BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2494085.2.4
(645 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BZ350671.1|BZ350671 ht59c02.g1 WGS-SbicolorF (JM107 adap... 153 2e-035
gb|CW042188.1|CW042188 104_276_10506979_114_30482 Sorghum m... 153 2e-035
gb|CW260825.1|CW260825 104_727_11229176_116_35196_020 Sorgh... 153 2e-035
gb|BG049431.1|BG049431 OV1_19_H02.g1_A002 Ovary 1 (OV1) Sor... 153 2e-035
gb|BG240262.1|BG240262 OV1_19_H02.b1_A002 Ovary 1 (OV1) Sor... 153 2e-035
gb|CL157218.1|CL157218 104_344_10783391_116_31374_335 Sorgh... 139 4e-031
gb|CW260826.1|CW260826 104_727_11229176_148_35200_020 Sorgh... 139 4e-031
gb|CW487350.1|CW487350 fsbb001f253c16f0 Sorghum methylation... 139 4e-031
gb|BG240504.1|BG240504 OV1_30_G12.b1_A002 Ovary 1 (OV1) Sor... 139 4e-031
gb|CL180693.1|CL180693 104_390_10896198_116_31930_342 Sorgh... 125 5e-027
gb|CW092637.1|CW092637 104_455_10999283_114_33047_044 Sorgh... 103 2e-020
gb|CW308362.1|CW308362 104_796_11468627_116_35732_036 Sorgh... 72 7e-011
gb|CL180694.1|CL180694 104_390_10896198_148_31929_342 Sorgh... 64 2e-008
gb|CL163908.1|CL163908 104_357_10807504_116_31813_256 Sorgh... 62 7e-008
gb|CW092638.1|CW092638 104_455_10999283_116_33051_044 Sorgh... 56 4e-006
gb|BG239927.1|BG239927 OV1_30_G12.g1_A002 Ovary 1 (OV1) Sor... 54 2e-005
gb|CW302893.1|CW302893 104_787_11464957_148_35670_059 Sorgh... 46 0.004
>gb|BZ350671.1|BZ350671 ht59c02.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ht59c02 5', DNA sequence
Length = 551
Score = 153 bits (77), Expect = 2e-035
Identities = 131/149 (87%)
Strand = Plus / Plus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
|||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 122 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 181
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||
Sbjct: 182 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 241
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
|| |||| ||||||| ||||||||||||
Sbjct: 242 tgaggctcggcgactcacacttcctcgcc 270
Score = 54.0 bits (27), Expect = 2e-005
Identities = 50/57 (87%), Gaps = 3/57 (5%)
Strand = Plus / Plus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
|||||| ||||||||| | |||||||||| ||||||||| |||||||||||||||
Sbjct: 451 gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 504
>gb|CW042188.1|CW042188 104_276_10506979_114_30482 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10506979, DNA
sequence
Length = 670
Score = 153 bits (77), Expect = 2e-035
Identities = 131/149 (87%)
Strand = Plus / Minus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
|||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 300 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 241
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||
Sbjct: 240 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 181
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
|| |||| ||||||| ||||||||||||
Sbjct: 180 tgaggctcggcgactcacacttcctcgcc 152
>gb|CW260825.1|CW260825 104_727_11229176_116_35196_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229176, DNA
sequence
Length = 654
Score = 153 bits (77), Expect = 2e-035
Identities = 131/149 (87%)
Strand = Plus / Minus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
|||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 415 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 356
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||
Sbjct: 355 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 296
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
|| |||| ||||||| ||||||||||||
Sbjct: 295 tgaggctcggcgactcacacttcctcgcc 267
Score = 54.0 bits (27), Expect = 2e-005
Identities = 50/57 (87%), Gaps = 3/57 (5%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
|||||| ||||||||| | |||||||||| ||||||||| |||||||||||||||
Sbjct: 87 gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 34
>gb|BG049431.1|BG049431 OV1_19_H02.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 344
Score = 153 bits (77), Expect = 2e-035
Identities = 131/149 (87%)
Strand = Plus / Minus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
|||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 269 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 210
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||
Sbjct: 209 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 150
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
|| |||| ||||||| ||||||||||||
Sbjct: 149 tgaggctcggcgactcacacttcctcgcc 121
Score = 54.0 bits (27), Expect = 2e-005
Identities = 50/57 (87%), Gaps = 3/57 (5%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
|||||| ||||||||| | |||||||||| ||||||||| |||||||||||||||
Sbjct: 73 gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 20
>gb|BG240262.1|BG240262 OV1_19_H02.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 284
Score = 153 bits (77), Expect = 2e-035
Identities = 131/149 (87%)
Strand = Plus / Minus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
|||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 269 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 210
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||
Sbjct: 209 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaatt 150
Query: 402 ggaagctctgcgactcgcacttcctcgcc 430
|| |||| ||||||| ||||||||||||
Sbjct: 149 tgaggctcggcgactcacacttcctcgcc 121
Score = 54.0 bits (27), Expect = 2e-005
Identities = 50/57 (87%), Gaps = 3/57 (5%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagaccgcccattgttctatcctt 531
|||||| ||||||||| | |||||||||| ||||||||| |||||||||||||||
Sbjct: 73 gagcagcaggaggaccgcaaaaagcttggcggagagacc---cattgttctatcctt 20
>gb|CL157218.1|CL157218 104_344_10783391_116_31374_335 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10783391, DNA
sequence
Length = 726
Score = 139 bits (70), Expect = 4e-031
Identities = 142/166 (85%)
Strand = Plus / Plus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
||||||||||| |||| ||||||||||||||||||||||| |||||| ||| ||||| |
Sbjct: 107 actagcagtccttggtacagaagcagcggtggcgtaggcctttgcacttgccaccggtaa 166
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| ||| |||| ||| |||||||||| ||||| || ||||| ||||||| |||||
Sbjct: 167 aaccttcagtccggcaaacggttgcgcagtttgcgtctctggagcagggtccctggaagc 226
Query: 402 ggaagctctgcgactcgcacttcctcgccgacaccatagtcaccgg 447
|| |||| ||||||| |||||||||||| |||||||||||||
Sbjct: 227 ggtggctcggcgactcacacttcctcgccagtgccatagtcaccgg 272
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
|||||||||||||||| | ||||| ||||||||||||||
Sbjct: 538 gagcaggaggaggaccgcaaaaagtttggtggagagacc 576
>gb|CW260826.1|CW260826 104_727_11229176_148_35200_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229176, DNA
sequence
Length = 548
Score = 139 bits (70), Expect = 4e-031
Identities = 106/118 (89%)
Strand = Plus / Plus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
|||||||||||||||| ||||||||||||||||||||||| |||||| |||| ||||| |
Sbjct: 414 actagcagtccctggtacagaagcagcggtggcgtaggcctttgcactcgccaccggtaa 473
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaa 399
||||||| |||||||| ||| |||||||||| ||||| |||||||| |||||| ||||
Sbjct: 474 aaccttcagtcaggcaaacgcttgcgcagtttgcgtctctcgagcagggtcccctgaa 531
>gb|CW487350.1|CW487350 fsbb001f253c16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f253c16, DNA
sequence
Length = 813
Score = 139 bits (70), Expect = 4e-031
Identities = 142/166 (85%)
Strand = Plus / Minus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
||||||||||| |||| ||||||||||||||||||||||| |||||| ||| ||||| |
Sbjct: 331 actagcagtccttggtacagaagcagcggtggcgtaggcctttgcacttgccaccggtaa 272
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| ||| |||| ||| |||||||||| ||||| || ||||| ||||||| |||||
Sbjct: 271 aaccttcagtccggcaaacggttgcgcagtttgcgtctctggagcagggtccctggaagc 212
Query: 402 ggaagctctgcgactcgcacttcctcgccgacaccatagtcaccgg 447
|| |||| ||||||| |||||||||||| |||||||||||||
Sbjct: 211 ggtggctcggcgactcacacttcctcgccagtgccatagtcaccgg 166
>gb|BG240504.1|BG240504 OV1_30_G12.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 429
Score = 139 bits (70), Expect = 4e-031
Identities = 142/166 (85%)
Strand = Plus / Minus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
||||||||||| |||| ||||||||||||||||||||||| |||||| ||| ||||| |
Sbjct: 280 actagcagtccttggtacagaagcagcggtggcgtaggcctttgcacttgccaccggtaa 221
Query: 342 aaccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagc 401
||||||| ||| |||| ||| |||||||||| ||||| || ||||| ||||||| |||||
Sbjct: 220 aaccttcagtccggcaaacggttgcgcagtttgcgtctctggagcagggtccctggaagc 161
Query: 402 ggaagctctgcgactcgcacttcctcgccgacaccatagtcaccgg 447
|| |||| ||||||| |||||||||||| |||||||||||||
Sbjct: 160 ggtggctcggcgactcacacttcctcgccagtgccatagtcaccgg 115
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
|||||||||||||||| | ||||| ||||||||||||||
Sbjct: 81 gagcaggaggaggaccgcaaaaagtttggtggagagacc 43
>gb|CL180693.1|CL180693 104_390_10896198_116_31930_342 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10896198, DNA
sequence
Length = 484
Score = 125 bits (63), Expect = 5e-027
Identities = 126/147 (85%)
Strand = Plus / Minus
Query: 284 tagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtgaaa 343
|||||||||||||| |||||||||||| |||||||||| ||||| ||| | ||| |||
Sbjct: 457 tagcagtccctggtacagaagcagcggcggcgtaggcctctgcacttgccactggtaaaa 398
Query: 344 ccttcggtcaggcagacgtttgcgcagttggcgtccctcgagcaaggtcccttgaagcgg 403
||||| |||||||| ||| |||| ||||| ||||||||||||| ||||||||||| |
Sbjct: 397 ccttctgtcaggcaaacggttgcacagttttcgtccctcgagcagggtcccttgaatttg 338
Query: 404 aagctctgcgactcgcacttcctcgcc 430
||||||| ||||| |||||||||||||
Sbjct: 337 aagctcttcgactggcacttcctcgcc 311
Score = 61.9 bits (31), Expect = 7e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
|||||||||||||||| | ||||||||||||||||||||
Sbjct: 150 gagcaggaggaggaccgcaaaaagcttggtggagagacc 112
>gb|CW092637.1|CW092637 104_455_10999283_114_33047_044 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10999283, DNA
sequence
Length = 700
Score = 103 bits (52), Expect = 2e-020
Identities = 112/132 (84%)
Strand = Plus / Minus
Query: 299 cagaagcagcggtggcgtaggcccttgcacacgccgccggtgaaaccttcggtcaggcag 358
|||||||||||| |||||||||| ||||| ||| | ||| |||||||| ||||||||
Sbjct: 698 cagaagcagcggcggcgtaggcctctgcacttgccactggtaaaaccttctgtcaggcaa 639
Query: 359 acgtttgcgcagttggcgtccctcgagcaaggtcccttgaagcggaagctctgcgactcg 418
||| |||| ||||| ||||||||||||| ||||||||||| |||||||| ||||| |
Sbjct: 638 acggttgcacagttttcgtccctcgagcagggtcccttgaatttgaagctcttcgactgg 579
Query: 419 cacttcctcgcc 430
||||||||||||
Sbjct: 578 cacttcctcgcc 567
Score = 61.9 bits (31), Expect = 7e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
|||||||||||||||| | ||||||||||||||||||||
Sbjct: 406 gagcaggaggaggaccgcaaaaagcttggtggagagacc 368
>gb|CW308362.1|CW308362 104_796_11468627_116_35732_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11468627, DNA
sequence
Length = 747
Score = 71.9 bits (36), Expect = 7e-011
Identities = 66/76 (86%)
Strand = Plus / Minus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcccttgcacacgccgccggtga 341
|||||||||||||||| |||||||||||| |||||||||| ||||| ||| | ||| |
Sbjct: 79 actagcagtccctggtacagaagcagcggcggcgtaggcctctgcacttgccactggtaa 20
Query: 342 aaccttcggtcaggca 357
||||||| ||||||||
Sbjct: 19 aaccttctgtcaggca 4
>gb|CL180694.1|CL180694 104_390_10896198_148_31929_342 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10896198, DNA
sequence
Length = 676
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Plus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgtaggcc 321
|||||||||||||||| |||||||||||| ||||||||||
Sbjct: 616 actagcagtccctggtacagaagcagcggcggcgtaggcc 655
>gb|CL163908.1|CL163908 104_357_10807504_116_31813_256 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10807504, DNA
sequence
Length = 734
Score = 61.9 bits (31), Expect = 7e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
|||||||||||||||| | ||||||||||||||||||||
Sbjct: 94 gagcaggaggaggaccgcaaaaagcttggtggagagacc 132
>gb|CW092638.1|CW092638 104_455_10999283_116_33051_044 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10999283, DNA
sequence
Length = 589
Score = 56.0 bits (28), Expect = 4e-006
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 282 actagcagtccctggtgcagaagcagcggtggcgta 317
|||||||||||||||| |||||||||||| ||||||
Sbjct: 519 actagcagtccctggtacagaagcagcggcggcgta 554
>gb|BG239927.1|BG239927 OV1_30_G12.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 169
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
|||||||||||||||| | ||||| ||||||||||||||
Sbjct: 81 gagcaggaggaggaccgcaaaaagtttggtggagagacc 43
>gb|CW302893.1|CW302893 104_787_11464957_148_35670_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11464957, DNA
sequence
Length = 487
Score = 46.1 bits (23), Expect = 0.004
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 475 gagcaggaggaggaccacgaaaagcttggtggagagacc 513
||||||||| ||||| | ||||||||||||||||||||
Sbjct: 424 gagcaggagagggaccgcaaaaagcttggtggagagacc 386
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 213,342
Number of Sequences: 832831
Number of extensions: 213342
Number of successful extensions: 71938
Number of sequences better than 0.5: 17
Number of HSP's better than 0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71905
Number of HSP's gapped (non-prelim): 29
length of query: 645
length of database: 491,359,669
effective HSP length: 19
effective length of query: 626
effective length of database: 475,535,880
effective search space: 297685460880
effective search space used: 297685460880
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)