BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2594147.2.1
(744 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW217959.1|CW217959 104_651_11195928_148_37066_090 Sorgh... 601 e-170
gb|CW435340.1|CW435340 fsbb001f151h04k0 Sorghum methylation... 601 e-170
gb|BZ780043.1|BZ780043 ii36g12.g1 WGS-SbicolorF (DH5a methy... 291 5e-077
gb|CW430464.1|CW430464 fsbb001f144d01f0 Sorghum methylation... 234 9e-060
gb|CW046679.1|CW046679 104_284_10512277_114_30219 Sorghum m... 182 3e-044
gb|CW423090.1|CW423090 fsbb001f132l21f0 Sorghum methylation... 182 3e-044
gb|CW427650.1|CW427650 fsbb001f139m02f0 Sorghum methylation... 170 1e-040
gb|CW217957.1|CW217957 104_651_11195928_116_37067_090 Sorgh... 167 2e-039
gb|CW104641.1|CW104641 104_473_11012539_116_34444_068 Sorgh... 159 4e-037
gb|CW396909.1|CW396909 fsbb001f085j02k0 Sorghum methylation... 94 2e-017
gb|BG048512.1|BG048512 OV1_14_E03.g2_A002 Ovary 1 (OV1) Sor... 94 2e-017
gb|CW155769.1|CW155769 104_558_11146316_116_36370_074 Sorgh... 84 2e-014
gb|CN136626.1|CN136626 OX1_44_G12.b1_A002 Oxidatively-stres... 84 2e-014
gb|CW354064.1|CW354064 fsbb001f017b11k0 Sorghum methylation... 78 1e-012
gb|CD219585.1|CD219585 CCC1_57_C04.g1_A007 Callus culture/c... 70 3e-010
gb|CD226852.1|CD226852 CCC1_48_E12.g1_A007 Callus culture/c... 70 3e-010
gb|CW268308.1|CW268308 104_739_11401215_116_35306_064 Sorgh... 68 1e-009
gb|CW047101.1|CW047101 104_284_10512536_114_30219 Sorghum m... 66 5e-009
gb|BH245862.1|BH245862 pSB1435.2 S. bicolor BTx623 PstI-dig... 62 8e-008
gb|CW233769.1|CW233769 104_687_11213622_148_37379_027 Sorgh... 62 8e-008
gb|CW241491.1|CW241491 104_700_11218800_116_37544_086 Sorgh... 62 8e-008
gb|CW241492.1|CW241492 104_700_11218800_148_37543_086 Sorgh... 62 8e-008
gb|CW377780.1|CW377780 fsbb001f056d24k0 Sorghum methylation... 62 8e-008
gb|CW445527.1|CW445527 fsbb001f170l16k0 Sorghum methylation... 62 8e-008
gb|BG048731.1|BG048731 OV1_22_C07.b1_A002 Ovary 1 (OV1) Sor... 62 8e-008
gb|BG048752.1|BG048752 OV1_22_E11.b1_A002 Ovary 1 (OV1) Sor... 62 8e-008
gb|BG048811.1|BG048811 OV1_23_C12.b1_A002 Ovary 1 (OV1) Sor... 62 8e-008
gb|BG049103.1|BG049103 OV1_23_C12.g1_A002 Ovary 1 (OV1) Sor... 62 8e-008
gb|CN131734.1|CN131734 OX1_2_B01.b1_A002 Oxidatively-stress... 58 1e-006
gb|BZ367428.1|BZ367428 id04d05.g1 WGS-SbicolorF (JM107 adap... 56 5e-006
gb|CL159722.1|CL159722 104_349_10804467_116_31382_291 Sorgh... 56 5e-006
gb|CW154770.1|CW154770 104_557_11145777_148_36360_047 Sorgh... 56 5e-006
gb|CW247381.1|CW247381 104_708_11221754_116_36078_009 Sorgh... 56 5e-006
gb|CW268309.1|CW268309 104_739_11401215_148_35310_064 Sorgh... 56 5e-006
gb|CW321934.1|CW321934 104_815_11475820_116_35944_008 Sorgh... 56 5e-006
gb|BG158255.1|BG158255 EM1_9_D12.b1_A002 Embryo 1 (EM1) Sor... 56 5e-006
gb|CD219865.1|CD219865 CCC1_59_D05.g1_A007 Callus culture/c... 56 5e-006
gb|CN146372.1|CN146372 WOUND1_39_H03.g1_A002 Wounded leaves... 56 5e-006
gb|CN146289.1|CN146289 WOUND1_39_H03.b1_A002 Wounded leaves... 52 7e-005
gb|CW038534.1|CW038534 104_270_10504977_115_30386 Sorghum m... 50 3e-004
gb|CW099293.1|CW099293 104_466_11003472_148_34379_094 Sorgh... 50 3e-004
gb|CW133289.1|CW133289 104_517_11116679_148_34812_096 Sorgh... 50 3e-004
gb|CW140343.1|CW140343 104_530_11135731_148_34916_066 Sorgh... 50 3e-004
gb|CW253166.1|CW253166 104_716_11224935_116_35104_054 Sorgh... 50 3e-004
gb|CW376698.1|CW376698 fsbb001f054l06f0 Sorghum methylation... 50 3e-004
gb|CW376699.1|CW376699 fsbb001f054l06k0 Sorghum methylation... 50 3e-004
gb|CW417495.1|CW417495 fsbb001f120i17f0 Sorghum methylation... 50 3e-004
gb|CW428522.1|CW428522 fsbb001f141e10k0 Sorghum methylation... 50 3e-004
gb|CW480555.1|CW480555 fsbb001f239k22f0 Sorghum methylation... 50 3e-004
gb|CD210102.1|CD210102 HS1_57_F11.b1_A012 Heat-shocked seed... 50 3e-004
gb|CD221639.1|CD221639 CCC1_70_G11.b1_A007 Callus culture/c... 50 3e-004
gb|CD221661.1|CD221661 CCC1_70_E11.b1_A007 Callus culture/c... 50 3e-004
gb|CX607987.1|CX607987 ANR1_32_A06.b1_A002 Anaerobic roots ... 50 3e-004
gb|CW054609.1|CW054609 104_295_10516628_114_30186 Sorghum m... 48 0.001
gb|CW061064.1|CW061064 104_304_10520199_114_30143 Sorghum m... 48 0.001
gb|CW062333.1|CW062333 104_307_10521280_5_30083 Sorghum met... 48 0.001
gb|CW089886.1|CW089886 104_435_10948967_116_32598_088 Sorgh... 48 0.001
gb|CW134146.1|CW134146 104_518_11117151_116_34820_060 Sorgh... 48 0.001
gb|CW189107.1|CW189107 104_610_11173790_116_37100_059 Sorgh... 48 0.001
gb|CW399257.1|CW399257 fsbb001f089a13f0 Sorghum methylation... 48 0.001
gb|CW417496.1|CW417496 fsbb001f120i17k0 Sorghum methylation... 48 0.001
gb|CN133273.1|CN133273 OX1_11_E08.b1_A002 Oxidatively-stres... 48 0.001
gb|CN133353.1|CN133353 OX1_11_E08.g1_A002 Oxidatively-stres... 48 0.001
gb|CN134577.1|CN134577 OX1_27_E09.b1_A002 Oxidatively-stres... 48 0.001
gb|CN134664.1|CN134664 OX1_27_E09.g1_A002 Oxidatively-stres... 48 0.001
gb|CX606182.1|CX606182 ANR1_1_C10.g1_A002 Anaerobic roots S... 48 0.001
gb|CX616493.1|CX616493 GABR1_28_F03.b1_A002 GA- or brassino... 48 0.001
gb|CX616580.1|CX616580 GABR1_28_F03.g1_A002 GA- or brassino... 48 0.001
gb|BZ346961.1|BZ346961 hw02c11.b1 WGS-SbicolorF (JM107 adap... 46 0.005
gb|CL159497.1|CL159497 104_349_10804291_114_31381_115 Sorgh... 46 0.005
gb|CW054610.1|CW054610 104_295_10516628_115_30179 Sorghum m... 46 0.005
gb|CW072445.1|CW072445 104_325_10592270_114_30536 Sorghum m... 46 0.005
gb|CW113135.1|CW113135 104_487_11105276_116_34556_076 Sorgh... 46 0.005
gb|CW137101.1|CW137101 104_523_11119113_148_34864_041 Sorgh... 46 0.005
gb|CW223947.1|CW223947 104_660_11203186_148_37446_047 Sorgh... 46 0.005
gb|CW228007.1|CW228007 104_667_11206124_116_37246_070 Sorgh... 46 0.005
gb|CW322132.1|CW322132 104_815_11475928_116_35944_052 Sorgh... 46 0.005
gb|CW333019.1|CW333019 104_830_11481720_116_36037_082 Sorgh... 46 0.005
gb|CW333020.1|CW333020 104_830_11481720_148_36038_082 Sorgh... 46 0.005
gb|CW454420.1|CW454420 fsbb001f198n16k0 Sorghum methylation... 46 0.005
gb|CW784462.1|CW784462 SP__Bb0024I23.r SP__Bb Sorghum propi... 46 0.005
gb|CF480054.1|CF480054 POL1_63_A12.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF480166.1|CF480166 POL1_64_D03.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF480248.1|CF480248 POL1_64_D03.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF480285.1|CF480285 POL1_64_G06.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF480411.1|CF480411 POL1_65_D03.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF480457.1|CF480457 POL1_65_H06.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF480711.1|CF480711 POL1_67_A06.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF480730.1|CF480730 POL1_67_C02.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF481066.1|CF481066 POL1_69_F07.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF481186.1|CF481186 POL1_70_B02.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF481234.1|CF481234 POL1_70_F07.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF481418.1|CF481418 POL1_71_H03.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF482510.1|CF482510 POL1_7_A01.g1_A002 Pollen Sorghum bi... 46 0.005
gb|CF482685.1|CF482685 POL1_8_B05.g1_A002 Pollen Sorghum bi... 46 0.005
gb|CF482799.1|CF482799 POL1_9_F05.b1_A002 Pollen Sorghum bi... 46 0.005
gb|CF482883.1|CF482883 POL1_9_F05.g1_A002 Pollen Sorghum bi... 46 0.005
gb|CF483096.1|CF483096 POL1_11_F05.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF483137.1|CF483137 POL1_12_B09.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF483169.1|CF483169 POL1_12_E10.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF483197.1|CF483197 POL1_12_H10.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF483231.1|CF483231 POL1_12_E10.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF483330.1|CF483330 POL1_21_B07.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF483416.1|CF483416 POL1_22_D07.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF483491.1|CF483491 POL1_22_D07.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF483683.1|CF483683 POL1_24_B02.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF483976.1|CF483976 POL1_2_G04.b1_A002 Pollen Sorghum bi... 46 0.005
gb|CF483980.1|CF483980 POL1_2_G08.b1_A002 Pollen Sorghum bi... 46 0.005
gb|CF484108.1|CF484108 POL1_3_E05.b1_A002 Pollen Sorghum bi... 46 0.005
gb|CF484397.1|CF484397 POL1_25_C05.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF484606.1|CF484606 POL1_26_H05.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF484704.1|CF484704 POL1_27_A11.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF484901.1|CF484901 POL1_28_F03.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF484984.1|CF484984 POL1_28_F03.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF485026.1|CF485026 POL1_29_A12.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF485051.1|CF485051 POL1_29_D08.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF485106.1|CF485106 POL1_29_A12.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF485127.1|CF485127 POL1_29_C12.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF485229.1|CF485229 POL1_30_E09.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF486512.1|CF486512 POL1_38_D06.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF486514.1|CF486514 POL1_38_D08.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF486570.1|CF486570 POL1_38_B03.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF486596.1|CF486596 POL1_38_D06.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF486598.1|CF486598 POL1_38_D08.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF486737.1|CF486737 POL1_39_A11.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF486753.1|CF486753 POL1_39_C04.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF486763.1|CF486763 POL1_39_D02.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487066.1|CF487066 POL1_41_C03.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487232.1|CF487232 POL1_42_C05.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487377.1|CF487377 POL1_43_A08.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487409.1|CF487409 POL1_43_D04.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487484.1|CF487484 POL1_44_C08.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF487513.1|CF487513 POL1_44_F08.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF487564.1|CF487564 POL1_44_C08.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487622.1|CF487622 POL1_44_H12.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487722.1|CF487722 POL1_45_C01.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487790.1|CF487790 POL1_46_A03.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF487872.1|CF487872 POL1_46_A03.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF487896.1|CF487896 POL1_46_C05.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF488078.1|CF488078 POL1_47_D10.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF488105.1|CF488105 POL1_47_G06.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF488299.1|CF488299 POL1_49_A10.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF488363.1|CF488363 POL1_49_A10.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF488671.1|CF488671 POL1_51_B05.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF488708.1|CF488708 POL1_51_E07.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF488732.1|CF488732 POL1_51_G09.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF488833.1|CF488833 POL1_52_B08.g1_A002 Pollen Sorghum b... 46 0.005
gb|CF489097.1|CF489097 POL1_54_H09.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF489352.1|CF489352 POL1_57_C07.b1_A002 Pollen Sorghum b... 46 0.005
gb|CF489435.1|CF489435 POL1_57_C07.g1_A002 Pollen Sorghum b... 46 0.005
gb|CX614568.1|CX614568 GABR1_14_H01.g1_A002 GA- or brassino... 46 0.005
gb|BZ349112.1|BZ349112 hq87c03.g1 WGS-SbicolorF (JM107 adap... 44 0.018
gb|CL165129.1|CL165129 104_359_10808375_114_31816_359 Sorgh... 44 0.018
gb|CW125015.1|CW125015 104_505_11112103_116_34713_030 Sorgh... 44 0.018
gb|CW204078.1|CW204078 104_631_11186348_148_37094_066 Sorgh... 44 0.018
gb|CW402616.1|CW402616 fsbb001f093p05k0 Sorghum methylation... 44 0.018
gb|BE357973.1|BE357973 DG1_23_H03.g1_A002 Dark Grown 1 (DG1... 44 0.018
gb|CD230488.1|CD230488 SS1_44_B08.b1_A012 Salt-stressed see... 44 0.018
gb|CD231800.1|CD231800 SS1_30_D03.b1_A012 Salt-stressed see... 44 0.018
gb|CD233638.1|CD233638 SS1_3_G02.b1_A012 Salt-stressed seed... 44 0.018
gb|CD428756.1|CD428756 ETH1_36_H11.b1_A002 Ethylene-treated... 44 0.018
gb|CD432496.1|CD432496 ETH1_30_C04.b1_A002 Ethylene-treated... 44 0.018
gb|CD462510.1|CD462510 ETH1_38_D10.b1_A002 Ethylene-treated... 44 0.018
gb|BZ339450.1|BZ339450 ic32c10.b1 WGS-SbicolorF (JM107 adap... 42 0.072
gb|CW233768.1|CW233768 104_687_11213622_116_37380_027 Sorgh... 42 0.072
gb|CW253167.1|CW253167 104_716_11224935_148_35100_054 Sorgh... 42 0.072
gb|CW450105.1|CW450105 fsbb001f188j04f0 Sorghum methylation... 42 0.072
gb|BE361244.1|BE361244 DG1_70_C10.g1_A002 Dark Grown 1 (DG1... 42 0.072
gb|BG049025.1|BG049025 OV1_22_C07.g1_A002 Ovary 1 (OV1) Sor... 42 0.072
gb|BG049047.1|BG049047 OV1_22_E11.g1_A002 Ovary 1 (OV1) Sor... 42 0.072
gb|BG932946.1|BG932946 DG1_69_C11.g1_A002 Dark Grown 1 (DG1... 42 0.072
gb|CD206178.1|CD206178 HS1_21_C02.b1_A012 Heat-shocked seed... 42 0.072
gb|CD210199.1|CD210199 HS1_57_F11.g1_A012 Heat-shocked seed... 42 0.072
gb|CD220424.1|CD220424 CCC1_67_F12.b1_A007 Callus culture/c... 42 0.072
gb|CD220530.1|CD220530 CCC1_67_F12.g1_A007 Callus culture/c... 42 0.072
gb|CF427028.1|CF427028 PH1_3_A04.b1_A002 Phosphorous-defici... 42 0.072
gb|CN126050.1|CN126050 RHOH1_14_H04.g1_A002 Acid- and alkal... 42 0.072
gb|CN131820.1|CN131820 OX1_2_B01.g1_A002 Oxidatively-stress... 42 0.072
gb|CN150998.1|CN150998 WOUND1_72_G04.g1_A002 Wounded leaves... 42 0.072
gb|CW433265.1|CW433265 fsbb001f148g13f0 Sorghum methylation... 40 0.28
gb|BF656823.1|BF656823 OV2_23_D07.g1_A002 Ovary 2 (OV2) Sor... 40 0.28
gb|CF480333.1|CF480333 POL1_65_D03.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF480969.1|CF480969 POL1_69_E05.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF481103.1|CF481103 POL1_70_B02.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF483265.1|CF483265 POL1_21_B07.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF486491.1|CF486491 POL1_38_B03.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF486657.1|CF486657 POL1_39_A11.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF486682.1|CF486682 POL1_39_D02.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF487815.1|CF487815 POL1_46_C05.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF488330.1|CF488330 POL1_49_E12.b1_A002 Pollen Sorghum b... 40 0.28
gb|CF488401.1|CF488401 POL1_49_E12.g1_A002 Pollen Sorghum b... 40 0.28
gb|CF488631.1|CF488631 POL1_51_E07.b1_A002 Pollen Sorghum b... 40 0.28
gb|CN125960.1|CN125960 RHOH1_14_H04.b1_A002 Acid- and alkal... 40 0.28
gb|CN134237.1|CN134237 OX1_25_D04.b1_A002 Oxidatively-stres... 40 0.28
gb|CN134318.1|CN134318 OX1_25_D04.g1_A002 Oxidatively-stres... 40 0.28
gb|CN134399.1|CN134399 OX1_26_D04.b1_A002 Oxidatively-stres... 40 0.28
gb|CN134481.1|CN134481 OX1_26_D04.g1_A002 Oxidatively-stres... 40 0.28
gb|CX613415.1|CX613415 GABR1_8_B11.b1_A002 GA- or brassinol... 40 0.28
gb|DN552513.1|DN552513 pSHR-RT-A-H1_H09_C105 pSHR Sorghum h... 40 0.28
gb|AF527808.1| Sorghum bicolor clone BAC SBTXS_0040L6 php20... 40 0.28
>gb|CW217959.1|CW217959 104_651_11195928_148_37066_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195928, DNA
sequence
Length = 715
Score = 601 bits (303), Expect = e-170
Identities = 362/381 (95%), Gaps = 3/381 (0%)
Strand = Plus / Plus
Query: 233 ccggcagcctcgtagccccggcaggcaccgctcctgggcctggccctcgtcacagccacg 292
|||||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||
Sbjct: 335 ccggcagcctcgtagcgccggcagacaccgctccggggcctggccctcgccacagccacg 394
Query: 293 ccgccagaccggtacgcgacgccggcgttccaccccgcaggtatggcgttgctggcgacg 352
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 395 ccgcctgaccggtacgcgacgccggcgttccaccccgcaggtatggcgttgccggcgacg 454
Query: 353 agcgccctgccagagctgaaggtgaggcggatgttgaaggggccctggaggacggagccg 412
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 455 agcaccctgccagagctgaaggtgaggcggatgttgaaggggccctggaggacggcgccg 514
Query: 413 gagttgatcttccacacggcgccccacgactgctgcatcggcacccactgccccgtcgtc 472
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 515 gagttgatcttccacacggcgccccacgactgctgcatcggcacccactgccccgtcgtg 574
Query: 473 ccgccctg---cgtctgcatcatgtccacggagtcgagggcgctgtcgctatcctcgtac 529
|||||||| | |||||| ||||||||||||| |||| |||||||||| |||||||||
Sbjct: 575 ccgccctgaccctgctgcatgatgtccacggagtagaggtcgctgtcgctgtcctcgtac 634
Query: 530 tcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaaggtcacgtcc 589
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 635 tcgatcagcacggccaggtagttcgggttggagcccgactccaccgagaaggtcacgtcc 694
Query: 590 acgccaggccactcgcactgc 610
|||||||||||||||||||||
Sbjct: 695 acgccaggccactcgcactgc 715
Score = 48.1 bits (24), Expect = 0.001
Identities = 60/72 (83%)
Strand = Plus / Plus
Query: 100 ctactcagtccatgtagcccaaactcgcacgctcccagaaccagcaaaattgcatcgcat 159
||||||| |||| |||| || || | |||||||| || |||| ||||||| ||||||||
Sbjct: 215 ctactcaatccaggtagtcctaatttgcacgctcacaccaccaccaaaattacatcgcat 274
Query: 160 ctcggctcacag 171
||| ||||||||
Sbjct: 275 ctccgctcacag 286
>gb|CW435340.1|CW435340 fsbb001f151h04k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f151h04, DNA
sequence
Length = 598
Score = 601 bits (303), Expect = e-170
Identities = 365/385 (94%), Gaps = 3/385 (0%)
Strand = Plus / Plus
Query: 233 ccggcagcctcgtagccccggcaggcaccgctcctgggcctggccctcgtcacagccacg 292
|||||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||
Sbjct: 98 ccggcagcctcgtagcgccggcagacaccgctccggggcctggccctcgccacagccacg 157
Query: 293 ccgccagaccggtacgcgacgccggcgttccaccccgcaggtatggcgttgctggcgacg 352
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 158 ccgcctgaccggtacgcgacgccggcgttccaccccgcaggtatggcgttgccggcgacg 217
Query: 353 agcgccctgccagagctgaaggtgaggcggatgttgaaggggccctggaggacggagccg 412
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 218 agcaccctgccagagctgaaggtgaggcggatgttgaaggggccctggaggacggcgccg 277
Query: 413 gagttgatcttccacacggcgccccacgactgctgcatcggcacccactgccccgtcgtc 472
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 278 gagttgatcttccacacggcgccccacgactgctgcatcggcacccactgccccgtcgtg 337
Query: 473 ccgccctg---cgtctgcatcatgtccacggagtcgagggcgctgtcgctatcctcgtac 529
|||||||| | |||||| ||||||||||||| |||| |||||||||| |||||||||
Sbjct: 338 ccgccctgaccctgctgcatgatgtccacggagtagaggtcgctgtcgctgtcctcgtac 397
Query: 530 tcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaaggtcacgtcc 589
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||
Sbjct: 398 tcgatcagcacggccaggtagttcgggttggagccggactccaccgagaaggtcacgtcc 457
Query: 590 acgccaggccactcgcactgcaccc 614
|||||||||||||||||||||||||
Sbjct: 458 acgccaggccactcgcactgcaccc 482
>gb|BZ780043.1|BZ780043 ii36g12.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ii36g12, DNA sequence
Length = 267
Score = 291 bits (147), Expect = 5e-077
Identities = 191/205 (93%), Gaps = 3/205 (1%)
Strand = Plus / Minus
Query: 413 gagttgatcttccacacggcgccccacgactgctgcatcggcacccactgccccgtcgtc 472
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 267 gagttaatcttccacacggcgcgccacgactgctgcatcggcacccactgccccgtcgtg 208
Query: 473 ccgccctg---cgtctgcatcatgtccacggagtcgagggcgctgtcgctatcctcgtac 529
|||||||| | |||||| ||||||||||||| |||| |||||||||| |||||||||
Sbjct: 207 ccgccctgaccctgctgcatgatgtccacggagtagaggtcgctgtcgctgtcctcgtac 148
Query: 530 tcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaaggtcacgtcc 589
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||
Sbjct: 147 tcgatcagcacggccaggtagttcgggttggagccggactccaccgagaaggtcacgtcc 88
Query: 590 acgccaggccactcgcactgcaccc 614
|||||||||||||||||||||||||
Sbjct: 87 acgccaggccactcgcactgcaccc 63
>gb|CW430464.1|CW430464 fsbb001f144d01f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f144d01, DNA
sequence
Length = 639
Score = 234 bits (118), Expect = 9e-060
Identities = 156/168 (92%), Gaps = 3/168 (1%)
Strand = Plus / Plus
Query: 450 tcggcacccactgccccgtcgtcccgccctg---cgtctgcatcatgtccacggagtcga 506
|||||||||||||||||||||| |||||||| | |||||| ||||||||||||| ||
Sbjct: 1 tcggcacccactgccccgtcgtgccgccctgaccctgctgcatgatgtccacggagtaga 60
Query: 507 gggcgctgtcgctatcctcgtactcgatcagcacggccaggtagttcgggttggagcccg 566
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 61 ggtcgctgtcgctgtcctcgtactcgatcagcacggccaggtagttcgggttggagccgg 120
Query: 567 gctccaccgagaaggtcacgtccacgccaggccactcgcactgcaccc 614
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 actccaccgagaaggtcacgtccacgccaggccactcgcactgcaccc 168
Score = 190 bits (96), Expect = 1e-046
Identities = 123/132 (93%)
Strand = Plus / Plus
Query: 613 ccgggtatactggatttggatggcgccggcgccacgcagctggctctcctgcccgggctt 672
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 290 ccgggtatactggatttggatggcaccagcgccacgcagctggctctcctgcccgggctt 349
Query: 673 cgccaaggcaccgaacgctgtcccgctcatgtcgaagtggacctgctcatcaggacacgg 732
|||||||| || |||||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 350 ggccaaggcgccaaacgctgtcccgctcatgtccaagtggacctggtcatctggacacgg 409
Query: 733 gcaatcggggca 744
|||||| |||||
Sbjct: 410 gcaatcagggca 421
>gb|CW046679.1|CW046679 104_284_10512277_114_30219 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10512277, DNA
sequence
Length = 320
Score = 182 bits (92), Expect = 3e-044
Identities = 122/132 (92%)
Strand = Plus / Plus
Query: 613 ccgggtatactggatttggatggcgccggcgccacgcagctggctctcctgcccgggctt 672
||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 74 ccgggaatactggatttggatggcaccagcgccacgcagctggctctcctgcccgggctt 133
Query: 673 cgccaaggcaccgaacgctgtcccgctcatgtcgaagtggacctgctcatcaggacacgg 732
|||||||| || |||||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 134 ggccaaggcgccaaacgctgtcccgctcatgtccaagtggacctggtcatctggacacgg 193
Query: 733 gcaatcggggca 744
|||||| |||||
Sbjct: 194 gcaatcagggca 205
>gb|CW423090.1|CW423090 fsbb001f132l21f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f132l21, DNA
sequence
Length = 554
Score = 182 bits (92), Expect = 3e-044
Identities = 122/132 (92%)
Strand = Plus / Minus
Query: 613 ccgggtatactggatttggatggcgccggcgccacgcagctggctctcctgcccgggctt 672
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 508 ccgggtatactggatttggatggcaccagcgccacgcagctggctctcctgcccgggctt 449
Query: 673 cgccaaggcaccgaacgctgtcccgctcatgtcgaagtggacctgctcatcaggacacgg 732
|||||||| || ||| |||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 448 ggccaaggcgccaaacactgtcccgctcatgtccaagtggacctggtcatctggacacgg 389
Query: 733 gcaatcggggca 744
|||||| |||||
Sbjct: 388 gcaatcagggca 377
>gb|CW427650.1|CW427650 fsbb001f139m02f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f139m02, DNA
sequence
Length = 510
Score = 170 bits (86), Expect = 1e-040
Identities = 101/106 (95%)
Strand = Plus / Plus
Query: 233 ccggcagcctcgtagccccggcaggcaccgctcctgggcctggccctcgtcacagccacg 292
|||||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||
Sbjct: 405 ccggcagcctcgtagcgccggcagacaccgctccggggcctggccctcgccacagccacg 464
Query: 293 ccgccagaccggtacgcgacgccggcgttccaccccgcaggtatgg 338
||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 ccgcctgaccggtacgcgacgccggcgttccaccccgcaggtatgg 510
Score = 48.1 bits (24), Expect = 0.001
Identities = 60/72 (83%)
Strand = Plus / Plus
Query: 100 ctactcagtccatgtagcccaaactcgcacgctcccagaaccagcaaaattgcatcgcat 159
||||||| |||| |||| || || | |||||||| || |||| ||||||| ||||||||
Sbjct: 285 ctactcaatccaggtagtcctaatttgcacgctcacaccaccaccaaaattacatcgcat 344
Query: 160 ctcggctcacag 171
||| ||||||||
Sbjct: 345 ctccgctcacag 356
>gb|CW217957.1|CW217957 104_651_11195928_116_37067_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195928, DNA
sequence
Length = 665
Score = 167 bits (84), Expect = 2e-039
Identities = 120/132 (90%)
Strand = Plus / Minus
Query: 613 ccgggtatactggatttggatggcgccggcgccacgcagctggctctcctgcccgggctt 672
|||||||||||||||||||||||| || ||| ||||||||||||||||||| ||||||||
Sbjct: 429 ccgggtatactggatttggatggcaccagcgtcacgcagctggctctcctggccgggctt 370
Query: 673 cgccaaggcaccgaacgctgtcccgctcatgtcgaagtggacctgctcatcaggacacgg 732
|||||||| || | |||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 369 ggccaaggcgccaatcgctgtcccgctcatgtccaagtggacctggtcatctggacacgg 310
Query: 733 gcaatcggggca 744
|||||| |||||
Sbjct: 309 gcaatcagggca 298
Score = 165 bits (83), Expect = 7e-039
Identities = 107/115 (93%)
Strand = Plus / Minus
Query: 500 gagtcgagggcgctgtcgctatcctcgtactcgatcagcacggccaggtagttcgggttg 559
|||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 665 gagtagaggtcgctgtcgctgtcctcgtactcgatcagcacggccaggtagttcgggttg 606
Query: 560 gagcccggctccaccgagaaggtcacgtccacgccaggccactcgcactgcaccc 614
|||| || ||||||||||||||||| ||||| ||||||||||||||| |||||||
Sbjct: 605 gagctcgactccaccgagaaggtcaggtccaggccaggccactcgcagtgcaccc 551
>gb|CW104641.1|CW104641 104_473_11012539_116_34444_068 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11012539, DNA
sequence
Length = 532
Score = 159 bits (80), Expect = 4e-037
Identities = 95/100 (95%)
Strand = Plus / Minus
Query: 233 ccggcagcctcgtagccccggcaggcaccgctcctgggcctggccctcgtcacagccacg 292
|||||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||
Sbjct: 100 ccggcagcctcgtagcgccggcagacaccgctccggggcctggccctcgccacagccacg 41
Query: 293 ccgccagaccggtacgcgacgccggcgttccaccccgcag 332
||||| ||||||||||||||||||||||||||||||||||
Sbjct: 40 ccgcctgaccggtacgcgacgccggcgttccaccccgcag 1
Score = 48.1 bits (24), Expect = 0.001
Identities = 60/72 (83%)
Strand = Plus / Minus
Query: 100 ctactcagtccatgtagcccaaactcgcacgctcccagaaccagcaaaattgcatcgcat 159
||||||| |||| |||| || || | |||||||| || |||| ||||||| ||||||||
Sbjct: 220 ctactcaatccaggtagtcctaatttgcacgctcacaccaccaccaaaattacatcgcat 161
Query: 160 ctcggctcacag 171
||| ||||||||
Sbjct: 160 ctccgctcacag 149
>gb|CW396909.1|CW396909 fsbb001f085j02k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f085j02, DNA
sequence
Length = 598
Score = 93.7 bits (47), Expect = 2e-017
Identities = 116/139 (83%)
Strand = Plus / Minus
Query: 322 ccaccccgcaggtatggcgttgctggcgacgagcgccctgccagagctgaaggtgaggcg 381
||||||||| || ||| ||||| |||| |||| || |||||| |||| | ||||||||||
Sbjct: 184 ccaccccgcggggatgacgttggtggccacgaccgtcctgccggagccggaggtgaggcg 125
Query: 382 gatgttgaaggggccctggaggacggagccggagttgatcttccacacggcgccccacga 441
|| | |||||| |||| ||| ||| |||||||||| | |||||||||||||||||||
Sbjct: 124 gacggagaagggcgcctgcagggcggcgccggagttgtacctccacacggcgccccacga 65
Query: 442 ctgctgcatcggcacccac 460
| ||||||||||| |||||
Sbjct: 64 ccgctgcatcggcgcccac 46
>gb|BG048512.1|BG048512 OV1_14_E03.g2_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 547
Score = 93.7 bits (47), Expect = 2e-017
Identities = 116/139 (83%)
Strand = Plus / Minus
Query: 322 ccaccccgcaggtatggcgttgctggcgacgagcgccctgccagagctgaaggtgaggcg 381
||||||||| || ||| ||||| |||| |||| || |||||| |||| | ||||||||||
Sbjct: 315 ccaccccgcggggatgacgttggtggccacgaccgtcctgccggagccggaggtgaggcg 256
Query: 382 gatgttgaaggggccctggaggacggagccggagttgatcttccacacggcgccccacga 441
|| | |||||| |||| ||| ||| |||||||||| | |||||||||||||||||||
Sbjct: 255 gacggagaagggcgcctgcagggcggcgccggagttgtacctccacacggcgccccacga 196
Query: 442 ctgctgcatcggcacccac 460
| ||||||||||| |||||
Sbjct: 195 ccgctgcatcggcgcccac 177
Score = 40.1 bits (20), Expect = 0.28
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 523 ctcgtactcgatcagcacggccaggtagttcg 554
|||||||||||||||||| | || ||||||||
Sbjct: 123 ctcgtactcgatcagcaccggcaagtagttcg 92
>gb|CW155769.1|CW155769 104_558_11146316_116_36370_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11146316, DNA
sequence
Length = 719
Score = 83.8 bits (42), Expect = 2e-014
Identities = 162/202 (80%)
Strand = Plus / Minus
Query: 258 caccgctcctgggcctggccctcgtcacagccacgccgccagaccggtacgcgacgccgg 317
|||| ||||||||||||||||| ||||| ||||| || || | ||||||||| || || |
Sbjct: 608 caccactcctgggcctggccctagtcaccgccactccacctgcccggtacgccacacccg 549
Query: 318 cgttccaccccgcaggtatggcgttgctggcgacgagcgccctgccagagctgaaggtga 377
||||||| ||||||||||| |||||||| | ||| ||||||| |||||||| || |
Sbjct: 548 gagtccaccctgcaggtatggcattgctggctatgagtaccctgcctgagctgaatgtca 489
Query: 378 ggcggatgttgaaggggccctggaggacggagccggagttgatcttccacacggcgcccc 437
|||||| || ||| ||||| || ||| | ||||| |||| || | |||| | || ||||
Sbjct: 488 ggcggaggtggaacgggccgtgaagggcagagcccgagtcgagcctccaaatcgcacccc 429
Query: 438 acgactgctgcatcggcaccca 459
| || |||||||| ||||||||
Sbjct: 428 atgaatgctgcataggcaccca 407
Score = 71.9 bits (36), Expect = 8e-011
Identities = 78/92 (84%)
Strand = Plus / Minus
Query: 521 tcctcgtactcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaag 580
|||||||||||||||||||| ||||| ||||||||||| ||||| | || || |||||
Sbjct: 354 tcctcgtactcgatcagcacagccagatagttcgggttcgagccagagtcaacagagaaa 295
Query: 581 gtcacgtccacgccaggccactcgcactgcac 612
|| || || || |||||||| |||||||||||
Sbjct: 294 gttacatcaactccaggccattcgcactgcac 263
>gb|CN136626.1|CN136626 OX1_44_G12.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_44_G12_A002 3', mRNA sequence
Length = 795
Score = 83.8 bits (42), Expect = 2e-014
Identities = 162/202 (80%)
Strand = Plus / Minus
Query: 258 caccgctcctgggcctggccctcgtcacagccacgccgccagaccggtacgcgacgccgg 317
|||| ||||||||||||||||| ||||| ||||| || || | ||||||||| || || |
Sbjct: 500 caccactcctgggcctggccctagtcaccgccactccacctgcccggtacgccacacccg 441
Query: 318 cgttccaccccgcaggtatggcgttgctggcgacgagcgccctgccagagctgaaggtga 377
||||||| ||||||||||| |||||||| | ||| ||||||| |||||||| || |
Sbjct: 440 gagtccaccctgcaggtatggcattgctggctatgagtaccctgcctgagctgaatgtca 381
Query: 378 ggcggatgttgaaggggccctggaggacggagccggagttgatcttccacacggcgcccc 437
|||||| || ||| ||||| || ||| | ||||| |||| || | |||| | || ||||
Sbjct: 380 ggcggaggtggaacgggccgtgaagggcagagcccgagtcgagcctccaaatcgcacccc 321
Query: 438 acgactgctgcatcggcaccca 459
| || |||||||| ||||||||
Sbjct: 320 atgaatgctgcataggcaccca 299
Score = 75.8 bits (38), Expect = 5e-012
Identities = 92/110 (83%)
Strand = Plus / Minus
Query: 521 tcctcgtactcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaag 580
|||||||||||||||||||| ||||| ||||||||||| ||||| | || || |||||
Sbjct: 246 tcctcgtactcgatcagcacagccagatagttcgggttcgagccagagtcaacagagaaa 187
Query: 581 gtcacgtccacgccaggccactcgcactgcacccgggtatactggatttg 630
|| || || || |||||||| ||||||||||| || || || ||||||||
Sbjct: 186 gttacatcaactccaggccattcgcactgcacacgagtgtattggatttg 137
>gb|CW354064.1|CW354064 fsbb001f017b11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f017b11, DNA
sequence
Length = 477
Score = 77.8 bits (39), Expect = 1e-012
Identities = 114/139 (82%)
Strand = Plus / Minus
Query: 258 caccgctcctgggcctggccctcgtcacagccacgccgccagaccggtacgcgacgccgg 317
|||| ||||||||||||||||| ||||| ||||| || || | ||||||||| || || |
Sbjct: 169 caccactcctgggcctggccctagtcaccgccactccacctgcccggtacgccacacccg 110
Query: 318 cgttccaccccgcaggtatggcgttgctggcgacgagcgccctgccagagctgaaggtga 377
||||||| ||||||||||| |||||||| | ||| ||||||| |||||||| || |
Sbjct: 109 gagtccaccctgcaggtatggcattgctggctatgagtaccctgcctgagctgaatgtca 50
Query: 378 ggcggatgttgaaggggcc 396
|||||| || ||| |||||
Sbjct: 49 ggcggaggtggaacgggcc 31
>gb|CD219585.1|CD219585 CCC1_57_C04.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_57_C04_A007 5', mRNA sequence
Length = 660
Score = 69.9 bits (35), Expect = 3e-010
Identities = 101/123 (82%)
Strand = Plus / Minus
Query: 590 acgccaggccactcgcactgcacccgggtatactggatttggatggcgccggcgccacgc 649
||||||||||| | |||| |||| ||||| ||||||||||||| | |||||||| |||
Sbjct: 601 acgccaggccagttgcacggcacgcgggtgtactggatttggaggacgccggcgttgcgc 542
Query: 650 agctggctctcctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaag 709
|||| | |||| ||||| ||||||| ||| ||||| || || |||||||||||||||
Sbjct: 541 agcttgtcggcctggccggggttcgccatggcgccgaatgccgttccgctcatgtcgaag 482
Query: 710 tgg 712
|||
Sbjct: 481 tgg 479
>gb|CD226852.1|CD226852 CCC1_48_E12.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_48_E12_A007 5', mRNA sequence
Length = 627
Score = 69.9 bits (35), Expect = 3e-010
Identities = 101/123 (82%)
Strand = Plus / Minus
Query: 590 acgccaggccactcgcactgcacccgggtatactggatttggatggcgccggcgccacgc 649
||||||||||| | |||| |||| ||||| ||||||||||||| | |||||||| |||
Sbjct: 603 acgccaggccagttgcacggcacgcgggtgtactggatttggaggacgccggcgttgcgc 544
Query: 650 agctggctctcctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaag 709
|||| | |||| ||||| ||||||| ||| ||||| || || |||||||||||||||
Sbjct: 543 agcttgtcggcctggccggggttcgccatggcgccgaatgccgttccgctcatgtcgaag 484
Query: 710 tgg 712
|||
Sbjct: 483 tgg 481
>gb|CW268308.1|CW268308 104_739_11401215_116_35306_064 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11401215, DNA
sequence
Length = 465
Score = 67.9 bits (34), Expect = 1e-009
Identities = 112/138 (81%)
Strand = Plus / Plus
Query: 322 ccaccccgcaggtatggcgttgctggcgacgagcgccctgccagagctgaaggtgaggcg 381
||||||||| || ||| ||||| |||| |||| || |||||| |||| | |||||| |||
Sbjct: 260 ccaccccgcggggatgacgttggtggccacgaccgtcctgccggagccggaggtgaagcg 319
Query: 382 gatgttgaaggggccctggaggacggagccggagttgatcttccacacggcgccccacga 441
|| | |||||| |||| ||| ||| ||| |||||| | ||||||| |||||||||||
Sbjct: 320 gacggagaagggcgcctgcagggcggggccagagttgtacctccacactgcgccccacga 379
Query: 442 ctgctgcatcggcaccca 459
| ||||||||||| ||||
Sbjct: 380 ccgctgcatcggctccca 397
>gb|CW047101.1|CW047101 104_284_10512536_114_30219 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10512536, DNA
sequence
Length = 87
Score = 65.9 bits (33), Expect = 5e-009
Identities = 49/53 (92%), Gaps = 1/53 (1%)
Strand = Plus / Plus
Query: 613 ccgggtatactgg-atttggatggcgccggcgccacgcagctggctctcctgc 664
||||||||||||| ||||||||||| || |||||||||| |||||||||||||
Sbjct: 35 ccgggtatactggcatttggatggcaccagcgccacgcaactggctctcctgc 87
>gb|BH245862.1|BH245862 pSB1435.2 S. bicolor BTx623 PstI-digested total genomic DNA library
Sorghum bicolor genomic clone pSB1435 similar to
putative beta-expansin (pollen allergen) (AAD32826), DNA
sequence
Length = 384
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 163 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 217
>gb|CW233769.1|CW233769 104_687_11213622_148_37379_027 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11213622, DNA
sequence
Length = 710
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 385 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 331
Score = 42.1 bits (21), Expect = 0.072
Identities = 60/73 (82%)
Strand = Plus / Minus
Query: 522 cctcgtactcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaagg 581
||||||||||||| || |||||||||||| | ||| ||||| | |||||| |||||
Sbjct: 635 cctcgtactcgatggccatggccaggtagttggcgttcgagccggcgtccaccctgaagg 576
Query: 582 tcacgtccacgcc 594
||||||||||||
Sbjct: 575 ccacgtccacgcc 563
>gb|CW241491.1|CW241491 104_700_11218800_116_37544_086 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11218800, DNA
sequence
Length = 641
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 204 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 150
Score = 42.1 bits (21), Expect = 0.072
Identities = 60/73 (82%)
Strand = Plus / Minus
Query: 522 cctcgtactcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaagg 581
||||||||||||| || |||||||||||| | ||| ||||| | |||||| |||||
Sbjct: 458 cctcgtactcgatggccatggccaggtagttggcgttcgagccggcgtccaccctgaagg 399
Query: 582 tcacgtccacgcc 594
||||||||||||
Sbjct: 398 ccacgtccacgcc 386
>gb|CW241492.1|CW241492 104_700_11218800_148_37543_086 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11218800, DNA
sequence
Length = 644
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 528 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 582
Score = 42.1 bits (21), Expect = 0.072
Identities = 60/73 (82%)
Strand = Plus / Plus
Query: 522 cctcgtactcgatcagcacggccaggtagttcgggttggagcccggctccaccgagaagg 581
||||||||||||| || |||||||||||| | ||| ||||| | |||||| |||||
Sbjct: 274 cctcgtactcgatggccatggccaggtagttggcgttcgagccggcgtccaccctgaagg 333
Query: 582 tcacgtccacgcc 594
||||||||||||
Sbjct: 334 ccacgtccacgcc 346
>gb|CW377780.1|CW377780 fsbb001f056d24k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f056d24, DNA
sequence
Length = 751
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 64 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 118
>gb|CW445527.1|CW445527 fsbb001f170l16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f170l16, DNA
sequence
Length = 663
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 109 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 163
>gb|BG048731.1|BG048731 OV1_22_C07.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 329
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 311 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 257
>gb|BG048752.1|BG048752 OV1_22_E11.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 405
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 182 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 128
>gb|BG048811.1|BG048811 OV1_23_C12.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 483
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 458 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 404
>gb|BG049103.1|BG049103 OV1_23_C12.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 554
Score = 61.9 bits (31), Expect = 8e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtggac 714
|||| ||||| ||||||| |||||||||||| |||||||| | ||||||||||||
Sbjct: 103 cctggccgggtttcgccatggcaccgaacgccgtcccgctgaggtcgaagtggac 49
>gb|CN131734.1|CN131734 OX1_2_B01.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_2_B01_A002 3', mRNA sequence
Length = 533
Score = 58.0 bits (29), Expect = 1e-006
Identities = 32/33 (96%)
Strand = Plus / Minus
Query: 335 atggcgttgctggcgacgagcgccctgccagag 367
||||||||||||||||||||| |||||||||||
Sbjct: 142 atggcgttgctggcgacgagcaccctgccagag 110
>gb|BZ367428.1|BZ367428 id04d05.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone id04d05 5', DNA sequence
Length = 783
Score = 56.0 bits (28), Expect = 5e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 525 cgtactcgatcagcacggccaggtagttcgggttggagcc 564
||||||||| ||||||||||||||||| |||||||||||
Sbjct: 143 cgtactcgacgagcacggccaggtagtttgggttggagcc 104
>gb|CL159722.1|CL159722 104_349_10804467_116_31382_291 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10804467, DNA
sequence
Length = 687
Score = 56.0 bits (28), Expect = 5e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 525 cgtactcgatcagcacggccaggtagttcgggttggagcc 564
||||||||| ||||||||||||||||| |||||||||||
Sbjct: 530 cgtactcgacgagcacggccaggtagtttgggttggagcc 491
>gb|CW154770.1|CW154770 104_557_11145777_148_36360_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11145777, DNA
sequence
Length = 672
Score = 56.0 bits (28), Expect = 5e-006
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 525 cgtactcgatcagcacggccaggtagttcgggttggagcc 564
||||||||| ||||||||||||||||| |||||||||||
Sbjct: 46 cgtactcgacgagcacggccaggtagtttgggttggagcc 85
>gb|CW247381.1|CW247381 104_708_11221754_116_36078_009 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11221754, DNA
sequence
Length = 639
Score = 56.0 bits (28), Expect = 5e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 525 cgtactcgatcagcacggccaggtagttcgggttggagcc 564
||||||||| ||||||||||||||||| |||||||||||
Sbjct: 480 cgtactcgacgagcacggccaggtagtttgggttggagcc 441
>gb|CW268309.1|CW268309 104_739_11401215_148_35310_064 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11401215, DNA
sequence
Length = 713
Score = 56.0 bits (28), Expect = 5e-006
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtg 711
|||| ||||||||||||| ||| |||||||| || ||||||| |||||||||
Sbjct: 411 cctggccgggcttcgccagggctccgaacgccgtgccgctcaggtcgaagtg 360
>gb|CW321934.1|CW321934 104_815_11475820_116_35944_008 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11475820, DNA
sequence
Length = 668
Score = 56.0 bits (28), Expect = 5e-006
Identities = 37/40 (92%)
Strand = Plus / Minus
Query: 525 cgtactcgatcagcacggccaggtagttcgggttggagcc 564
||||||||| ||||||||||||||||| |||||||||||
Sbjct: 408 cgtactcgacgagcacggccaggtagtttgggttggagcc 369
>gb|BG158255.1|BG158255 EM1_9_D12.b1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 486
Score = 56.0 bits (28), Expect = 5e-006
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtg 711
|||| ||||||||||||| ||| |||||||| || ||||||| |||||||||
Sbjct: 484 cctggccgggcttcgccagggctccgaacgccgtgccgctcaggtcgaagtg 433
>gb|CD219865.1|CD219865 CCC1_59_D05.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_59_D05_A007 5', mRNA sequence
Length = 596
Score = 56.0 bits (28), Expect = 5e-006
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 660 cctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtg 711
|||| ||||||||||||| ||| |||||||| || ||||||| |||||||||
Sbjct: 486 cctggccgggcttcgccagggctccgaacgccgtgccgctcaggtcgaagtg 435
>gb|CN146372.1|CN146372 WOUND1_39_H03.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_39_H03_A002 5', mRNA sequence
Length = 666
Score = 56.0 bits (28), Expect = 5e-006
Identities = 100/124 (80%)
Strand = Plus / Minus
Query: 589 cacgccaggccactcgcactgcacccgggtatactggatttggatggcgccggcgccacg 648
|||||||||||| | ||| |||| ||||| ||||| ||||||| | |||||||| ||
Sbjct: 591 cacgccaggccagttgcatggcacacgggtgtactgtatttggaggacgccggcgttgcg 532
Query: 649 cagctggctctcctgcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaa 708
||||| | |||| ||||| ||||||| ||| ||||| || || ||||||||||||||
Sbjct: 531 cagcttgtcggcctggccggggttcgccatggcgccgaatgccgttccgctcatgtcgaa 472
Query: 709 gtgg 712
||||
Sbjct: 471 gtgg 468
>gb|CN146289.1|CN146289 WOUND1_39_H03.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_39_H03_A002 3', mRNA sequence
Length = 509
Score = 52.0 bits (26), Expect = 7e-005
Identities = 104/130 (80%)
Strand = Plus / Minus
Query: 321 tccaccccgcaggtatggcgttgctggcgacgagcgccctgccagagctgaaggtgaggc 380
||||||| || || ||| ||||||||||||||||| | |||| ||||| | || ||||
Sbjct: 172 tccacccggcggggatgacgttgctggcgacgagctgcttgccggagctcgacgtcaggc 113
Query: 381 ggatgttgaaggggccctggaggacggagccggagttgatcttccacacggcgccccacg 440
||||| ||||| |||| | | | || |||| ||||| |||||| |||||||||||||
Sbjct: 112 ggatggacaagggcgcctgcaaggccgacccggcgttgaacttccagacggcgccccacg 53
Query: 441 actgctgcat 450
|| |||||||
Sbjct: 52 acggctgcat 43
>gb|CW038534.1|CW038534 104_270_10504977_115_30386 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10504977, DNA
sequence
Length = 172
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 526 gtactcgatcagcacggccaggtagttcgggttggagcccggctccacc 574
||||| |||||||||||| |||||| ||||||||||||| | ||||||
Sbjct: 106 gtactggatcagcacggcgaggtagaacgggttggagccccggtccacc 154
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 424 ccacacggcgccccacgactgctgcatcggc 454
||||| |||||||||||| ||||||||||||
Sbjct: 16 ccacatggcgccccacgagtgctgcatcggc 46
>gb|CW099293.1|CW099293 104_466_11003472_148_34379_094 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11003472, DNA
sequence
Length = 563
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 526 gtactcgatcagcacggccaggtagttcgggttggagcccggctccacc 574
||||| |||||||||||| |||||| ||||||||||||| | ||||||
Sbjct: 41 gtactggatcagcacggcgaggtagaacgggttggagccccggtccacc 89
>gb|CW133289.1|CW133289 104_517_11116679_148_34812_096 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11116679, DNA
sequence
Length = 439
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 335 atggcgttgctggcgacgagcgccctgcc 363
||||||||||||||||||||| |||||||
Sbjct: 395 atggcgttgctggcgacgagcaccctgcc 423
>gb|CW140343.1|CW140343 104_530_11135731_148_34916_066 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11135731, DNA
sequence
Length = 562
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 526 gtactcgatcagcacggccaggtagttcgggttggagcccggctccacc 574
||||| |||||||||||| |||||| ||||||||||||| | ||||||
Sbjct: 377 gtactggatcagcacggcgaggtagaacgggttggagccccggtccacc 425
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 424 ccacacggcgccccacgactgctgcatcggc 454
||||| |||||||||||| ||||||||||||
Sbjct: 287 ccacatggcgccccacgagtgctgcatcggc 317
>gb|CW253166.1|CW253166 104_716_11224935_116_35104_054 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11224935, DNA
sequence
Length = 674
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 335 atggcgttgctggcgacgagcgccctgcc 363
||||||||||||||||||||| |||||||
Sbjct: 326 atggcgttgctggcgacgagcaccctgcc 354
>gb|CW376698.1|CW376698 fsbb001f054l06f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f054l06, DNA
sequence
Length = 588
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 335 atggcgttgctggcgacgagcgccctgcc 363
||||||||||||||||||||| |||||||
Sbjct: 468 atggcgttgctggcgacgagcaccctgcc 440
Score = 42.1 bits (21), Expect = 0.072
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 663 gcccgggcttcgccaaggcaccgaacgctgtcccgctcatgtcgaagtg 711
||||||||||||||| ||| || | || || |||||||||||||||||
Sbjct: 143 gcccgggcttcgccatggcgcccatggccgtgccgctcatgtcgaagtg 95
>gb|CW376699.1|CW376699 fsbb001f054l06k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f054l06, DNA
sequence
Length = 616
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 335 atggcgttgctggcgacgagcgccctgcc 363
||||||||||||||||||||| |||||||
Sbjct: 588 atggcgttgctggcgacgagcaccctgcc 616
>gb|CW417495.1|CW417495 fsbb001f120i17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f120i17, DNA
sequence
Length = 752
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Minus
Query: 526 gtactcgatcagcacggccaggtagttcgggttggagcccggctccacc 574
||||| |||||||||||| |||||| ||||||||||||| | ||||||
Sbjct: 262 gtactggatcagcacggcgaggtagaacgggttggagccccggtccacc 214
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 424 ccacacggcgccccacgactgctgcatcggc 454
||||| |||||||||||| ||||||||||||
Sbjct: 352 ccacatggcgccccacgagtgctgcatcggc 322
>gb|CW428522.1|CW428522 fsbb001f141e10k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f141e10, DNA
sequence
Length = 687
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 526 gtactcgatcagcacggccaggtagttcgggttggagcccggctccacc 574
||||| |||||||||||| |||||| ||||||||||||| | ||||||
Sbjct: 447 gtactggatcagcacggcgaggtagaacgggttggagccccggtccacc 495
Score = 46.1 bits (23), Expect = 0.005
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 424 ccacacggcgccccacgactgctgcatcggc 454
||||| |||||||||||| ||||||||||||
Sbjct: 357 ccacatggcgccccacgagtgctgcatcggc 387
>gb|CW480555.1|CW480555 fsbb001f239k22f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f239k22, DNA
sequence
Length = 361
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 335 atggcgttgctggcgacgagcgccctgcc 363
||||||||||||||||||||| |||||||
Sbjct: 235 atggcgttgctggcgacgagcaccctgcc 207
>gb|CD210102.1|CD210102 HS1_57_F11.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_57_F11_A012 3', mRNA sequence
Length = 692
Score = 50.1 bits (25), Expect = 3e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 335 atggcgttgctggcgacgagcgccctgcc 363
||||||||||||||||||||| |||||||
Sbjct: 300 atggcgttgctggcgacgagcaccctgcc 272
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 191,265
Number of Sequences: 832831
Number of extensions: 191265
Number of successful extensions: 54061
Number of sequences better than 0.5: 200
Number of HSP's better than 0.5 without gapping: 200
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53678
Number of HSP's gapped (non-prelim): 377
length of query: 744
length of database: 491,359,669
effective HSP length: 20
effective length of query: 724
effective length of database: 474,703,049
effective search space: 343685007476
effective search space used: 343685007476
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)