BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2591131.2.1
(596 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW215800.1|CW215800 104_648_11194751_116_37117_092 Sorgh... 494 e-138
gb|CW215801.1|CW215801 104_648_11194751_148_37118_092 Sorgh... 470 e-131
gb|CW132505.1|CW132505 104_515_11116248_116_34797_082 Sorgh... 454 e-126
gb|CL182296.1|CL182296 104_393_10897331_148_31921_323 Sorgh... 305 2e-081
gb|CW455692.1|CW455692 fsbb001f200l01f0 Sorghum methylation... 220 1e-055
gb|CW179534.1|CW179534 104_593_11160150_148_36628_019 Sorgh... 190 1e-046
gb|CW421780.1|CW421780 fsbb001f130l24f0 Sorghum methylation... 190 1e-046
gb|CW455693.1|CW455693 fsbb001f200l01k0 Sorghum methylation... 186 2e-045
gb|CL172101.1|CL172101 104_374_10889911_148_31774_199 Sorgh... 66 4e-009
gb|CW059494.1|CW059494 104_302_10519350_114_30165 Sorghum m... 66 4e-009
gb|CW143277.1|CW143277 104_535_11137329_148_34958_047 Sorgh... 66 4e-009
gb|CW177877.1|CW177877 104_591_11159265_116_36611_041 Sorgh... 66 4e-009
gb|CW318661.1|CW318661 104_811_11474070_148_35883_031 Sorgh... 66 4e-009
gb|BE917670.1|BE917670 OV1_6_F07.g1_A002 Ovary 1 (OV1) Sorg... 66 4e-009
gb|BG052868.1|BG052868 RHIZ2_15_B11.g1_A003 Rhizome2 (RHIZ2... 66 4e-009
gb|BG464039.1|BG464039 EM1_52_H10.g1_A002 Embryo 1 (EM1) So... 66 4e-009
gb|CW096538.1|CW096538 104_462_11001950_116_34349_059 Sorgh... 64 2e-008
gb|BG557559.1|BG557559 EM1_53_A06.g1_A002 Embryo 1 (EM1) So... 62 6e-008
gb|BG053558.1|BG053558 RHIZ2_10_G02.g1_A003 Rhizome2 (RHIZ2... 60 2e-007
gb|CL172100.1|CL172100 104_374_10889911_116_31775_199 Sorgh... 58 1e-006
gb|CW179533.1|CW179533 104_593_11160150_116_36624_019 Sorgh... 58 1e-006
gb|CW386714.1|CW386714 fsbb001f070m01f0 Sorghum methylation... 58 1e-006
gb|CW088882.1|CW088882 104_434_10948378_115_32585_047 Sorgh... 56 4e-006
gb|CN151243.1|CN151243 WOUND1_74_G01.b1_A002 Wounded leaves... 56 4e-006
gb|CW231485.1|CW231485 104_680_11211147_116_37343_004 Sorgh... 50 2e-004
gb|BG240827.1|BG240827 OV1_38_G09.g1_A002 Ovary 1 (OV1) Sor... 50 2e-004
gb|BI140900.1|BI140900 IP1_40_E08.b1_A002 Immature pannicle... 50 2e-004
gb|BG356043.2|BG356043 EM1_19_F04.g1_A002 Embryo 1 (EM1) So... 50 2e-004
gb|CF429993.1|CF429993 PH1_25_G07.g1_A002 Phosphorous-defic... 50 2e-004
gb|CN142636.1|CN142636 WOUND1_11_F01.b1_A002 Wounded leaves... 50 2e-004
gb|CW038341.1|CW038341 104_270_10504868_114_30385 Sorghum m... 48 0.001
gb|CW075930.1|CW075930 104_363_10809810_114_31800_258 Sorgh... 48 0.001
gb|CW075931.1|CW075931 104_363_10809810_116_31801_258 Sorgh... 48 0.001
gb|BG051930.1|BG051930 RHIZ2_6_F11.g1_A003 Rhizome2 (RHIZ2)... 48 0.001
gb|BG355666.1|BG355666 EM1_16_F05.g1_A002 Embryo 1 (EM1) So... 48 0.001
gb|BI075536.1|BI075536 IP1_21_G05.g1_A002 Immature pannicle... 48 0.001
gb|CF430219.1|CF430219 PH1_27_A08.b1_A002 Phosphorous-defic... 48 0.001
gb|CF430353.1|CF430353 PH1_27_A08.g1_A002 Phosphorous-defic... 48 0.001
gb|CN136158.1|CN136158 OX1_41_D05.b1_A002 Oxidatively-stres... 48 0.001
gb|CN136232.1|CN136232 OX1_41_D05.g1_A002 Oxidatively-stres... 48 0.001
gb|CX606996.1|CX606996 ANR1_6_C12.b1_A002 Anaerobic roots S... 48 0.001
gb|CX607081.1|CX607081 ANR1_6_C12.g1_A002 Anaerobic roots S... 48 0.001
gb|CX610991.1|CX610991 ANR1_22_B08.b1_A002 Anaerobic roots ... 48 0.001
gb|CX611078.1|CX611078 ANR1_22_B08.g1_A002 Anaerobic roots ... 48 0.001
gb|CX623191.1|CX623191 GABR1_68_F03.b1_A002 GA- or brassino... 48 0.001
gb|CL177978.1|CL177978 104_385_10894229_116_31914_293 Sorgh... 42 0.057
gb|CL177979.1|CL177979 104_385_10894229_148_31913_293 Sorgh... 42 0.057
gb|CW088881.1|CW088881 104_434_10948378_114_32602_047 Sorgh... 42 0.057
gb|CW325048.1|CW325048 104_819_11477484_116_35915_034 Sorgh... 42 0.057
gb|CW426483.1|CW426483 fsbb001f137o10k0 Sorghum methylation... 42 0.057
gb|CW479320.1|CW479320 fsbb001f237l21f0 Sorghum methylation... 42 0.057
gb|BG355810.1|BG355810 EM1_17_A05.g1_A002 Embryo 1 (EM1) So... 42 0.057
gb|BG556323.1|BG556323 EM1_68_E09.g1_A002 Embryo 1 (EM1) So... 42 0.057
gb|CW032533.1|CW032533 104_261_10501433_114_30363 Sorghum m... 40 0.23
gb|CW135331.1|CW135331 104_519_11117788_148_34827_002 Sorgh... 40 0.23
gb|CW146462.1|CW146462 104_539_11139005_148_34986_025 Sorgh... 40 0.23
gb|CW160556.1|CW160556 104_567_11149950_148_36420_029 Sorgh... 40 0.23
gb|CW220361.1|CW220361 104_655_11197308_116_37156_048 Sorgh... 40 0.23
gb|CW220362.1|CW220362 104_655_11197308_148_37155_048 Sorgh... 40 0.23
gb|CW242125.1|CW242125 104_701_11219158_148_37553_085 Sorgh... 40 0.23
gb|CW376600.1|CW376600 fsbb001f054i21k0 Sorghum methylation... 40 0.23
gb|CW470839.1|CW470839 fsbb001f224e15k0 Sorghum methylation... 40 0.23
gb|CW481549.1|CW481549 fsbb001f241d06f0 Sorghum methylation... 40 0.23
gb|DN551840.1|DN551840 pSPR-RT-A-H2_G06_S131 pSPR Sorghum p... 40 0.23
>gb|CW215800.1|CW215800 104_648_11194751_116_37117_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11194751, DNA
sequence
Length = 643
Score = 494 bits (249), Expect = e-138
Identities = 297/313 (94%)
Strand = Plus / Plus
Query: 179 tctactcggcgaactgcttgccctcgaacgtctgcgcgaacatccagtccgccggcgcca 238
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
Sbjct: 201 tctactcggcgaactgctttccctcaaacgtctgcgcgaacatccagtccgctggcgcga 260
Query: 239 cgctgtaggcggtgaccgtcctgcccctcccgccggtgacctcgaacgacagcggctggg 298
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 261 cactgtaggcggtgaccgtcctgcccctcccgccggtgacctcgaacgacagtggctggc 320
Query: 299 cgcggaggtcggcgtcgcactgccagttctggccccagttccgccccatcgggatccacc 358
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 321 cgcggaggtcggcgtcgcactgccagttctggccccagttccgtcccatcgggatccacc 380
Query: 359 ccgtcctcgagcccttcaccttcacggccgccacctcgccgtccgccgccacgttggtga 418
|||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 381 ccgtcctcgaccctttcaccttcacggccgtcacctcgccgtccgccgccacgttggtga 440
Query: 419 tgagcacctgcaggaagtgggcgctaccggagatggtgaaccgcatgccgcccgccctgt 478
| ||||||||||||||||| || || |||| |||||||||||||||||||||||||||||
Sbjct: 441 tcagcacctgcaggaagtgagcactgccggtgatggtgaaccgcatgccgcccgccctgt 500
Query: 479 cgcagctcaccct 491
|||||||||||||
Sbjct: 501 cgcagctcaccct 513
>gb|CW215801.1|CW215801 104_648_11194751_148_37118_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11194751, DNA
sequence
Length = 659
Score = 470 bits (237), Expect = e-131
Identities = 285/301 (94%)
Strand = Plus / Minus
Query: 191 actgcttgccctcgaacgtctgcgcgaacatccagtccgccggcgccacgctgtaggcgg 250
||||||| ||||| |||||||||||||||||||||||||| ||||| || ||||||||||
Sbjct: 659 actgctttccctcaaacgtctgcgcgaacatccagtccgctggcgcgacactgtaggcgg 600
Query: 251 tgaccgtcctgcccctcccgccggtgacctcgaacgacagcggctgggcgcggaggtcgg 310
|||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||
Sbjct: 599 tgaccgtcctgcccctcccgccggtgacctcgaacgacagtggctggccgcggaggtcgg 540
Query: 311 cgtcgcactgccagttctggccccagttccgccccatcgggatccaccccgtcctcgagc 370
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 539 cgtcgcactgccagttctggccccagttccgtcccatcgggatccaccccgtcctcgacc 480
Query: 371 ccttcaccttcacggccgccacctcgccgtccgccgccacgttggtgatgagcacctgca 430
| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||
Sbjct: 479 ctttcaccttcacggccgtcacctcgccgtccgccgccacgttggtgatcagcacctgca 420
Query: 431 ggaagtgggcgctaccggagatggtgaaccgcatgccgcccgccctgtcgcagctcaccc 490
||||||| || || |||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 ggaagtgagcactgccggtgatggtgaaccgcatgccgcccgccctgtcgcagctcaccc 360
Query: 491 t 491
|
Sbjct: 359 t 359
>gb|CW132505.1|CW132505 104_515_11116248_116_34797_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11116248, DNA
sequence
Length = 643
Score = 454 bits (229), Expect = e-126
Identities = 277/293 (94%)
Strand = Plus / Plus
Query: 179 tctactcggcgaactgcttgccctcgaacgtctgcgcgaacatccagtccgccggcgcca 238
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
Sbjct: 351 tctactcggcgaactgctttccctcaaacgtctgcgcgaacatccagtccgctggcgcga 410
Query: 239 cgctgtaggcggtgaccgtcctgcccctcccgccggtgacctcgaacgacagcggctggg 298
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 411 cactgtaggcggtgaccgtcctgcccctcccgccggtgacctcgaacgacagtggctggc 470
Query: 299 cgcggaggtcggcgtcgcactgccagttctggccccagttccgccccatcgggatccacc 358
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 471 cgcggaggtcggcgtcgcactgccagttctggccccagttccgtcccatcgggatccacc 530
Query: 359 ccgtcctcgagcccttcaccttcacggccgccacctcgccgtccgccgccacgttggtga 418
|||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 531 ccgtcctcgaccctttcaccttcacggccgtcacctcgccgtccgccgccacgttggtga 590
Query: 419 tgagcacctgcaggaagtgggcgctaccggagatggtgaaccgcatgccgccc 471
| ||||||||||||||||| || || |||| ||||||||||||||||||||||
Sbjct: 591 tcagcacctgcaggaagtgagcactgccggtgatggtgaaccgcatgccgccc 643
>gb|CL182296.1|CL182296 104_393_10897331_148_31921_323 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10897331, DNA
sequence
Length = 709
Score = 305 bits (154), Expect = 2e-081
Identities = 181/190 (95%)
Strand = Plus / Minus
Query: 302 ggaggtcggcgtcgcactgccagttctggccccagttccgccccatcgggatccaccccg 361
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 709 ggaggtcggcgtcgcactgccagttctggccccagttccgtcccatcgggatccaccccg 650
Query: 362 tcctcgagcccttcaccttcacggccgccacctcgccgtccgccgccacgttggtgatga 421
||||||| || |||||||||||||||| |||||||||||||||||||||||||||||| |
Sbjct: 649 tcctcgaccctttcaccttcacggccgtcacctcgccgtccgccgccacgttggtgatca 590
Query: 422 gcacctgcaggaagtgggcgctaccggagatggtgaaccgcatgccgcccgccctgtcgc 481
|||||||||||||||| || || |||| ||||||||||||||||||||||||||||||||
Sbjct: 589 gcacctgcaggaagtgagcactgccggtgatggtgaaccgcatgccgcccgccctgtcgc 530
Query: 482 agctcaccct 491
||||||||||
Sbjct: 529 agctcaccct 520
>gb|CW455692.1|CW455692 fsbb001f200l01f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f200l01, DNA
sequence
Length = 584
Score = 220 bits (111), Expect = 1e-055
Identities = 135/143 (94%)
Strand = Plus / Minus
Query: 349 gggatccaccccgtcctcgagcccttcaccttcacggccgccacctcgccgtccgccgcc 408
|||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||
Sbjct: 584 gggatccaccccgtcctcgaccctttcaccttcacggccgtcacctcgccgtccgccgcc 525
Query: 409 acgttggtgatgagcacctgcaggaagtgggcgctaccggagatggtgaaccgcatgccg 468
||||||||||| ||||||||||||||||| || || |||| |||||||||||||||||||
Sbjct: 524 acgttggtgatcagcacctgcaggaagtgagcactgccggtgatggtgaaccgcatgccg 465
Query: 469 cccgccctgtcgcagctcaccct 491
|||||||||||||||||||||||
Sbjct: 464 cccgccctgtcgcagctcaccct 442
>gb|CW179534.1|CW179534 104_593_11160150_148_36628_019 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11160150, DNA
sequence
Length = 669
Score = 190 bits (96), Expect = 1e-046
Identities = 105/108 (97%)
Strand = Plus / Minus
Query: 489 cctccggaactgcaccggcacgatgccggccttggccttggcgacgcggaggaacgcggc 548
||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||
Sbjct: 380 cctccggaactgcacgggcacgatgtcggccttggccttggcgacgcggaggaaggcggc 321
Query: 549 ctccgacagctcgaggtgctcccgcgggaagttgcaccagccgccggc 596
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 ctccgacagctcgaggtgctcccgcgggaagttgcaccagccgccggc 273
>gb|CW421780.1|CW421780 fsbb001f130l24f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f130l24, DNA
sequence
Length = 743
Score = 190 bits (96), Expect = 1e-046
Identities = 105/108 (97%)
Strand = Plus / Plus
Query: 489 cctccggaactgcaccggcacgatgccggccttggccttggcgacgcggaggaacgcggc 548
||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||
Sbjct: 96 cctccggaactgcacgggcacgatgtcggccttggccttggcgacgcggaggaaggcggc 155
Query: 549 ctccgacagctcgaggtgctcccgcgggaagttgcaccagccgccggc 596
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 156 ctccgacagctcgaggtgctcccgcgggaagttgcaccagccgccggc 203
>gb|CW455693.1|CW455693 fsbb001f200l01k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f200l01, DNA
sequence
Length = 596
Score = 186 bits (94), Expect = 2e-045
Identities = 112/118 (94%)
Strand = Plus / Plus
Query: 179 tctactcggcgaactgcttgccctcgaacgtctgcgcgaacatccagtccgccggcgcca 238
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
Sbjct: 479 tctactcggcgaactgctttccctcaaacgtctgcgcgaacatccagtccgctggcgcga 538
Query: 239 cgctgtaggcggtgaccgtcctgcccctcccgccggtgacctcgaacgacagcggctg 296
| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 539 cactgtaggcggtgaccgtcctgcccctcccgccggtgacctcgaacgacagtggctg 596
>gb|CL172101.1|CL172101 104_374_10889911_148_31774_199 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10889911, DNA
sequence
Length = 766
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 179 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 238
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 239 cccagttccgcgacatgggctgccaccccgtccgcgagccc 279
>gb|CW059494.1|CW059494 104_302_10519350_114_30165 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10519350, DNA
sequence
Length = 558
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 210 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 151
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 150 cccagttccgcgacatgggctgccaccccgtccgcgagccc 110
>gb|CW143277.1|CW143277 104_535_11137329_148_34958_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11137329, DNA
sequence
Length = 593
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 473 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 414
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 413 cccagttccgcgacatgggctgccaccccgtccgcgagccc 373
>gb|CW177877.1|CW177877 104_591_11159265_116_36611_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11159265, DNA
sequence
Length = 627
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 483 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 542
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 543 cccagttccgcgacatgggctgccaccccgtccgcgagccc 583
>gb|CW318661.1|CW318661 104_811_11474070_148_35883_031 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11474070, DNA
sequence
Length = 692
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 281 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 340
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 341 cccagttccgcgacatgggctgccaccccgtccgcgagccc 381
>gb|BE917670.1|BE917670 OV1_6_F07.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA sequence
Length = 673
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 209 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 150
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 149 cccagttccgcgacatgggctgccaccccgtccgcgagccc 109
>gb|BG052868.1|BG052868 RHIZ2_15_B11.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 576
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 109 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 50
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 49 cccagttccgcgacatgggctgccaccccgtccgcgagccc 9
>gb|BG464039.1|BG464039 EM1_52_H10.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 664
Score = 65.9 bits (33), Expect = 4e-009
Identities = 84/101 (83%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 187 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 128
Query: 332 cccagttccgccccatcgggatccaccccgtcctcgagccc 372
||||||||||| ||| || ||||||||||| |||||||
Sbjct: 127 cccagttccgcgacatgggctgccaccccgtccgcgagccc 87
>gb|CW096538.1|CW096538 104_462_11001950_116_34349_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11001950, DNA
sequence
Length = 674
Score = 63.9 bits (32), Expect = 2e-008
Identities = 32/32 (100%)
Strand = Plus / Plus
Query: 565 tgctcccgcgggaagttgcaccagccgccggc 596
||||||||||||||||||||||||||||||||
Sbjct: 1 tgctcccgcgggaagttgcaccagccgccggc 32
>gb|BG557559.1|BG557559 EM1_53_A06.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 577
Score = 61.9 bits (31), Expect = 6e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 98 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 39
Query: 332 cccagttccgc 342
|||||||||||
Sbjct: 38 cccagttccgc 28
>gb|BG053558.1|BG053558 RHIZ2_10_G02.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 563
Score = 60.0 bits (30), Expect = 2e-007
Identities = 60/70 (85%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 70 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 11
Query: 332 cccagttccg 341
||||||||||
Sbjct: 10 cccagttccg 1
>gb|CL172100.1|CL172100 104_374_10889911_116_31775_199 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10889911, DNA
sequence
Length = 762
Score = 58.0 bits (29), Expect = 1e-006
Identities = 59/69 (85%)
Strand = Plus / Minus
Query: 304 aggtcggcgtcgcactgccagttctggccccagttccgccccatcgggatccaccccgtc 363
||||| |||| || ||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 745 aggtccgcgttgctctgccagttctggccccagttccgcgacatgggctgccaccccgtc 686
Query: 364 ctcgagccc 372
| |||||||
Sbjct: 685 cgcgagccc 677
>gb|CW179533.1|CW179533 104_593_11160150_116_36624_019 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11160150, DNA
sequence
Length = 678
Score = 58.0 bits (29), Expect = 1e-006
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 463 atgccgcccgccctgtcgcagctcaccct 491
|||||||||||||||||||||||||||||
Sbjct: 1 atgccgcccgccctgtcgcagctcaccct 29
>gb|CW386714.1|CW386714 fsbb001f070m01f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f070m01, DNA
sequence
Length = 339
Score = 58.0 bits (29), Expect = 1e-006
Identities = 59/69 (85%)
Strand = Plus / Minus
Query: 304 aggtcggcgtcgcactgccagttctggccccagttccgccccatcgggatccaccccgtc 363
||||| |||| || ||||||||||||||||||||||||| ||| || ||||||||||
Sbjct: 200 aggtccgcgttgctctgccagttctggccccagttccgcgacatgggctgccaccccgtc 141
Query: 364 ctcgagccc 372
| |||||||
Sbjct: 140 cgcgagccc 132
>gb|CW088882.1|CW088882 104_434_10948378_115_32585_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10948378, DNA
sequence
Length = 710
Score = 56.0 bits (28), Expect = 4e-006
Identities = 42/44 (95%), Gaps = 2/44 (4%)
Strand = Plus / Minus
Query: 553 gacagctcgaggtgctcccgcgggaagttgcaccagccgccggc 596
||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 710 gacagctcgag-tgctcccgcggga-gttgcaccagccgccggc 669
>gb|CN151243.1|CN151243 WOUND1_74_G01.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_74_G01_A002 3', mRNA sequence
Length = 681
Score = 56.0 bits (28), Expect = 4e-006
Identities = 82/100 (82%)
Strand = Plus / Minus
Query: 273 ggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggcc 332
|||||||| ||||||||||| ||| || ||||| |||| || |||||||||||||||
Sbjct: 195 ggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggcc 136
Query: 333 ccagttccgccccatcgggatccaccccgtcctcgagccc 372
||| |||||| ||| || ||||||||||| |||||||
Sbjct: 135 ccaattccgcgacatgggctgccaccccgtccgcgagccc 96
>gb|CW231485.1|CW231485 104_680_11211147_116_37343_004 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11211147, DNA
sequence
Length = 736
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccg 341
|||||||||||||||||||||||||
Sbjct: 275 actgccagttctggccccagttccg 251
>gb|BG240827.1|BG240827 OV1_38_G09.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 618
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccg 341
|||||||||||||||||||||||||
Sbjct: 193 actgccagttctggccccagttccg 169
>gb|BI140900.1|BI140900 IP1_40_E08.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 622
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccg 341
|||||||||||||||||||||||||
Sbjct: 551 actgccagttctggccccagttccg 527
>gb|BG356043.2|BG356043 EM1_19_F04.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 596
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccg 341
|||||||||||||||||||||||||
Sbjct: 29 actgccagttctggccccagttccg 5
>gb|CF429993.1|CF429993 PH1_25_G07.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_25_G07_A002 5', mRNA sequence
Length = 823
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccg 341
|||||||||||||||||||||||||
Sbjct: 759 actgccagttctggccccagttccg 735
>gb|CN142636.1|CN142636 WOUND1_11_F01.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_11_F01_A002 3', mRNA sequence
Length = 702
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 317 actgccagttctggccccagttccg 341
|||||||||||||||||||||||||
Sbjct: 89 actgccagttctggccccagttccg 65
>gb|CW038341.1|CW038341 104_270_10504868_114_30385 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10504868, DNA
sequence
Length = 715
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 306 ctgccagttctggccccagttccg 329
>gb|CW075930.1|CW075930 104_363_10809810_114_31800_258 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809810, DNA
sequence
Length = 719
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 575 ctgccagttctggccccagttccg 552
>gb|CW075931.1|CW075931 104_363_10809810_116_31801_258 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809810, DNA
sequence
Length = 503
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 283 ctgccagttctggccccagttccg 306
>gb|BG051930.1|BG051930 RHIZ2_6_F11.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 588
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 55 ctgccagttctggccccagttccg 32
>gb|BG355666.1|BG355666 EM1_16_F05.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 648
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 82 ctgccagttctggccccagttccg 59
>gb|BI075536.1|BI075536 IP1_21_G05.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 564
Score = 48.1 bits (24), Expect = 0.001
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 272 cggtgacctcgaacgacagcggctgggcgcggaggtcggcgtcgcactgccagttctggc 331
||||||||| ||||||||||| ||| || ||||| |||| || ||||||||||||||
Sbjct: 64 cggtgacctggaacgacagcgcctgcccgtccaggtccgcgttgctctgccagttctggc 5
Query: 332 ccca 335
||||
Sbjct: 4 ccca 1
>gb|CF430219.1|CF430219 PH1_27_A08.b1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_27_A08_A002 3', mRNA sequence
Length = 685
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 60 ctgccagttctggccccagttccg 37
>gb|CF430353.1|CF430353 PH1_27_A08.g1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_27_A08_A002 5', mRNA sequence
Length = 787
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 709 ctgccagttctggccccagttccg 686
>gb|CN136158.1|CN136158 OX1_41_D05.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_41_D05_A002 3', mRNA sequence
Length = 725
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 370 ctgccagttctggccccagttccg 347
>gb|CN136232.1|CN136232 OX1_41_D05.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_41_D05_A002 5', mRNA sequence
Length = 840
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 705 ctgccagttctggccccagttccg 682
>gb|CX606996.1|CX606996 ANR1_6_C12.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_6_C12_A002 3', mRNA sequence
Length = 699
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 108 ctgccagttctggccccagttccg 85
>gb|CX607081.1|CX607081 ANR1_6_C12.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_6_C12_A002 5', mRNA sequence
Length = 705
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 692 ctgccagttctggccccagttccg 669
>gb|CX610991.1|CX610991 ANR1_22_B08.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_22_B08_A002 3', mRNA sequence
Length = 731
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 152 ctgccagttctggccccagttccg 129
>gb|CX611078.1|CX611078 ANR1_22_B08.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_22_B08_A002 5', mRNA sequence
Length = 605
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 577 ctgccagttctggccccagttccg 554
>gb|CX623191.1|CX623191 GABR1_68_F03.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_68_F03_A002 3', mRNA sequence
Length = 680
Score = 48.1 bits (24), Expect = 0.001
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagttccg 341
||||||||||||||||||||||||
Sbjct: 96 ctgccagttctggccccagttccg 73
>gb|CL177978.1|CL177978 104_385_10894229_116_31914_293 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894229, DNA
sequence
Length = 704
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagtt 338
|||||||||||||||||||||
Sbjct: 315 ctgccagttctggccccagtt 295
>gb|CL177979.1|CL177979 104_385_10894229_148_31913_293 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894229, DNA
sequence
Length = 731
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 318 ctgccagttctggccccagtt 338
|||||||||||||||||||||
Sbjct: 686 ctgccagttctggccccagtt 706
>gb|CW088881.1|CW088881 104_434_10948378_114_32602_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10948378, DNA
sequence
Length = 699
Score = 42.1 bits (21), Expect = 0.057
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 489 cctccggaactgcaccggcacgatg 513
||||||||||||||| |||||||||
Sbjct: 674 cctccggaactgcacgggcacgatg 698
>gb|CW325048.1|CW325048 104_819_11477484_116_35915_034 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11477484, DNA
sequence
Length = 612
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagtt 338
|||||||||||||||||||||
Sbjct: 222 ctgccagttctggccccagtt 202
>gb|CW426483.1|CW426483 fsbb001f137o10k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f137o10, DNA
sequence
Length = 727
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 318 ctgccagttctggccccagtt 338
|||||||||||||||||||||
Sbjct: 209 ctgccagttctggccccagtt 189
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 177,840
Number of Sequences: 832831
Number of extensions: 177840
Number of successful extensions: 49130
Number of sequences better than 0.5: 64
Number of HSP's better than 0.5 without gapping: 63
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 48974
Number of HSP's gapped (non-prelim): 133
length of query: 596
length of database: 491,359,669
effective HSP length: 19
effective length of query: 577
effective length of database: 475,535,880
effective search space: 274384202760
effective search space used: 274384202760
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)