004
gb|CW344601.1|CW344601 104_847_11488040_148_36199_026 Sorgh... 46 0.004
gb|CW348342.1|CW348342 fsbb001f008k22f0 Sorghum methylation... 46 0.004
gb|CW412343.1|CW412343 fsbb001f107p03k0 Sorghum methylation... 46 0.004
gb|CW492473.1|CW492473 fsbb001f282m08f0 Sorghum methylation... 46 0.004
gb|CW500793.1|CW500793 fsbb001f296e14f0 Sorghum methylation... 46 0.004
gb|BZ333902.1|BZ333902 hx75a05.b1 WGS-SbicolorF (JM107 adap... 44 0.016
gb|CW027407.1|CW027407 104_254_10498496_116_30396 Sorghum m... 44 0.016
gb|CW046207.1|CW046207 104_283_10510041_115_30139 Sorghum m... 44 0.016
gb|CW124713.1|CW124713 104_504_11111934_148_34704_021 Sorgh... 44 0.016
gb|CW144951.1|CW144951 104_537_11138211_116_34972_010 Sorgh... 44 0.016
gb|CW144952.1|CW144952 104_537_11138211_148_34968_010 Sorgh... 44 0.016
gb|CW172187.1|CW172187 104_583_11156148_148_36539_044 Sorgh... 44 0.016
gb|CW244742.1|CW244742 104_705_11220777_116_37585_033 Sorgh... 44 0.016
gb|CW244743.1|CW244743 104_705_11220777_148_37586_033 Sorgh... 44 0.016
gb|CW262838.1|CW262838 104_730_11230302_116_35227_021 Sorgh... 44 0.016
gb|CW304410.1|CW304410 104_789_11465768_116_35702_026 Sorgh... 44 0.016
gb|CW358887.1|CW358887 fsbb001f026e10f0 Sorghum methylation... 44 0.016
gb|CW375182.1|CW375182 fsbb001f052h01f0 Sorghum methylation... 44 0.016
gb|CW375183.1|CW375183 fsbb001f052h01k0 Sorghum methylation... 44 0.016
gb|CW414949.1|CW414949 fsbb001f114n10k0 Sorghum methylation... 44 0.016
gb|CW461849.1|CW461849 fsbb001f209l09k0 Sorghum methylation... 44 0.016
gb|CW473115.1|CW473115 fsbb001f228f20f0 Sorghum methylation... 44 0.016
gb|CW473116.1|CW473116 fsbb001f228f20k0 Sorghum methylation... 44 0.016
gb|CW493804.1|CW493804 fsbb001f284m05k0 Sorghum methylation... 44 0.016
gb|AW282841.2|AW282841 LG1_305_F08.g1_A002 Light Grown 1 (L... 44 0.016
gb|AW287566.2|AW287566 LG1_242_F09.b1_A002 Light Grown 1 (L... 44 0.016
gb|BZ780476.1|BZ780476 ii13f12.b1 WGS-SbicolorF (DH5a methy... 42 0.063
gb|BZ696339.1|BZ696339 SP__Ba0077N02.f SP__Ba Sorghum propi... 42 0.063
gb|CL149332.1|CL149332 104_330_10777761_114_31353_081 Sorgh... 42 0.063
gb|CL151049.1|CL151049 104_333_10778965_114_31359_133 Sorgh... 42 0.063
gb|CL155260.1|CL155260 104_341_10782002_116_31472_098 Sorgh... 42 0.063
gb|CL158036.1|CL158036 104_346_10803256_116_31376_232 Sorgh... 42 0.063
gb|CL162091.1|CL162091 104_354_10806172_114_31830_076 Sorgh... 42 0.063
gb|CL162092.1|CL162092 104_354_10806172_116_31831_076 Sorgh... 42 0.063
gb|CL178796.1|CL178796 104_387_10894839_116_31906_135 Sorgh... 42 0.063
gb|CL181794.1|CL181794 104_392_10896981_148_31925_357 Sorgh... 42 0.063
gb|CL189616.1|CL189616 104_407_10905493_116_32481_063 Sorgh... 42 0.063
gb|CL189644.1|CL189644 104_407_10905514_114_32476_045 Sorgh... 42 0.063
gb|CL189645.1|CL189645 104_407_10905514_116_32480_045 Sorgh... 42 0.063
gb|CW021193.1|CW021193 104_109_10409403_114_30491 Sorghum m... 42 0.063
gb|CW026875.1|CW026875 104_253_10498195_116_30529 Sorghum m... 42 0.063
gb|CW036973.1|CW036973 104_268_10504072_114_30381 Sorghum m... 42 0.063
gb|CW062790.1|CW062790 104_308_10521536_1_30092 Sorghum met... 42 0.063
gb|CW063171.1|CW063171 104_308_10521757_1_30092 Sorghum met... 42 0.063
gb|CW072557.1|CW072557 104_325_10592334_116_30542 Sorghum m... 42 0.063
gb|CW104116.1|CW104116 104_473_11012256_148_34441_096 Sorgh... 42 0.063
gb|CW111747.1|CW111747 104_485_11104498_116_34540_043 Sorgh... 42 0.063
gb|CW130204.1|CW130204 104_512_11114983_116_34768_022 Sorgh... 42 0.063
gb|CW159486.1|CW159486 104_565_11149383_116_36407_054 Sorgh... 42 0.063
gb|CW162848.1|CW162848 104_570_11151151_148_36450_028 Sorgh... 42 0.063
gb|CW164186.1|CW164186 104_572_11151853_148_36462_061 Sorgh... 42 0.063
gb|CW165718.1|CW165718 104_574_11152659_116_36484_012 Sorgh... 42 0.063
gb|CW173282.1|CW173282 104_584_11156759_148_36542_082 Sorgh... 42 0.063
gb|CW175284.1|CW175284 104_587_11157856_116_36569_052 Sorgh... 42 0.063
gb|CW176693.1|CW176693 104_589_11158624_148_36680_052 Sorgh... 42 0.063
gb|CW177129.1|CW177129 104_590_11158858_116_36593_041 Sorgh... 42 0.063
gb|CW180277.1|CW180277 104_594_11160551_148_36634_084 Sorgh... 42 0.063
gb|CW183262.1|CW183262 104_599_11164518_116_36674_029 Sorgh... 42 0.063
gb|CW192986.1|CW192986 104_615_11179321_148_36774_005 Sorgh... 42 0.063
gb|CW199203.1|CW199203 104_624_11183386_148_36851_043 Sorgh... 42 0.063
gb|CW208588.1|CW208588 104_638_11188750_116_36984_093 Sorgh... 42 0.063
gb|CW222869.1|CW222869 104_658_11202605_116_37181_023 Sorgh... 42 0.063
gb|CW243148.1|CW243148 104_703_11219768_148_37569_028 Sorgh... 42 0.063
gb|CW254066.1|CW254066 104_718_11225454_116_35121_031 Sorgh... 42 0.063
gb|CW254067.1|CW254067 104_718_11225454_148_35117_031 Sorgh... 42 0.063
gb|CW296313.1|CW296313 104_778_11461437_116_35630_095 Sorgh... 42 0.063
gb|CW298225.1|CW298225 104_780_11462469_116_35646_083 Sorgh... 42 0.063
gb|CW298226.1|CW298226 104_780_11462469_148_35650_083 Sorgh... 42 0.063
gb|CW301675.1|CW301675 104_785_11464325_116_36261_021 Sorgh... 42 0.063
gb|CW301676.1|CW301676 104_785_11464325_148_36262_021 Sorgh... 42 0.063
gb|CW327360.1|CW327360 104_823_11478704_116_35982_032 Sorgh... 42 0.063
gb|CW332929.1|CW332929 104_830_11481672_116_36037_084 Sorgh... 42 0.063
gb|CW332930.1|CW332930 104_830_11481672_148_36038_084 Sorgh... 42 0.063
gb|CW352451.1|CW352451 fsbb001f014l19f0 Sorghum methylation... 42 0.063
gb|CW356558.1|CW356558 fsbb001f021l10f0 Sorghum methylation... 42 0.063
gb|CW356559.1|CW356559 fsbb001f021l10k0 Sorghum methylation... 42 0.063
gb|CW376656.1|CW376656 fsbb001f054k05k0 Sorghum methylation... 42 0.063
gb|CW385388.1|CW385388 fsbb001f068n14f0 Sorghum methylation... 42 0.063
gb|CW387241.1|CW387241 fsbb001f071h24k0 Sorghum methylation... 42 0.063
gb|CW396338.1|CW396338 fsbb001f084l20k0 Sorghum methylation... 42 0.063
gb|CW429707.1|CW429707 fsbb001f143b15f0 Sorghum methylation... 42 0.063
gb|CW435020.1|CW435020 fsbb001f150p17k0 Sorghum methylation... 42 0.063
gb|CW436270.1|CW436270 fsbb001f152m21f0 Sorghum methylation... 42 0.063
gb|CW436412.1|CW436412 fsbb001f153a03k0 Sorghum methylation... 42 0.063
gb|CW449438.1|CW449438 fsbb001f183j10k0 Sorghum methylation... 42 0.063
gb|CW465385.1|CW465385 fsbb001f216c05f0 Sorghum methylation... 42 0.063
gb|CW465386.1|CW465386 fsbb001f216c05k0 Sorghum methylation... 42 0.063
gb|CW472634.1|CW472634 fsbb001f227k17k0 Sorghum methylation... 42 0.063
gb|CW473335.1|CW473335 fsbb001f228k16k0 Sorghum methylation... 42 0.063
gb|CW482893.1|CW482893 fsbb001f244d15f0 Sorghum methylation... 42 0.063
gb|CW500794.1|CW500794 fsbb001f296e14k0 Sorghum methylation... 42 0.063
gb|CW500811.1|CW500811 fsbb001f296f01f0 Sorghum methylation... 42 0.063
gb|CW791258.1|CW791258 SP__Ba0077N02.f SP__Ba Sorghum propi... 42 0.063
gb|BE358802.1|BE358802 DG1_32_H08.b1_A002 Dark Grown 1 (DG1... 42 0.063
gb|BG558829.1|BG558829 RHIZ2_57_B09.b1_A003 Rhizome2 (RHIZ2... 42 0.063
gb|AF488412.1| Sorghum bicolor BAC 131L1, complete sequence 42 0.063
gb|AY761592.1| Sorghum bicolor clone 152702 unknown sequence 42 0.063
gb|AY761609.1| Sorghum bicolor clone 51836 unknown sequence 42 0.063
gb|AY761621.1| Sorghum bicolor clone RTx430 unknown sequence 42 0.063
gb|AC169370.3| Sorghum bicolor clone SB_BBc0011I20, WORKING... 42 0.063
gb|BZ336964.1|BZ336964 ia84d01.g1 WGS-SbicolorF (JM107 adap... 40 0.25
gb|CL153681.1|CL153681 104_338_10780888_116_31370_136 Sorgh... 40 0.25
gb|CL158027.1|CL158027 104_346_10803249_114_31375_225 Sorgh... 40 0.25
gb|CL160672.1|CL160672 104_351_10805150_114_31824_206 Sorgh... 40 0.25
gb|CL165644.1|CL165644 104_361_10808788_116_31821_004 Sorgh... 40 0.25
gb|CL175909.1|CL175909 104_381_10892775_116_31765_375 Sorgh... 40 0.25
gb|CL179886.1|CL179886 104_389_10895616_148_31907_144 Sorgh... 40 0.25
gb|CL185063.1|CL185063 104_398_10899270_116_32371_017 Sorgh... 40 0.25
gb|CW035043.1|CW035043 104_265_10502910_115_30379 Sorghum m... 40 0.25
gb|CW046206.1|CW046206 104_283_10510041_114_30137 Sorghum m... 40 0.25
gb|CW064397.1|CW064397 104_310_10522545_114_30141 Sorghum m... 40 0.25
gb|CW065496.1|CW065496 104_312_10523181_114_30128 Sorghum m... 40 0.25
gb|CW094237.1|CW094237 104_457_11000199_148_37478_054 Sorgh... 40 0.25
gb|CW104672.1|CW104672 104_473_11012555_148_34438_034 Sorgh... 40 0.25
gb|CW129367.1|CW129367 104_511_11114528_148_34763_026 Sorgh... 40 0.25
gb|CW142078.1|CW142078 104_533_11136655_116_34938_028 Sorgh... 40 0.25
gb|CW179419.1|CW179419 104_593_11160089_148_36629_071 Sorgh... 40 0.25
gb|CW189913.1|CW189913 104_611_11174218_148_36747_041 Sorgh... 40 0.25
gb|CW191870.1|CW191870 104_614_11178726_116_36946_029 Sorgh... 40 0.25
gb|CW191871.1|CW191871 104_614_11178726_148_36945_029 Sorgh... 40 0.25
gb|CW202009.1|CW202009 104_628_11184867_148_37084_014 Sorgh... 40 0.25
gb|CW212859.1|CW212859 104_644_11191246_116_37033_093 Sorgh... 40 0.25
gb|CW214648.1|CW214648 104_646_11194125_116_37050_085 Sorgh... 40 0.25
gb|CW218279.1|CW218279 104_651_11196106_116_37067_033 Sorgh... 40 0.25
gb|CW218280.1|CW218280 104_651_11196106_116_37459_033 Sorgh... 40 0.25
gb|CW218281.1|CW218281 104_651_11196106_148_37066_033 Sorgh... 40 0.25
gb|CW218282.1|CW218282 104_651_11196106_148_37458_033 Sorgh... 40 0.25
gb|CW257939.1|CW257939 104_723_11227606_116_35159_085 Sorgh... 40 0.25
gb|CW258909.1|CW258909 104_725_11228133_116_35182_095 Sorgh... 40 0.25
gb|CW272507.1|CW272507 104_744_11403449_148_36226_067 Sorgh... 40 0.25
gb|CW285192.1|CW285192 104_762_11410202_116_35504_009 Sorgh... 40 0.25
gb|CW285193.1|CW285193 104_762_11410202_148_35500_009 Sorgh... 40 0.25
gb|CW321004.1|CW321004 104_814_11475314_116_35933_011 Sorgh... 40 0.25
gb|CW321005.1|CW321005 104_814_11475314_148_35937_011 Sorgh... 40 0.25
gb|CW331543.1|CW331543 104_828_11480956_116_36026_002 Sorgh... 40 0.25
gb|CW331544.1|CW331544 104_828_11480956_148_36025_002 Sorgh... 40 0.25
gb|CW333227.1|CW333227 104_831_11481828_116_36045_046 Sorgh... 40 0.25
gb|CW333228.1|CW333228 104_831_11481828_148_36046_046 Sorgh... 40 0.25
gb|CW339716.1|CW339716 104_840_11485416_116_36141_088 Sorgh... 40 0.25
gb|CW340224.1|CW340224 104_841_11485685_116_36146_027 Sorgh... 40 0.25
gb|CW345628.1|CW345628 104_848_11488596_116_36212_036 Sorgh... 40 0.25
gb|CW345629.1|CW345629 104_848_11488596_148_36211_036 Sorgh... 40 0.25
gb|CW355248.1|CW355248 fsbb001f019m21f0 Sorghum methylation... 40 0.25
gb|CW355249.1|CW355249 fsbb001f019m21k0 Sorghum methylation... 40 0.25
gb|CW397203.1|CW397203 fsbb001f085p21k0 Sorghum methylation... 40 0.25
gb|CW405751.1|CW405751 fsbb001f098h05k0 Sorghum methylation... 40 0.25
gb|CW410911.1|CW410911 fsbb001f105n19f0 Sorghum methylation... 40 0.25
gb|CW440697.1|CW440697 fsbb001f159h13f0 Sorghum methylation... 40 0.25
gb|CW444733.1|CW444733 fsbb001f166h20k0 Sorghum methylation... 40 0.25
gb|CW446943.1|CW446943 fsbb001f179n08f0 Sorghum methylation... 40 0.25
gb|CW457134.1|CW457134 fsbb001f202m24k0 Sorghum methylation... 40 0.25
gb|CW463105.1|CW463105 fsbb001f211i17k0 Sorghum methylation... 40 0.25
gb|CW465016.1|CW465016 fsbb001f215j04k0 Sorghum methylation... 40 0.25
gb|CW467609.1|CW467609 fsbb001f219f24k0 Sorghum methylation... 40 0.25
gb|CW486693.1|CW486693 fsbb001f252b24k0 Sorghum methylation... 40 0.25
gb|CW496926.1|CW496926 fsbb001f289g16f0 Sorghum methylation... 40 0.25
gb|CL701717.2|CL701717 SP__Ba0076G02.f SP__Ba Sorghum propi... 40 0.25
gb|CL702813.2|CL702813 SP__Ba0089E13.f SP__Ba Sorghum propi... 40 0.25
gb|BG411512.1|BG411512 EM1_59_H06.g1_A002 Embryo 1 (EM1) So... 40 0.25
gb|CD206163.1|CD206163 HS1_21_F04.b1_A012 Heat-shocked seed... 40 0.25
gb|CD208470.1|CD208470 HS1_38_A04.b1_A012 Heat-shocked seed... 40 0.25
gb|CX608373.1|CX608373 ANR1_38_F05.b1_A002 Anaerobic roots ... 40 0.25
gb|CX611051.1|CX611051 ANR1_22_H01.b1_A002 Anaerobic roots ... 40 0.25
>gb|CD219527.1|CD219527 CCC1_57_C08.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_57_C08_A007 3', mRNA sequence
Length = 630
Score = 551 bits (278), Expect = e-155
Identities = 384/419 (91%), Gaps = 9/419 (2%)
Strand = Plus / Plus
Query: 14 gccaggctcgcgtcgggcgcgcacgtcctgggcaacgtgctggtgcacgagaccgcggtc 73
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 36 gccaggctcgcgtcgggcgcgcacgtcctgggcaacgtgctggtgcacgagacggccgtc 95
Query: 74 atcggggacggctgcctcatcgggcccgacgtcgcggtcgggccaggctgcgtggtggag 133
|||||||| || |||||||||||||||||||| || ||||| || || ||||| ||||||
Sbjct: 96 atcggggaaggatgcctcatcgggcccgacgttgctgtcggccccgggtgcgtagtggag 155
Query: 134 gccggggtgcgcctgtcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcc 193
||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||
Sbjct: 156 gccggggtgcggctgtcccgctgcaccgtcatgcgcggcgcgcgcgtgaagcagcacgcc 215
Query: 194 tgcgtctccagcagcatcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgag 253
||||||||||||||||||||||| |||||||||||||| || |||||||| ||||| |||
Sbjct: 216 tgcgtctccagcagcatcatcggatggcactccaccgttggaaagtgggcacgcgtggag 275
Query: 254 aacatgaccatcctcggcgaggacgtccacgtctgcgacgagatctacagcaacggcggc 313
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 276 aacatgaccatccttggggaggacgtgcacgtctgcgacgagatctacagcaacggcggc 335
Query: 314 gtcgtgctcccgcacaaggagatcaaatccagcatcctcaagcccgagatcgtcatgt-- 371
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 336 gtcgtgctcccgcacaaggagatcaagtccagcatcctcaagcccgagatcgtcatgtga 395
Query: 372 --gatccgggagtaaatct-----ggggcgccaaatccaaatcacaaggggcccttgca 423
||||| |||| |||||| |||||||||||||||||| ||||||| ||||||||
Sbjct: 396 tggatccaggaggaaatctgggtgggggcgccaaatccaaattacaagggccccttgca 454
Score = 85.7 bits (43), Expect = 5e-015
Identities = 57/61 (93%), Gaps = 3/61 (4%)
Strand = Plus / Plus
Query: 467 tgcttcatacttttgttgtttgattttttgctcggttgt---ttgtctgcaagtgtaacc 523
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 468 tgcttcatacttttgttgtttgattttttgctcggttgtctcttgtctgcaactgtaacc 527
Query: 524 a 524
|
Sbjct: 528 a 528
>gb|CX616870.1|CX616870 GABR1_30_H12.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_30_H12_A002 3', mRNA sequence
Length = 771
Score = 551 bits (278), Expect = e-155
Identities = 384/419 (91%), Gaps = 9/419 (2%)
Strand = Plus / Plus
Query: 14 gccaggctcgcgtcgggcgcgcacgtcctgggcaacgtgctggtgcacgagaccgcggtc 73
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 176 gccaggctcgcgtcgggcgcgcacgtcctgggcaacgtgctggtgcacgagacggccgtc 235
Query: 74 atcggggacggctgcctcatcgggcccgacgtcgcggtcgggccaggctgcgtggtggag 133
|||||||| || |||||||||||||||||||| || ||||| || || ||||| ||||||
Sbjct: 236 atcggggaaggatgcctcatcgggcccgacgttgctgtcggccccgggtgcgtagtggag 295
Query: 134 gccggggtgcgcctgtcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcc 193
||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||
Sbjct: 296 gccggggtgcggctgtcccgctgcaccgtcatgcgcggcgcgcgcgtgaagcagcacgcc 355
Query: 194 tgcgtctccagcagcatcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgag 253
||||||||||||||||||||||| |||||||||||||| || |||||||| ||||| |||
Sbjct: 356 tgcgtctccagcagcatcatcggatggcactccaccgttggaaagtgggcacgcgtggag 415
Query: 254 aacatgaccatcctcggcgaggacgtccacgtctgcgacgagatctacagcaacggcggc 313
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 416 aacatgaccatccttggggaggacgtgcacgtctgcgacgagatctacagcaacggcggc 475
Query: 314 gtcgtgctcccgcacaaggagatcaaatccagcatcctcaagcccgagatcgtcatgt-- 371
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 476 gtcgtgctcccgcacaaggagatcaagtccagcatcctcaagcccgagatcgtcatgtga 535
Query: 372 --gatccgggagtaaatct-----ggggcgccaaatccaaatcacaaggggcccttgca 423
||||| |||| |||||| |||||||||||||||||| ||||||| ||||||||
Sbjct: 536 tggatccaggaggaaatctgggtgggggcgccaaatccaaattacaagggccccttgca 594
Score = 85.7 bits (43), Expect = 5e-015
Identities = 57/61 (93%), Gaps = 3/61 (4%)
Strand = Plus / Plus
Query: 467 tgcttcatacttttgttgtttgattttttgctcggttgt---ttgtctgcaagtgtaacc 523
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 608 tgcttcatacttttgttgtttgattttttgctcggttgtctcttgtctgcaactgtaacc 667
Query: 524 a 524
|
Sbjct: 668 a 668
>gb|CD424085.1|CD424085 SA1_3_E09.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_3_E09_A002 3', mRNA sequence
Length = 634
Score = 541 bits (273), Expect = e-152
Identities = 339/361 (93%)
Strand = Plus / Plus
Query: 14 gccaggctcgcgtcgggcgcgcacgtcctgggcaacgtgctggtgcacgagaccgcggtc 73
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 30 gccaggctcgcgtcgggcgcgcacgtcctgggcaacgtgctggtgcacgagacggccgtc 89
Query: 74 atcggggacggctgcctcatcgggcccgacgtcgcggtcgggccaggctgcgtggtggag 133
|||||||| || |||||||||||||||||||| || ||||| || || ||||| ||||||
Sbjct: 90 atcggggaaggatgcctcatcgggcccgacgttgctgtcggccccgggtgcgtagtggag 149
Query: 134 gccggggtgcgcctgtcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcc 193
||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||
Sbjct: 150 gccggggtgcggctgtcccgctgcaccgtcatgcgcggcgcgcgcgtgaagcagcacgcc 209
Query: 194 tgcgtctccagcagcatcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgag 253
||||||||||||||||||||||| |||||||||||||| || |||||||| ||||| |||
Sbjct: 210 tgcgtctccagcagcatcatcggatggcactccaccgttggaaagtgggcacgcgtggag 269
Query: 254 aacatgaccatcctcggcgaggacgtccacgtctgcgacgagatctacagcaacggcggc 313
|||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 270 aacatgaccatccttggggaggacgtgcacgtctgcgacgagatctacagcaacggcggc 329
Query: 314 gtcgtgctcccgcacaaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 330 gtcgtgctcccgcacaaggagatcaagtccagcatcctcaagcccgagatcgtcatgtga 389
Query: 374 t 374
|
Sbjct: 390 t 390
Score = 85.7 bits (43), Expect = 5e-015
Identities = 57/61 (93%), Gaps = 3/61 (4%)
Strand = Plus / Plus
Query: 467 tgcttcatacttttgttgtttgattttttgctcggttgt---ttgtctgcaagtgtaacc 523
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 461 tgcttcatacttttgttgtttgattttttgctcggttgtctcttgtctgcaactgtaacc 520
Query: 524 a 524
|
Sbjct: 521 a 521
>gb|CD210669.1|CD210669 HS1_49_C03.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_49_C03_A012 3', mRNA sequence
Length = 589
Score = 517 bits (261), Expect = e-145
Identities = 370/406 (91%), Gaps = 9/406 (2%)
Strand = Plus / Plus
Query: 27 cgggcgcgcacgtcctgggcaacgtgctggtgcacgagaccgcggtcatcggggacggct 86
|||||||||||||||||||||||||||||||||||||||| || ||||||||||| || |
Sbjct: 1 cgggcgcgcacgtcctgggcaacgtgctggtgcacgagacggccgtcatcggggaaggat 60
Query: 87 gcctcatcgggcccgacgtcgcggtcgggccaggctgcgtggtggaggccggggtgcgcc 146
||||||||||||||||||| || ||||| || || ||||| ||||||||||||||||| |
Sbjct: 61 gcctcatcgggcccgacgttgctgtcggccccgggtgcgtagtggaggccggggtgcggc 120
Query: 147 tgtcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagca 206
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 121 tgtcccgctgcaccgtcatgcgcggcgcgcgcgtgaagcagcacgcctgcgtctccagca 180
Query: 207 gcatcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcc 266
|||||||||| |||||||||||||| || |||||||| ||||| ||||||||||||||||
Sbjct: 181 gcatcatcggatggcactccaccgttggaaagtgggcacgcgtggagaacatgaccatcc 240
Query: 267 tcggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgc 326
| || |||||||| |||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 241 ttggggaggacgtgcacgtctgtgacgagatctacagcaacggcggcgtcgtgctcccgc 300
Query: 327 acaaggagatcaaatccagcatcctcaagcccgagatcgtcatgt----gatccgggagt 382
||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 301 acaaggagatcaagtccagcatcctcaagcccgagatcgtcatgtgatggatccaggagg 360
Query: 383 aaatct-----ggggcgccaaatccaaatcacaaggggcccttgca 423
|||||| |||||||||||||||||| ||||||| ||||||||
Sbjct: 361 aaatctgggtgggggcgccaaatccaaattacaagggccccttgca 406
Score = 85.7 bits (43), Expect = 5e-015
Identities = 57/61 (93%), Gaps = 3/61 (4%)
Strand = Plus / Plus
Query: 467 tgcttcatacttttgttgtttgattttttgctcggttgt---ttgtctgcaagtgtaacc 523
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 420 tgcttcatacttttgttgtttgattttttgctcggttgtctcttgtctgcaactgtaacc 479
Query: 524 a 524
|
Sbjct: 480 a 480
>gb|CD221819.1|CD221819 CCC1_71_E09.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_71_E09_A007 3', mRNA sequence
Length = 604
Score = 486 bits (245), Expect = e-135
Identities = 354/390 (90%), Gaps = 9/390 (2%)
Strand = Plus / Plus
Query: 43 gggcaacgtgctggtgcacgagaccgcggtcatcggggacggctgcctcatcgggcccga 102
|||||||||||||||||||||||| | ||||||||||| || |||||||||||||||||
Sbjct: 1 gggcaacgtgctggtgcacgagacgcccgtcatcggggaaggatgcctcatcgggcccga 60
Query: 103 cgtcgcggtcgggccaggctgcgtggtggaggccggggtgcgcctgtcccgctgcaccgt 162
||| || ||||| || || ||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 61 cgttgctgtcggccccgggtgcgtagtggaggccggggtgcggctgtcccgctgcaccgt 120
Query: 163 catgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagcatcatcggctggca 222
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 121 catgcgcggcgcgcgcgtgaagcagcacgcctgcgtctccagcagcatcatcggatggca 180
Query: 223 ctccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctcggcgaggacgtcca 282
||||||||| || |||||||| ||||| ||||||||||||||||| || |||||||| ||
Sbjct: 181 ctccaccgttggaaagtgggcacgcgtggagaacatgaccatccttggggaggacgtgca 240
Query: 283 cgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcacaaggagatcaaatc 342
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 241 cgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcacaaggagatcaagtc 300
Query: 343 cagcatcctcaagcccgagatcgtcatgt----gatccgggagtaaatct-----ggggc 393
||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 301 cagcatcctcaagcccgagatcgtcatgtgatggatccaggaggaaatctgggtgggggc 360
Query: 394 gccaaatccaaatcacaaggggcccttgca 423
||||||||||||| ||||||| ||||||||
Sbjct: 361 gccaaatccaaattacaagggccccttgca 390
Score = 85.7 bits (43), Expect = 5e-015
Identities = 57/61 (93%), Gaps = 3/61 (4%)
Strand = Plus / Plus
Query: 467 tgcttcatacttttgttgtttgattttttgctcggttgt---ttgtctgcaagtgtaacc 523
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 404 tgcttcatacttttgttgtttgattttttgctcggttgtctcttgtctgcaactgtaacc 463
Query: 524 a 524
|
Sbjct: 464 a 464
>gb|CW379734.1|CW379734 fsbb001f059c14f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f059c14, DNA
sequence
Length = 722
Score = 73.8 bits (37), Expect = 2e-011
Identities = 178/225 (79%)
Strand = Plus / Minus
Query: 149 tcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagc 208
||||||||||| |||||||| | | |||| ||||| |||| || ||| |||| | ||||
Sbjct: 460 tcccgctgcactgtcatgcgtggtgtgcgcatcaagaagcatgcttgcatctcaaacagc 401
Query: 209 atcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctc 268
|| ||||| |||||||| || || || || ||||| || | ||||| ||||| |||||
Sbjct: 400 attatcgggtggcactcaactgttggaaaatgggcacggatagagaatatgactatcctg 341
Query: 269 ggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcac 328
|| ||||| || || || || || ||| | |||||||| ||||| || || ||||| ||
Sbjct: 340 ggggaggatgttcatgtgtgtgatgaggtatacagcaatggcggtgttgttctcccacat 281
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|| |||||||| || ||||| || ||||| |||||||||||||||
Sbjct: 280 aaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 236
>gb|CW448133.1|CW448133 fsbb001f181j18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f181j18, DNA
sequence
Length = 524
Score = 73.8 bits (37), Expect = 2e-011
Identities = 178/225 (79%)
Strand = Plus / Minus
Query: 149 tcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagc 208
||||||||||| |||||||| | | |||| ||||| |||| || ||| |||| | ||||
Sbjct: 389 tcccgctgcactgtcatgcgtggtgtgcgcatcaagaagcatgcttgcatctcaaacagc 330
Query: 209 atcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctc 268
|| ||||| |||||||| || || || || ||||| || | ||||| ||||| |||||
Sbjct: 329 attatcgggtggcactcaactgttggaaaatgggcacggatagagaatatgactatcctg 270
Query: 269 ggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcac 328
|| ||||| || || || || || ||| | |||||||| ||||| || || ||||| ||
Sbjct: 269 ggggaggatgttcatgtgtgtgatgaggtatacagcaatggcggtgttgttctcccacat 210
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|| |||||||| || ||||| || ||||| |||||||||||||||
Sbjct: 209 aaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 165
>gb|BG049329.1|BG049329 OV1_18_E11.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 694
Score = 73.8 bits (37), Expect = 2e-011
Identities = 178/225 (79%)
Strand = Plus / Plus
Query: 149 tcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagc 208
||||||||||| |||||||| | | |||| ||||| |||| || ||| |||| | ||||
Sbjct: 343 tcccgctgcactgtcatgcgtggtgtgcgcatcaagaagcatgcttgcatctcaaacagc 402
Query: 209 atcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctc 268
|| ||||| |||||||| || || || || ||||| || | ||||| ||||| |||||
Sbjct: 403 attatcgggtggcactcaactgttggaaaatgggcacggatagagaatatgactatcctg 462
Query: 269 ggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcac 328
|| ||||| || || || || || ||| | |||||||| ||||| || || ||||| ||
Sbjct: 463 ggggaggatgttcatgtgtgtgatgaggtatacagcaatggcggtgttgttctcccacat 522
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|| |||||||| || ||||| || ||||| |||||||||||||||
Sbjct: 523 aaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 567
>gb|BI075102.1|BI075102 IP1_19_G10.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 654
Score = 73.8 bits (37), Expect = 2e-011
Identities = 178/225 (79%)
Strand = Plus / Plus
Query: 149 tcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagc 208
||||||||||| |||||||| | | |||| ||||| |||| || ||| |||| | ||||
Sbjct: 261 tcccgctgcactgtcatgcgtggtgtgcgcatcaagaagcatgcttgcatctcaaacagc 320
Query: 209 atcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctc 268
|| ||||| |||||||| || || || || ||||| || | ||||| ||||| |||||
Sbjct: 321 attatcgggtggcactcaactgttggaaaatgggcacggatagagaatatgactatcctg 380
Query: 269 ggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcac 328
|| ||||| || || || || || ||| | |||||||| ||||| || || ||||| ||
Sbjct: 381 ggggaggatgttcatgtgtgtgatgaggtatacagcaatggcggtgttgttctcccacat 440
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|| |||||||| || ||||| || ||||| |||||||||||||||
Sbjct: 441 aaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 485
>gb|BM328918.1|BM328918 PIC1_31_C01.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 584
Score = 73.8 bits (37), Expect = 2e-011
Identities = 178/225 (79%)
Strand = Plus / Plus
Query: 149 tcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagc 208
||||||||||| |||||||| | | |||| ||||| |||| || ||| |||| | ||||
Sbjct: 169 tcccgctgcactgtcatgcgtggtgtgcgcatcaagaagcatgcttgcatctcaaacagc 228
Query: 209 atcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctc 268
|| ||||| |||||||| || || || || ||||| || | ||||| ||||| |||||
Sbjct: 229 attatcgggtggcactcaactgttggaaaatgggcacggatagagaatatgactatcctg 288
Query: 269 ggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcac 328
|| ||||| || || || || || ||| | |||||||| ||||| || || ||||| ||
Sbjct: 289 ggggaggatgttcatgtgtgtgatgaggtatacagcaatggcggtgttgttctcccacat 348
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|| |||||||| || ||||| || ||||| |||||||||||||||
Sbjct: 349 aaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 393
>gb|CN135824.1|CN135824 OX1_39_D11.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_39_D11_A002 3', mRNA sequence
Length = 763
Score = 73.8 bits (37), Expect = 2e-011
Identities = 178/225 (79%)
Strand = Plus / Plus
Query: 149 tcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagc 208
||||||||||| |||||||| | | |||| ||||| |||| || ||| |||| | ||||
Sbjct: 426 tcccgctgcactgtcatgcgtggtgtgcgcatcaagaagcatgcttgcatctcaaacagc 485
Query: 209 atcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctc 268
|| ||||| |||||||| || || || || ||||| || | ||||| ||||| |||||
Sbjct: 486 attatcgggtggcactcaactgttggaaaatgggcacggatagagaatatgactatcctg 545
Query: 269 ggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcac 328
|| ||||| || || || || || ||| | |||||||| ||||| || || ||||| ||
Sbjct: 546 ggggaggatgttcatgtgtgtgatgaggtatacagcaatggcggtgttgttctcccacat 605
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|| |||||||| || ||||| || ||||| |||||||||||||||
Sbjct: 606 aaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 650
>gb|BM328644.1|BM328644 PIC1_24_G06.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 585
Score = 65.9 bits (33), Expect = 4e-009
Identities = 177/225 (78%)
Strand = Plus / Plus
Query: 149 tcccgctgcaccgtcatgcgcgccgcgcgcgtcaagcagcacgcctgcgtctccagcagc 208
||||||||||| |||||||| | | |||| ||||| |||| || ||| |||| | ||||
Sbjct: 167 tcccgctgcactgtcatgcgtggtgtgcgcatcaagaagcatgcttgcatctcaaacagc 226
Query: 209 atcatcggctggcactccaccgtcggcaagtgggcgcgcgtcgagaacatgaccatcctc 268
|| ||||| |||||||| || || || || ||||| || | ||||| ||||| |||||
Sbjct: 227 attatcgggtggcactcaactgttggaaaatgggcacggatagagaatatgactatcctg 286
Query: 269 ggcgaggacgtccacgtctgcgacgagatctacagcaacggcggcgtcgtgctcccgcac 328
|| ||||| || | || || || ||| | |||||||| ||||| || || ||||| ||
Sbjct: 287 ggggaggatgttaatgtgtgtgatgaggtatacagcaatggcggtgttgttctcccacat 346
Query: 329 aaggagatcaaatccagcatcctcaagcccgagatcgtcatgtga 373
|| |||||||| || ||||| || ||||| |||||||||||||||
Sbjct: 347 aaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 391
>gb|BM328738.1|BM328738 PIC1_26_A02.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 575
Score = 54.0 bits (27), Expect = 2e-005
Identities = 63/75 (84%)
Strand = Plus / Plus
Query: 299 tacagcaacggcggcgtcgtgctcccgcacaaggagatcaaatccagcatcctcaagccc 358
|||||||| ||||| || || ||||| || || |||||||| || ||||| || |||||
Sbjct: 61 tacagcaatggcggtgttgttctcccacataaagagatcaagtcaagcattctgaagcct 120
Query: 359 gagatcgtcatgtga 373
|||||||||||||||
Sbjct: 121 gagatcgtcatgtga 135
>gb|BZ332218.1|BZ332218 hx26b07.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hx26b07 5', DNA sequence
Length = 559
Score = 52.0 bits (26), Expect = 6e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||||||||||||||
Sbjct: 131 tgcattgcattgcatcgcatcgcatc 106
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||| ||||||||||
Sbjct: 131 tgcattgcattgcatcgcatcgcatc 106
>gb|CW242793.1|CW242793 104_702_11219534_116_37562_053 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11219534, DNA
sequence
Length = 691
Score = 52.0 bits (26), Expect = 6e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||||||||||||||
Sbjct: 229 tgcattgcattgcatcgcatcgcatc 254
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||| ||||||||||
Sbjct: 229 tgcattgcattgcatcgcatcgcatc 254
>gb|CW265724.1|CW265724 104_735_11232038_116_35272_061 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232038, DNA
sequence
Length = 653
Score = 52.0 bits (26), Expect = 6e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||||||||||||||
Sbjct: 510 tgcattgcattgcatcgcatcgcatc 535
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||| ||||||||||
Sbjct: 510 tgcattgcattgcatcgcatcgcatc 535
>gb|CW265725.1|CW265725 104_735_11232038_148_35268_061 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232038, DNA
sequence
Length = 605
Score = 52.0 bits (26), Expect = 6e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||||||||||||||
Sbjct: 591 tgcattgcattgcatcgcatcgcatc 566
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||| ||||||||||
Sbjct: 591 tgcattgcattgcatcgcatcgcatc 566
>gb|CW476185.1|CW476185 fsbb001f232o20f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f232o20, DNA
sequence
Length = 740
Score = 52.0 bits (26), Expect = 6e-005
Identities = 26/26 (100%)
Strand = Plus / Minus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||||||||||||||
Sbjct: 452 tgcattgcattgcatcgcatcgcatc 427
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||| ||||||||||
Sbjct: 452 tgcattgcattgcatcgcatcgcatc 427
>gb|CW476186.1|CW476186 fsbb001f232o20k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f232o20, DNA
sequence
Length = 733
Score = 52.0 bits (26), Expect = 6e-005
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 425 tgcattgcattgcatcgcatcgcatc 450
||||||||||||||||||||||||||
Sbjct: 411 tgcattgcattgcatcgcatcgcatc 436
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatc 445
||||||||||||||| ||||||||||
Sbjct: 411 tgcattgcattgcatcgcatcgcatc 436
>gb|CW099507.1|CW099507 104_466_11003587_148_34376_072 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11003587, DNA
sequence
Length = 594
Score = 50.1 bits (25), Expect = 3e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcatcc 451
|||||| ||||||||||||||||||| ||||||
Sbjct: 61 ttgcatcgcattgcattgcatcgcattgcatcc 29
>gb|CW305089.1|CW305089 104_790_11466133_116_37439_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11466133, DNA
sequence
Length = 603
Score = 50.1 bits (25), Expect = 3e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcatcc 451
|||||| ||||||||||||||||||| ||||||
Sbjct: 307 ttgcatcgcattgcattgcatcgcattgcatcc 275
>gb|CW140160.1|CW140160 104_530_11135636_116_34913_070 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135636, DNA
sequence
Length = 593
Score = 48.1 bits (24), Expect = 0.001
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 417 ccttgcattgcattgcattgcatcgcat 444
||||||||||||||||| ||||||||||
Sbjct: 272 ccttgcattgcattgcactgcatcgcat 299
>gb|CW140161.1|CW140161 104_530_11135636_148_34917_070 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135636, DNA
sequence
Length = 637
Score = 48.1 bits (24), Expect = 0.001
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 417 ccttgcattgcattgcattgcatcgcat 444
||||||||||||||||| ||||||||||
Sbjct: 423 ccttgcattgcattgcactgcatcgcat 396
>gb|CW787911.1|CW787911 SP__Ba0039O18.f SP__Ba Sorghum propinquum genomic clone
SP__Ba0039O18 5', DNA sequence
Length = 735
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatcgc 442
||||||||||||||||||||||||
Sbjct: 7 ttgcattgcattgcattgcatcgc 30
Score = 40.1 bits (20), Expect = 0.25
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 424 ttgcattgcattgcatcgcatcgc 447
|||||||||||||||| |||||||
Sbjct: 7 ttgcattgcattgcattgcatcgc 30
>gb|BZ345198.1|BZ345198 hr47b01.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hr47b01 5', DNA sequence
Length = 430
Score = 46.1 bits (23), Expect = 0.004
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||| |||||
Sbjct: 236 ttgcattgcattgcattgcattgcatc 262
Score = 40.1 bits (20), Expect = 0.25
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 424 ttgcattgcattgcatcgcatcgcatcc 451
|||||||||||||||| |||| ||||||
Sbjct: 236 ttgcattgcattgcattgcattgcatcc 263
>gb|CL154627.1|CL154627 104_340_10781550_114_31469_030 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10781550, DNA
sequence
Length = 728
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 416 cccttgcattgcattgcattgca 438
|||||||||||||||||||||||
Sbjct: 367 cccttgcattgcattgcattgca 389
>gb|CW053125.1|CW053125 104_293_10515788_114_30185 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515788, DNA
sequence
Length = 627
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 242 ttgcattgcattgcattgcattgcattgcat 212
>gb|CW053335.1|CW053335 104_293_10515906_114_30185 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515906, DNA
sequence
Length = 660
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 242 ttgcattgcattgcattgcattgcattgcat 212
>gb|CW213394.1|CW213394 104_644_11191518_148_37032_017 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11191518, DNA
sequence
Length = 637
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 181 ttgcattgcattgcattgcattgcattgcat 151
Score = 42.1 bits (21), Expect = 0.063
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 421 gcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||| |||| ||||
Sbjct: 184 gcattgcattgcattgcattgcattgcat 156
>gb|CW222516.1|CW222516 104_658_11202416_116_37184_032 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11202416, DNA
sequence
Length = 666
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 610 ttgcattgcattgcattgcattgcattgcat 640
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 605 ttgcattgcattgcattgcattgcattgcat 635
Score = 42.1 bits (21), Expect = 0.063
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 421 gcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||| |||| ||||
Sbjct: 602 gcattgcattgcattgcattgcattgcat 630
>gb|CW222517.1|CW222517 104_658_11202416_148_37183_032 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11202416, DNA
sequence
Length = 650
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 194 ttgcattgcattgcattgcattgcattgcat 164
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 189 ttgcattgcattgcattgcattgcattgcat 159
Score = 42.1 bits (21), Expect = 0.063
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 421 gcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||| |||| ||||
Sbjct: 197 gcattgcattgcattgcattgcattgcat 169
>gb|CW224266.1|CW224266 104_660_11203357_116_37193_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11203357, DNA
sequence
Length = 655
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatcg 441
|||||||||||||||||||||||
Sbjct: 325 ttgcattgcattgcattgcatcg 347
Score = 46.1 bits (23), Expect = 0.004
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatcgcatcg 446
|||||||||||||||||||| ||||||
Sbjct: 321 tgcattgcattgcattgcattgcatcg 347
>gb|CW225652.1|CW225652 104_663_11204470_116_37210_089 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11204470, DNA
sequence
Length = 679
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 416 cccttgcattgcattgcattgca 438
|||||||||||||||||||||||
Sbjct: 421 cccttgcattgcattgcattgca 399
>gb|CW248300.1|CW248300 104_709_11222225_148_35025_069 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11222225, DNA
sequence
Length = 594
Score = 46.1 bits (23), Expect = 0.004
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatcgcatc 445
||||||||||||||||||||| |||||
Sbjct: 409 ttgcattgcattgcattgcattgcatc 435
Score = 40.1 bits (20), Expect = 0.25
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 424 ttgcattgcattgcatcgcatcgcatcc 451
|||||||||||||||| |||| ||||||
Sbjct: 409 ttgcattgcattgcattgcattgcatcc 436
>gb|CW269139.1|CW269139 104_740_11401699_148_35314_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11401699, DNA
sequence
Length = 624
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 418 cttgcattgcattgcattgcatc 440
|||||||||||||||||||||||
Sbjct: 43 cttgcattgcattgcattgcatc 65
>gb|CW294121.1|CW294121 104_774_11415021_116_35773_081 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11415021, DNA
sequence
Length = 668
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 310 ttgcattgcattgcattgcattgcattgcat 280
Score = 42.1 bits (21), Expect = 0.063
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 421 gcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||| |||| ||||
Sbjct: 313 gcattgcattgcattgcattgcattgcat 285
>gb|CW294122.1|CW294122 104_774_11415021_148_35772_081 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11415021, DNA
sequence
Length = 670
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 438 ttgcattgcattgcattgcattgcattgcat 468
Score = 42.1 bits (21), Expect = 0.063
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 421 gcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||| |||| ||||
Sbjct: 435 gcattgcattgcattgcattgcattgcat 463
>gb|CW344600.1|CW344600 104_847_11488040_116_36200_026 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11488040, DNA
sequence
Length = 724
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 416 cccttgcattgcattgcattgca 438
|||||||||||||||||||||||
Sbjct: 563 cccttgcattgcattgcattgca 585
>gb|CW344601.1|CW344601 104_847_11488040_148_36199_026 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11488040, DNA
sequence
Length = 579
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 416 cccttgcattgcattgcattgca 438
|||||||||||||||||||||||
Sbjct: 417 cccttgcattgcattgcattgca 395
>gb|CW348342.1|CW348342 fsbb001f008k22f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f008k22, DNA
sequence
Length = 722
Score = 46.1 bits (23), Expect = 0.004
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatcg 446
|||||||||||||||||||| ||||||
Sbjct: 264 tgcattgcattgcattgcattgcatcg 238
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcg 441
|||||||||||||||||||||||
Sbjct: 260 ttgcattgcattgcattgcatcg 238
>gb|CW412343.1|CW412343 fsbb001f107p03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f107p03, DNA
sequence
Length = 540
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 431 gcattgcatcgcatcgcatccca 453
|||||||||||||||||||||||
Sbjct: 470 gcattgcatcgcatcgcatccca 492
>gb|CW492473.1|CW492473 fsbb001f282m08f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f282m08, DNA
sequence
Length = 772
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 416 cccttgcattgcattgcattgca 438
|||||||||||||||||||||||
Sbjct: 140 cccttgcattgcattgcattgca 118
>gb|CW500793.1|CW500793 fsbb001f296e14f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f296e14, DNA
sequence
Length = 737
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcatcgcat 449
||||||||||||||||||||| |||| ||||
Sbjct: 711 ttgcattgcattgcattgcattgcattgcat 681
Score = 44.1 bits (22), Expect = 0.016
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatcgcat 449
|||||||||||||||||||| |||| ||||
Sbjct: 715 tgcattgcattgcattgcattgcattgcat 686
>gb|BZ333902.1|BZ333902 hx75a05.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hx75a05 5', DNA sequence
Length = 740
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 418 cttgcattgcattgcattgcat 439
||||||||||||||||||||||
Sbjct: 615 cttgcattgcattgcattgcat 636
>gb|CW027407.1|CW027407 104_254_10498496_116_30396 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10498496, DNA
sequence
Length = 806
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 418 cttgcattgcattgcattgcat 439
||||||||||||||||||||||
Sbjct: 313 cttgcattgcattgcattgcat 292
>gb|CW046207.1|CW046207 104_283_10510041_115_30139 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10510041, DNA
sequence
Length = 522
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 418 cttgcattgcattgcattgcat 439
||||||||||||||||||||||
Sbjct: 446 cttgcattgcattgcattgcat 425
>gb|CW124713.1|CW124713 104_504_11111934_148_34704_021 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11111934, DNA
sequence
Length = 540
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 426 gcattgcattgcatcgcatcgcatcc 451
||||||||||||||||||| ||||||
Sbjct: 536 gcattgcattgcatcgcattgcatcc 511
>gb|CW144951.1|CW144951 104_537_11138211_116_34972_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11138211, DNA
sequence
Length = 725
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 415 gcccttgcattgcattgcattg 436
||||||||||||||||||||||
Sbjct: 201 gcccttgcattgcattgcattg 180
>gb|CW144952.1|CW144952 104_537_11138211_148_34968_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11138211, DNA
sequence
Length = 693
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 415 gcccttgcattgcattgcattg 436
||||||||||||||||||||||
Sbjct: 543 gcccttgcattgcattgcattg 564
>gb|CW172187.1|CW172187 104_583_11156148_148_36539_044 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11156148, DNA
sequence
Length = 517
Score = 44.1 bits (22), Expect = 0.016
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgcatc 440
||||||||||||||||||||||
Sbjct: 2 ttgcattgcattgcattgcatc 23
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 221,362
Number of Sequences: 832831
Number of extensions: 221362
Number of successful extensions: 68877
Number of sequences better than 0.5: 201
Number of HSP's better than 0.5 without gapping: 201
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68039
Number of HSP's gapped (non-prelim): 685
length of query: 649
length of database: 491,359,669
effective HSP length: 19
effective length of query: 630
effective length of database: 475,535,880
effective search space: 299587604400
effective search space used: 299587604400
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)