BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2494085.2.4
         (645 letters)

Database: Sorghum_nucl_with_EST.fasta 
           832,831 sequences; 491,359,669 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BZ350671.1|BZ350671  ht59c02.g1 WGS-SbicolorF (JM107 adap...   153   2e-035
gb|CW042188.1|CW042188  104_276_10506979_114_30482 Sorghum m...   153   2e-035
gb|CW260825.1|CW260825  104_727_11229176_116_35196_020 Sorgh...   153   2e-035
gb|BG049431.1|BG049431  OV1_19_H02.g1_A002 Ovary 1 (OV1) Sor...   153   2e-035
gb|BG240262.1|BG240262  OV1_19_H02.b1_A002 Ovary 1 (OV1) Sor...   153   2e-035
gb|CL157218.1|CL157218  104_344_10783391_116_31374_335 Sorgh...   139   4e-031
gb|CW260826.1|CW260826  104_727_11229176_148_35200_020 Sorgh...   139   4e-031
gb|CW487350.1|CW487350  fsbb001f253c16f0 Sorghum methylation...   139   4e-031
gb|BG240504.1|BG240504  OV1_30_G12.b1_A002 Ovary 1 (OV1) Sor...   139   4e-031
gb|CL180693.1|CL180693  104_390_10896198_116_31930_342 Sorgh...   125   5e-027
gb|CW092637.1|CW092637  104_455_10999283_114_33047_044 Sorgh...   103   2e-020
gb|CW308362.1|CW308362  104_796_11468627_116_35732_036 Sorgh...    72   7e-011
gb|CL180694.1|CL180694  104_390_10896198_148_31929_342 Sorgh...    64   2e-008
gb|CL163908.1|CL163908  104_357_10807504_116_31813_256 Sorgh...    62   7e-008
gb|CW092638.1|CW092638  104_455_10999283_116_33051_044 Sorgh...    56   4e-006
gb|BG239927.1|BG239927  OV1_30_G12.g1_A002 Ovary 1 (OV1) Sor...    54   2e-005
gb|CW302893.1|CW302893  104_787_11464957_148_35670_059 Sorgh...    46   0.004
>gb|BZ350671.1|BZ350671 ht59c02.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
           bicolor genomic clone ht59c02 5', DNA sequence
          Length = 551

 Score =  153 bits (77), Expect = 2e-035
 Identities = 131/149 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           |||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 122 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 181

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||  
Sbjct: 182 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 241

                                        
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
            || |||| ||||||| ||||||||||||
Sbjct: 242 tgaggctcggcgactcacacttcctcgcc 270

 Score = 54.0 bits (27), Expect = 2e-005
 Identities = 50/57 (87%), Gaps = 3/57 (5%)
 Strand = Plus / Plus

                                                                    
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
           |||||| ||||||||| | |||||||||| |||||||||   |||||||||||||||
Sbjct: 451 gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 504
>gb|CW042188.1|CW042188 104_276_10506979_114_30482 Sorghum methylation filtered library
           (LibID: 104) Sorghum bicolor genomic clone 10506979, DNA
           sequence
          Length = 670

 Score =  153 bits (77), Expect = 2e-035
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           |||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 300 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 241

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||  
Sbjct: 240 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 181

                                        
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
            || |||| ||||||| ||||||||||||
Sbjct: 180 tgaggctcggcgactcacacttcctcgcc 152
>gb|CW260825.1|CW260825 104_727_11229176_116_35196_020 Sorghum methylation filtered library
           (LibID: 104) Sorghum bicolor genomic clone 11229176, DNA
           sequence
          Length = 654

 Score =  153 bits (77), Expect = 2e-035
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           |||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 415 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 356

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||  
Sbjct: 355 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 296

                                        
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
            || |||| ||||||| ||||||||||||
Sbjct: 295 tgaggctcggcgactcacacttcctcgcc 267

 Score = 54.0 bits (27), Expect = 2e-005
 Identities = 50/57 (87%), Gaps = 3/57 (5%)
 Strand = Plus / Minus

                                                                    
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
           |||||| ||||||||| | |||||||||| |||||||||   |||||||||||||||
Sbjct: 87  gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 34
>gb|BG049431.1|BG049431 OV1_19_H02.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
           sequence
          Length = 344

 Score =  153 bits (77), Expect = 2e-035
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           |||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 269 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 210

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||  
Sbjct: 209 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 150

                                        
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
            || |||| ||||||| ||||||||||||
Sbjct: 149 tgaggctcggcgactcacacttcctcgcc 121

 Score = 54.0 bits (27), Expect = 2e-005
 Identities = 50/57 (87%), Gaps = 3/57 (5%)
 Strand = Plus / Minus

                                                                    
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
           |||||| ||||||||| | |||||||||| |||||||||   |||||||||||||||
Sbjct: 73  gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 20
>gb|BG240262.1|BG240262 OV1_19_H02.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
           sequence
          Length = 284

 Score =  153 bits (77), Expect = 2e-035
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           |||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 269 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 210

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||  
Sbjct: 209 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 150

                                        
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
            || |||| ||||||| ||||||||||||
Sbjct: 149 tgaggctcggcgactcacacttcctcgcc 121

 Score = 54.0 bits (27), Expect = 2e-005
 Identities = 50/57 (87%), Gaps = 3/57 (5%)
 Strand = Plus / Minus

                                                                    
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
           |||||| ||||||||| | |||||||||| |||||||||   |||||||||||||||
Sbjct: 73  gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 20
>gb|CL157218.1|CL157218 104_344_10783391_116_31374_335 Sorghum methylation-filtered library
           (LibID: 104) Sorghum bicolor genomic clone 10783391, DNA
           sequence
          Length = 726

 Score =  139 bits (70), Expect = 4e-031
 Identities = 142/166 (85%)
 Strand = Plus / Plus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           ||||||||||| |||| ||||||||||||||||||||||| ||||||  ||| ||||| |
Sbjct: 107 actagcagtccttggtacagaagcagcggtggcgtaggcctttgcacttgccaccggtaa 166

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| ||| |||| ||| |||||||||| ||||| || ||||| ||||||| |||||
Sbjct: 167 aaccttcagtccggcaaacggttgcgcagtttgcgtctctggagcagggtccctggaagc 226

                                                         
Query: 402 ggaagctctgcgactcgcacttcctcgccgacaccatagtcaccgg 447
           ||  |||| ||||||| ||||||||||||    |||||||||||||
Sbjct: 227 ggtggctcggcgactcacacttcctcgccagtgccatagtcaccgg 272

 Score = 54.0 bits (27), Expect = 2e-005
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
           |||||||||||||||| | ||||| ||||||||||||||
Sbjct: 538 gagcaggaggaggaccgcaaaaagtttggtggagagacc 576
>gb|CW260826.1|CW260826 104_727_11229176_148_35200_020 Sorghum methylation filtered library
           (LibID: 104) Sorghum bicolor genomic clone 11229176, DNA
           sequence
          Length = 548

 Score =  139 bits (70), Expect = 4e-031
 Identities = 106/118 (89%)
 Strand = Plus / Plus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           |||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 414 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 473

                                                                     
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaa 399
           ||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||
Sbjct: 474 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaa 531
>gb|CW487350.1|CW487350 fsbb001f253c16f0 Sorghum methylation filtered library (LibID: 104)
           Sorghum bicolor genomic clone fsbb001f253c16, DNA
           sequence
          Length = 813

 Score =  139 bits (70), Expect = 4e-031
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           ||||||||||| |||| ||||||||||||||||||||||| ||||||  ||| ||||| |
Sbjct: 331 actagcagtccttggtacagaagcagcggtggcgtaggcctttgcacttgccaccggtaa 272

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| ||| |||| ||| |||||||||| ||||| || ||||| ||||||| |||||
Sbjct: 271 aaccttcagtccggcaaacggttgcgcagtttgcgtctctggagcagggtccctggaagc 212

                                                         
Query: 402 ggaagctctgcgactcgcacttcctcgccgacaccatagtcaccgg 447
           ||  |||| ||||||| ||||||||||||    |||||||||||||
Sbjct: 211 ggtggctcggcgactcacacttcctcgccagtgccatagtcaccgg 166
>gb|BG240504.1|BG240504 OV1_30_G12.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
           sequence
          Length = 429

 Score =  139 bits (70), Expect = 4e-031
 Identities = 142/166 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           ||||||||||| |||| ||||||||||||||||||||||| ||||||  ||| ||||| |
Sbjct: 280 actagcagtccttggtacagaagcagcggtggcgtaggcctttgcacttgccaccggtaa 221

                                                                       
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
           ||||||| ||| |||| ||| |||||||||| ||||| || ||||| ||||||| |||||
Sbjct: 220 aaccttcagtccggcaaacggttgcgcagtttgcgtctctggagcagggtccctggaagc 161

                                                         
Query: 402 ggaagctctgcgactcgcacttcctcgccgacaccatagtcaccgg 447
           ||  |||| ||||||| ||||||||||||    |||||||||||||
Sbjct: 160 ggtggctcggcgactcacacttcctcgccagtgccatagtcaccgg 115

 Score = 54.0 bits (27), Expect = 2e-005
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
           |||||||||||||||| | ||||| ||||||||||||||
Sbjct: 81  gagcaggaggaggaccgcaaaaagtttggtggagagacc 43
>gb|CL180693.1|CL180693 104_390_10896198_116_31930_342 Sorghum methylation-filtered library
           (LibID: 104) Sorghum bicolor genomic clone 10896198, DNA
           sequence
          Length = 484

 Score =  125 bits (63), Expect = 5e-027
 Identities = 126/147 (85%)
 Strand = Plus / Minus

                                                                       
Query: 284 tagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtgaaa 343
           |||||||||||||| |||||||||||| ||||||||||  |||||  ||| | ||| |||
Sbjct: 457 tagcagtccctggtacagaagcagcggcggcgtaggcctctgcacttgccactggtaaaa 398

                                                                       
Query: 344 ccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagcgg 403
           ||||| |||||||| ||| |||| |||||  ||||||||||||| |||||||||||   |
Sbjct: 397 ccttctgtcaggcaaacggttgcacagttttcgtccctcgagcagggtcccttgaatttg 338

                                      
Query: 404 aagctctgcgactcgcacttcctcgcc 430
           ||||||| ||||| |||||||||||||
Sbjct: 337 aagctcttcgactggcacttcctcgcc 311

 Score = 61.9 bits (31), Expect = 7e-008
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
           |||||||||||||||| | ||||||||||||||||||||
Sbjct: 150 gagcaggaggaggaccgcaaaaagcttggtggagagacc 112
>gb|CW092637.1|CW092637 104_455_10999283_114_33047_044 Sorghum methylation filtered library
           (LibID: 104) Sorghum bicolor genomic clone 10999283, DNA
           sequence
          Length = 700

 Score =  103 bits (52), Expect = 2e-020
 Identities = 112/132 (84%)
 Strand = Plus / Minus

                                                                       
Query: 299 cagaagcagcggtggcgtaggcccttgcacacgccgccggtgaaaccttcggtcaggcag 358
           |||||||||||| ||||||||||  |||||  ||| | ||| |||||||| |||||||| 
Sbjct: 698 cagaagcagcggcggcgtaggcctctgcacttgccactggtaaaaccttctgtcaggcaa 639

                                                                       
Query: 359 acgtttgcgcagttggcgtccctcgagcaaggtcccttgaagcggaagctctgcgactcg 418
           ||| |||| |||||  ||||||||||||| |||||||||||   |||||||| ||||| |
Sbjct: 638 acggttgcacagttttcgtccctcgagcagggtcccttgaatttgaagctcttcgactgg 579

                       
Query: 419 cacttcctcgcc 430
           ||||||||||||
Sbjct: 578 cacttcctcgcc 567

 Score = 61.9 bits (31), Expect = 7e-008
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
           |||||||||||||||| | ||||||||||||||||||||
Sbjct: 406 gagcaggaggaggaccgcaaaaagcttggtggagagacc 368
>gb|CW308362.1|CW308362 104_796_11468627_116_35732_036 Sorghum methylation filtered library
           (LibID: 104) Sorghum bicolor genomic clone 11468627, DNA
           sequence
          Length = 747

 Score = 71.9 bits (36), Expect = 7e-011
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
           |||||||||||||||| |||||||||||| ||||||||||  |||||  ||| | ||| |
Sbjct: 79  actagcagtccctggtacagaagcagcggcggcgtaggcctctgcacttgccactggtaa 20

                           
Query: 342 aaccttcggtcaggca 357
           ||||||| ||||||||
Sbjct: 19  aaccttctgtcaggca 4
>gb|CL180694.1|CL180694 104_390_10896198_148_31929_342 Sorghum methylation-filtered library
           (LibID: 104) Sorghum bicolor genomic clone 10896198, DNA
           sequence
          Length = 676

 Score = 63.9 bits (32), Expect = 2e-008
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcc 321
           |||||||||||||||| |||||||||||| ||||||||||
Sbjct: 616 actagcagtccctggtacagaagcagcggcggcgtaggcc 655
>gb|CL163908.1|CL163908 104_357_10807504_116_31813_256 Sorghum methylation-filtered library
           (LibID: 104) Sorghum bicolor genomic clone 10807504, DNA
           sequence
          Length = 734

 Score = 61.9 bits (31), Expect = 7e-008
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                  
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
           |||||||||||||||| | ||||||||||||||||||||
Sbjct: 94  gagcaggaggaggaccgcaaaaagcttggtggagagacc 132
>gb|CW092638.1|CW092638 104_455_10999283_116_33051_044 Sorghum methylation filtered library
           (LibID: 104) Sorghum bicolor genomic clone 10999283, DNA
           sequence
          Length = 589

 Score = 56.0 bits (28), Expect = 4e-006
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 282 actagcagtccctggtgcagaagcagcggtggcgta 317
           |||||||||||||||| |||||||||||| ||||||
Sbjct: 519 actagcagtccctggtacagaagcagcggcggcgta 554
>gb|BG239927.1|BG239927 OV1_30_G12.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
           sequence
          Length = 169

 Score = 54.0 bits (27), Expect = 2e-005
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
           |||||||||||||||| | ||||| ||||||||||||||
Sbjct: 81  gagcaggaggaggaccgcaaaaagtttggtggagagacc 43
>gb|CW302893.1|CW302893 104_787_11464957_148_35670_059 Sorghum methylation filtered library
           (LibID: 104) Sorghum bicolor genomic clone 11464957, DNA
           sequence
          Length = 487

 Score = 46.1 bits (23), Expect = 0.004
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
           |||||||||  ||||| | ||||||||||||||||||||
Sbjct: 424 gagcaggagagggaccgcaaaaagcttggtggagagacc 386
  Database: Sorghum_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:54 PM
  Number of letters in database: 491,359,669
  Number of sequences in database:  832,831
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 213,342
Number of Sequences: 832831
Number of extensions: 213342
Number of successful extensions: 71938
Number of sequences better than  0.5: 17
Number of HSP's better than  0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71905
Number of HSP's gapped (non-prelim): 29
length of query: 645
length of database: 491,359,669
effective HSP length: 19
effective length of query: 626
effective length of database: 475,535,880
effective search space: 297685460880
effective search space used: 297685460880
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)