BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2493695.2.1
(570 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BH245440.1|BH245440 pSB0606 S. bicolor BTx623 PstI-diges... 163 2e-038
gb|CW166848.1|CW166848 104_575_11153285_148_36762_017 Sorgh... 163 2e-038
gb|AW746789.1|AW746789 WS1_55_A07.b1_A002 Water-stressed 1 ... 163 2e-038
gb|CW490187.1|CW490187 fsbb001f275i03f0 Sorghum methylation... 161 9e-038
gb|CW493841.1|CW493841 fsbb001f284m24f0 Sorghum methylation... 161 9e-038
gb|CW419268.1|CW419268 fsbb001f124a23f0 Sorghum methylation... 147 1e-033
gb|CW125152.1|CW125152 104_505_11112180_116_34716_044 Sorgh... 68 1e-009
gb|BZ343484.1|BZ343484 ho55h04.b1 WGS-SbicolorF (JM107 adap... 60 2e-007
gb|BZ343485.1|BZ343485 ho55h04.b2 WGS-SbicolorF (JM107 adap... 60 2e-007
gb|CW020744.1|CW020744 104_109_10409144_116_30500 Sorghum m... 60 2e-007
gb|CW305356.1|CW305356 104_790_11466270_148_37437_021 Sorgh... 60 2e-007
gb|CW346754.1|CW346754 fsbb001f006g08k0 Sorghum methylation... 48 9e-004
gb|CX607349.1|CX607349 ANR1_8_C06.b1_A002 Anaerobic roots S... 46 0.004
gb|BZ423001.1|BZ423001 id08b01.g1 WGS-SbicolorF (DH5a methy... 42 0.055
gb|CW136014.1|CW136014 104_520_11118154_116_34837_033 Sorgh... 42 0.055
gb|CW170580.1|CW170580 104_581_11155281_116_36521_047 Sorgh... 42 0.055
gb|CW338200.1|CW338200 104_838_11484617_116_36126_073 Sorgh... 42 0.055
gb|CW338201.1|CW338201 104_838_11484617_148_36127_073 Sorgh... 42 0.055
gb|CW376504.1|CW376504 fsbb001f054g19f0 Sorghum methylation... 42 0.055
gb|CW387622.1|CW387622 fsbb001f072a19f0 Sorghum methylation... 42 0.055
gb|CW448185.1|CW448185 fsbb001f181k22k0 Sorghum methylation... 42 0.055
gb|CW489065.1|CW489065 fsbb001f265m12k0 Sorghum methylation... 42 0.055
gb|CW501033.1|CW501033 fsbb001f296k09k0 Sorghum methylation... 42 0.055
gb|AW671853.1|AW671853 LG1_352_C04.b1_A002 Light Grown 1 (L... 42 0.055
gb|BG051179.1|BG051179 FM1_57_C08.b1_A003 Floral-Induced Me... 42 0.055
gb|BI139955.1|BI139955 IP1_48_A03.b1_A002 Immature pannicle... 42 0.055
gb|CD206802.1|CD206802 HS1_25_E09.b1_A012 Heat-shocked seed... 42 0.055
gb|CF483521.1|CF483521 POL1_22_G08.g1_A002 Pollen Sorghum b... 42 0.055
gb|BZ339394.1|BZ339394 ic31h07.b1 WGS-SbicolorF (JM107 adap... 40 0.22
gb|BZ627635.1|BZ627635 ih53h11.b1 WGS-SbicolorF (DH5a methy... 40 0.22
gb|BZ627636.1|BZ627636 ih53h11.g1 WGS-SbicolorF (DH5a methy... 40 0.22
gb|CL167751.1|CL167751 104_364_10810303_116_31803_367 Sorgh... 40 0.22
gb|CL168178.1|CL168178 104_365_10810620_116_31805_300 Sorgh... 40 0.22
gb|CL175521.1|CL175521 104_381_10892504_116_31765_104 Sorgh... 40 0.22
gb|CL175522.1|CL175522 104_381_10892504_148_31764_104 Sorgh... 40 0.22
gb|CL178004.1|CL178004 104_385_10894249_148_31913_313 Sorgh... 40 0.22
gb|CL181404.1|CL181404 104_392_10896732_148_31925_108 Sorgh... 40 0.22
gb|CW041213.1|CW041213 104_274_10506450_116_30434 Sorghum m... 40 0.22
gb|CW041214.1|CW041214 104_274_10506450_116_30484 Sorghum m... 40 0.22
gb|CW050645.1|CW050645 104_290_10514778_115_30205 Sorghum m... 40 0.22
gb|CW056950.1|CW056950 104_298_10517957_114_30156 Sorghum m... 40 0.22
gb|CW090081.1|CW090081 104_435_10949076_114_32597_036 Sorgh... 40 0.22
gb|CW103861.1|CW103861 104_472_11012117_148_34434_019 Sorgh... 40 0.22
gb|CW116733.1|CW116733 104_492_11107276_148_34605_008 Sorgh... 40 0.22
gb|CW142687.1|CW142687 104_534_11136999_148_34946_062 Sorgh... 40 0.22
gb|CW143407.1|CW143407 104_535_11137397_116_34952_027 Sorgh... 40 0.22
gb|CW143408.1|CW143408 104_535_11137397_148_34956_027 Sorgh... 40 0.22
gb|CW159792.1|CW159792 104_566_11149541_116_36421_029 Sorgh... 40 0.22
gb|CW162685.1|CW162685 104_570_11151068_116_36452_080 Sorgh... 40 0.22
gb|CW169906.1|CW169906 104_580_11154918_116_36512_029 Sorgh... 40 0.22
gb|CW174971.1|CW174971 104_587_11157689_148_36839_075 Sorgh... 40 0.22
gb|CW179812.1|CW179812 104_594_11160304_148_36631_062 Sorgh... 40 0.22
gb|CW191317.1|CW191317 104_613_11178431_116_36939_092 Sorgh... 40 0.22
gb|CW195654.1|CW195654 104_619_11180753_148_36801_073 Sorgh... 40 0.22
gb|CW199534.1|CW199534 104_624_11183561_148_36854_069 Sorgh... 40 0.22
gb|CW201670.1|CW201670 104_627_11184690_116_37108_069 Sorgh... 40 0.22
gb|CW218992.1|CW218992 104_652_11196483_148_37529_002 Sorgh... 40 0.22
gb|CW222169.1|CW222169 104_657_11202235_148_37175_072 Sorgh... 40 0.22
gb|CW223050.1|CW223050 104_658_11202700_148_37183_004 Sorgh... 40 0.22
gb|CW255671.1|CW255671 104_720_11226364_148_35137_010 Sorgh... 40 0.22
gb|CW262969.1|CW262969 104_730_11230378_116_35224_033 Sorgh... 40 0.22
gb|CW263384.1|CW263384 104_731_11230662_148_35216_021 Sorgh... 40 0.22
gb|CW286139.1|CW286139 104_763_11410719_148_35505_052 Sorgh... 40 0.22
gb|CW312065.1|CW312065 104_801_11470559_116_36281_084 Sorgh... 40 0.22
gb|CW352350.1|CW352350 fsbb001f014j08f0 Sorghum methylation... 40 0.22
gb|CW352488.1|CW352488 fsbb001f014m14k0 Sorghum methylation... 40 0.22
gb|CW370374.1|CW370374 fsbb001f045e11f0 Sorghum methylation... 40 0.22
gb|CW398992.1|CW398992 fsbb001f088k19k0 Sorghum methylation... 40 0.22
gb|CW421828.1|CW421828 fsbb001f130n02f0 Sorghum methylation... 40 0.22
gb|CW423003.1|CW423003 fsbb001f132j14k0 Sorghum methylation... 40 0.22
gb|CW444775.1|CW444775 fsbb001f166i19k0 Sorghum methylation... 40 0.22
gb|CW470108.1|CW470108 fsbb001f223c15f0 Sorghum methylation... 40 0.22
gb|AW671017.1|AW671017 LG1_278_G02.b1_A002 Light Grown 1 (L... 40 0.22
gb|BE354996.1|BE354996 DG1_10_H12.b1_A002 Dark Grown 1 (DG1... 40 0.22
gb|BE595070.1|BE595070 PI1_45_C08.b1_A002 Pathogen induced ... 40 0.22
gb|BG050774.1|BG050774 FM1_70_D04.b1_A003 Floral-Induced Me... 40 0.22
gb|BG052806.1|BG052806 RHIZ2_14_C02.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG052813.1|BG052813 RHIZ2_14_C10.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG052819.1|BG052819 RHIZ2_14_D10.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG053334.1|BG053334 RHIZ2_26_B11.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG158804.1|BG158804 RHIZ2_44_E08.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG463903.1|BG463903 EM1_52_C07.b1_A002 Embryo 1 (EM1) So... 40 0.22
gb|BG558293.1|BG558293 RHIZ2_65_D09.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG559361.1|BG559361 RHIZ2_53_H03.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG560286.1|BG560286 RHIZ2_72_D07.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BG560291.1|BG560291 RHIZ2_72_D12.b1_A003 Rhizome2 (RHIZ2... 40 0.22
gb|BI140016.1|BI140016 IP1_48_G12.b1_A002 Immature pannicle... 40 0.22
gb|CB925619.1|CB925619 ABA1_22_F09.g1_A012 Abscisic acid-tr... 40 0.22
gb|CB926086.1|CB926086 ABA1_31_E08.g1_A012 Abscisic acid-tr... 40 0.22
gb|CD211632.1|CD211632 HS1_63_F03.g1_A012 Heat-shocked seed... 40 0.22
gb|CD213687.1|CD213687 HS1_52_C07.g1_A012 Heat-shocked seed... 40 0.22
gb|CD230704.1|CD230704 SS1_47_A12.g1_A012 Salt-stressed see... 40 0.22
gb|CD233705.1|CD233705 SS1_3_E07.g1_A012 Salt-stressed seed... 40 0.22
gb|CD234839.1|CD234839 SS1_18_H04.g1_A012 Salt-stressed see... 40 0.22
gb|CF483373.1|CF483373 POL1_21_G04.g1_A002 Pollen Sorghum b... 40 0.22
gb|CF486060.1|CF486060 POL1_35_A08.g1_A002 Pollen Sorghum b... 40 0.22
gb|CN139039.1|CN139039 OX1_15_D06.g1_A002 Oxidatively-stres... 40 0.22
gb|CN151924.1|CN151924 WOUND1_78_C10.g1_A002 Wounded leaves... 40 0.22
gb|CX608787.1|CX608787 ANR1_40_E11.g1_A002 Anaerobic roots ... 40 0.22
gb|CX620420.1|CX620420 GABR1_51_F04.g1_A002 GA- or brassino... 40 0.22
gb|CX622713.1|CX622713 GABR1_65_C05.g1_A002 GA- or brassino... 40 0.22
>gb|BH245440.1|BH245440 pSB0606 S. bicolor BTx623 PstI-digested total genomic DNA library
Sorghum bicolor genomic clone pSB0606, DNA sequence
Length = 811
Score = 163 bits (82), Expect = 2e-038
Identities = 94/98 (95%)
Strand = Plus / Minus
Query: 303 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacgctggccgcgcacac 362
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 776 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacgctgaacgcgcacac 717
Query: 363 cgactacatctacacccagcagcaccacggctgatcca 400
|||||||||||||||||||||||||||| ||||||||
Sbjct: 716 cgactacatctacacccagcagcaccacaactgatcca 679
>gb|CW166848.1|CW166848 104_575_11153285_148_36762_017 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11153285, DNA
sequence
Length = 618
Score = 163 bits (82), Expect = 2e-038
Identities = 94/98 (95%)
Strand = Plus / Plus
Query: 303 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacgctggccgcgcacac 362
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 226 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacgctgaacgcgcacac 285
Query: 363 cgactacatctacacccagcagcaccacggctgatcca 400
|||||||||||||||||||||||||||| ||||||||
Sbjct: 286 cgactacatctacacccagcagcaccacaactgatcca 323
Score = 69.9 bits (35), Expect = 2e-010
Identities = 61/69 (88%), Gaps = 3/69 (4%)
Strand = Plus / Plus
Query: 182 ccgtggccagcgccgcccgggacgacccctcggcagcggcggcggcggccgtcacttctt 241
|||||||||||||||| |||||||||| |||| |||||||||||||||||| | ||||
Sbjct: 1 ccgtggccagcgccgcgcgggacgacc---cggctgcggcggcggcggccgtctcatctt 57
Query: 242 ctcgtgacc 250
||| |||||
Sbjct: 58 ctcatgacc 66
>gb|AW746789.1|AW746789 WS1_55_A07.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 463
Score = 163 bits (82), Expect = 2e-038
Identities = 94/98 (95%)
Strand = Plus / Plus
Query: 303 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacgctggccgcgcacac 362
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 30 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacgctgaacgcgcacac 89
Query: 363 cgactacatctacacccagcagcaccacggctgatcca 400
|||||||||||||||||||||||||||| ||||||||
Sbjct: 90 cgactacatctacacccagcagcaccacaactgatcca 127
>gb|CW490187.1|CW490187 fsbb001f275i03f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f275i03, DNA
sequence
Length = 367
Score = 161 bits (81), Expect = 9e-038
Identities = 136/154 (88%), Gaps = 9/154 (5%)
Strand = Plus / Minus
Query: 97 tccatggcgaggagggcgacggtgatggtgctcgcggcggcgctcgcggtcctcctgctg 156
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 349 tccatggcgaagagggcgacggtcatggtgctcgcggcggcgctcgcggtcctcctgctg 290
Query: 157 gcgtcgtcgtcgtcgaagacggcccccgtggccagcgccgcccgggacgacccctcggca 216
||| || |||||| |||||||||||||||||||||| |||||||||| ||||
Sbjct: 289 gcggcggcgtcgt------cggcccccgtggccagcgccgcgcgggacgacc---cggct 239
Query: 217 gcggcggcggcggccgtcacttcttctcgtgacc 250
|||||||||||||||||| | ||||||| |||||
Sbjct: 238 gcggcggcggcggccgtctcatcttctcatgacc 205
Score = 89.7 bits (45), Expect = 3e-016
Identities = 45/45 (100%)
Strand = Plus / Minus
Query: 303 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcac 347
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 45 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcac 1
>gb|CW493841.1|CW493841 fsbb001f284m24f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f284m24, DNA
sequence
Length = 484
Score = 161 bits (81), Expect = 9e-038
Identities = 136/154 (88%), Gaps = 9/154 (5%)
Strand = Plus / Minus
Query: 97 tccatggcgaggagggcgacggtgatggtgctcgcggcggcgctcgcggtcctcctgctg 156
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 277 tccatggcgaagagggcgacggtcatggtgctcgcggcggcgctcgcggtcctcctgctg 218
Query: 157 gcgtcgtcgtcgtcgaagacggcccccgtggccagcgccgcccgggacgacccctcggca 216
||| || |||||| |||||||||||||||||||||| |||||||||| ||||
Sbjct: 217 gcggcggcgtcgt------cggcccccgtggccagcgccgcgcgggacgacc---cggct 167
Query: 217 gcggcggcggcggccgtcacttcttctcgtgacc 250
|||||||||||||||||| | ||||||| |||||
Sbjct: 166 gcggcggcggcggccgtctcatcttctcatgacc 133
>gb|CW419268.1|CW419268 fsbb001f124a23f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f124a23, DNA
sequence
Length = 379
Score = 147 bits (74), Expect = 1e-033
Identities = 92/98 (93%)
Strand = Plus / Minus
Query: 303 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacgctggccgcgcacac 362
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 342 gtgcgagggcgccaacgacgaggacgagtgcatgatgaggcgcacggtgaacgcgcacac 283
Query: 363 cgactacatctacacccagcagcaccacggctgatcca 400
||||||||| |||||||||||||||||| ||||||||
Sbjct: 282 cgactacatgtacacccagcagcaccacaactgatcca 245
>gb|CW125152.1|CW125152 104_505_11112180_116_34716_044 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11112180, DNA
sequence
Length = 470
Score = 67.9 bits (34), Expect = 1e-009
Identities = 49/54 (90%)
Strand = Plus / Minus
Query: 328 gagtgcatgatgaggcgcacgctggccgcgcacaccgactacatctacacccag 381
||||||||||||||| | ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 174 gagtgcatgatgaggaggacgttggtcgctcacaccgactacatctacacccag 121
>gb|BZ343484.1|BZ343484 ho55h04.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ho55h04 5', DNA sequence
Length = 454
Score = 60.0 bits (30), Expect = 2e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 328 gagtgcatgatgaggcgcacgctggccgcgcacaccgactacatctacacccag 381
|||||| |||||||| | ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 219 gagtgcctgatgaggaggacgttggtcgctcacaccgactacatctacacccag 166
>gb|BZ343485.1|BZ343485 ho55h04.b2 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ho55h04 5', DNA sequence
Length = 640
Score = 60.0 bits (30), Expect = 2e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 328 gagtgcatgatgaggcgcacgctggccgcgcacaccgactacatctacacccag 381
|||||| |||||||| | ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 232 gagtgcctgatgaggaggacgttggtcgctcacaccgactacatctacacccag 179
>gb|CW020744.1|CW020744 104_109_10409144_116_30500 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10409144, DNA
sequence
Length = 661
Score = 60.0 bits (30), Expect = 2e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 328 gagtgcatgatgaggcgcacgctggccgcgcacaccgactacatctacacccag 381
|||||| |||||||| | ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 142 gagtgcctgatgaggaggacgttggtcgctcacaccgactacatctacacccag 89
>gb|CW305356.1|CW305356 104_790_11466270_148_37437_021 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11466270, DNA
sequence
Length = 712
Score = 60.0 bits (30), Expect = 2e-007
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 328 gagtgcatgatgaggcgcacgctggccgcgcacaccgactacatctacacccag 381
|||||| |||||||| | ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 186 gagtgcctgatgaggaggacgttggtcgctcacaccgactacatctacacccag 239
>gb|CW346754.1|CW346754 fsbb001f006g08k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f006g08, DNA
sequence
Length = 794
Score = 48.1 bits (24), Expect = 9e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 266 cggcggcggcggcggaagggaaggggaaggag 297
||||| |||||||||||||| |||||||||||
Sbjct: 59 cggcgccggcggcggaaggggaggggaaggag 28
>gb|CX607349.1|CX607349 ANR1_8_C06.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_8_C06_A002 3', mRNA sequence
Length = 732
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 212 cggcagcggcggcggcggccgtc 234
|||||||||||||||||||||||
Sbjct: 518 cggcagcggcggcggcggccgtc 496
>gb|BZ423001.1|BZ423001 id08b01.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone id08b01 5', DNA sequence
Length = 208
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 266 cggcggcggcggcggaaggga 286
|||||||||||||||||||||
Sbjct: 38 cggcggcggcggcggaaggga 58
>gb|CW136014.1|CW136014 104_520_11118154_116_34837_033 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11118154, DNA
sequence
Length = 604
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 208 ccctcggcagcggcggcggcggccg 232
|||||||||||||| ||||||||||
Sbjct: 564 ccctcggcagcggcagcggcggccg 540
>gb|CW170580.1|CW170580 104_581_11155281_116_36521_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11155281, DNA
sequence
Length = 281
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 209 cctcggcagcggcggcggcggccgt 233
||||| |||||||||||||||||||
Sbjct: 245 cctcgccagcggcggcggcggccgt 221
>gb|CW338200.1|CW338200 104_838_11484617_116_36126_073 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484617, DNA
sequence
Length = 671
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 212 cggcagcggcggcggcggccg 232
|||||||||||||||||||||
Sbjct: 338 cggcagcggcggcggcggccg 358
>gb|CW338201.1|CW338201 104_838_11484617_148_36127_073 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484617, DNA
sequence
Length = 708
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 212 cggcagcggcggcggcggccg 232
|||||||||||||||||||||
Sbjct: 420 cggcagcggcggcggcggccg 400
>gb|CW376504.1|CW376504 fsbb001f054g19f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f054g19, DNA
sequence
Length = 413
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 212 cggcagcggcggcggcggccgtcac 236
|||| ||||||||||||||||||||
Sbjct: 332 cggcggcggcggcggcggccgtcac 308
>gb|CW387622.1|CW387622 fsbb001f072a19f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f072a19, DNA
sequence
Length = 118
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 283 gggaaggggaaggagaaggag 303
|||||||||||||||||||||
Sbjct: 85 gggaaggggaaggagaaggag 65
>gb|CW448185.1|CW448185 fsbb001f181k22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f181k22, DNA
sequence
Length = 536
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 209 cctcggcagcggcggcggcggccgt 233
||||| |||||||||||||||||||
Sbjct: 306 cctcgccagcggcggcggcggccgt 282
>gb|CW489065.1|CW489065 fsbb001f265m12k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f265m12, DNA
sequence
Length = 702
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 283 gggaaggggaaggagaaggag 303
|||||||||||||||||||||
Sbjct: 233 gggaaggggaaggagaaggag 213
>gb|CW501033.1|CW501033 fsbb001f296k09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f296k09, DNA
sequence
Length = 793
Score = 42.1 bits (21), Expect = 0.055
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 273 ggcggcggaagggaaggggaaggagaagg 301
|||||| | ||||||||||||||||||||
Sbjct: 378 ggcggcaggagggaaggggaaggagaagg 350
>gb|AW671853.1|AW671853 LG1_352_C04.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 589
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 266 cggcggcggcggcggaaggga 286
|||||||||||||||||||||
Sbjct: 38 cggcggcggcggcggaaggga 58
>gb|BG051179.1|BG051179 FM1_57_C08.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 537
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 266 cggcggcggcggcggaaggga 286
|||||||||||||||||||||
Sbjct: 68 cggcggcggcggcggaaggga 88
>gb|BI139955.1|BI139955 IP1_48_A03.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 406
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 266 cggcggcggcggcggaaggga 286
|||||||||||||||||||||
Sbjct: 80 cggcggcggcggcggaaggga 100
>gb|CD206802.1|CD206802 HS1_25_E09.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_25_E09_A012 3', mRNA sequence
Length = 516
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 268 gcggcggcggcggaagggaag 288
|||||||||||||||||||||
Sbjct: 43 gcggcggcggcggaagggaag 23
>gb|CF483521.1|CF483521 POL1_22_G08.g1_A002 Pollen Sorghum bicolor cDNA clone
POL1_22_G08_A002 5', mRNA sequence
Length = 629
Score = 42.1 bits (21), Expect = 0.055
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 266 cggcggcggcggcggaaggga 286
|||||||||||||||||||||
Sbjct: 101 cggcggcggcggcggaaggga 121
>gb|BZ339394.1|BZ339394 ic31h07.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ic31h07 5', DNA sequence
Length = 452
Score = 40.1 bits (20), Expect = 0.22
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 274 gcggcggaagggaaggggaaggagaagg 301
|||||||| ||||||||||||| |||||
Sbjct: 228 gcggcggaggggaaggggaaggggaagg 255
>gb|BZ627635.1|BZ627635 ih53h11.b1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ih53h11 5', DNA sequence
Length = 758
Score = 40.1 bits (20), Expect = 0.22
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 209 cctcggcagcggcggcggcggccg 232
||||||| ||||||||||||||||
Sbjct: 393 cctcggcggcggcggcggcggccg 416
>gb|BZ627636.1|BZ627636 ih53h11.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ih53h11 5', DNA sequence
Length = 638
Score = 40.1 bits (20), Expect = 0.22
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 209 cctcggcagcggcggcggcggccg 232
||||||| ||||||||||||||||
Sbjct: 502 cctcggcggcggcggcggcggccg 479
>gb|CL167751.1|CL167751 104_364_10810303_116_31803_367 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10810303, DNA
sequence
Length = 229
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 496 cgccagcgcgtgctgcttct 515
||||||||||||||||||||
Sbjct: 156 cgccagcgcgtgctgcttct 137
>gb|CL168178.1|CL168178 104_365_10810620_116_31805_300 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10810620, DNA
sequence
Length = 623
Score = 40.1 bits (20), Expect = 0.22
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 268 gcggcggcggcggaagggaaggggaaggagaaggag 303
|||||||||||||||||| || || ||||| |||||
Sbjct: 57 gcggcggcggcggaaggggagcgggaggaggaggag 22
>gb|CL175521.1|CL175521 104_381_10892504_116_31765_104 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10892504, DNA
sequence
Length = 687
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 217 gcggcggcggcggccgtcac 236
||||||||||||||||||||
Sbjct: 215 gcggcggcggcggccgtcac 234
>gb|CL175522.1|CL175522 104_381_10892504_148_31764_104 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10892504, DNA
sequence
Length = 683
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 217 gcggcggcggcggccgtcac 236
||||||||||||||||||||
Sbjct: 597 gcggcggcggcggccgtcac 578
>gb|CL178004.1|CL178004 104_385_10894249_148_31913_313 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894249, DNA
sequence
Length = 709
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 155 tggcgtcgtcgtcgtcgaag 174
||||||||||||||||||||
Sbjct: 311 tggcgtcgtcgtcgtcgaag 330
>gb|CL181404.1|CL181404 104_392_10896732_148_31925_108 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10896732, DNA
sequence
Length = 286
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 212 cggcagcggcggcggcggcc 231
||||||||||||||||||||
Sbjct: 94 cggcagcggcggcggcggcc 113
>gb|CW041213.1|CW041213 104_274_10506450_116_30434 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10506450, DNA
sequence
Length = 667
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 213 ggcagcggcggcggcggccg 232
||||||||||||||||||||
Sbjct: 415 ggcagcggcggcggcggccg 434
>gb|CW041214.1|CW041214 104_274_10506450_116_30484 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10506450, DNA
sequence
Length = 638
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 213 ggcagcggcggcggcggccg 232
||||||||||||||||||||
Sbjct: 415 ggcagcggcggcggcggccg 434
>gb|CW050645.1|CW050645 104_290_10514778_115_30205 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10514778, DNA
sequence
Length = 507
Score = 40.1 bits (20), Expect = 0.22
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 209 cctcggcagcggcggcggcggccg 232
||||||| ||||||||||||||||
Sbjct: 432 cctcggcggcggcggcggcggccg 455
>gb|CW056950.1|CW056950 104_298_10517957_114_30156 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10517957, DNA
sequence
Length = 494
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 211 tcggcagcggcggcggcggc 230
||||||||||||||||||||
Sbjct: 109 tcggcagcggcggcggcggc 128
>gb|CW090081.1|CW090081 104_435_10949076_114_32597_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10949076, DNA
sequence
Length = 667
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 217 gcggcggcggcggccgtcac 236
||||||||||||||||||||
Sbjct: 167 gcggcggcggcggccgtcac 148
>gb|CW103861.1|CW103861 104_472_11012117_148_34434_019 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11012117, DNA
sequence
Length = 618
Score = 40.1 bits (20), Expect = 0.22
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 209 cctcggcagcggcggcggcggccg 232
||||||| ||||||||||||||||
Sbjct: 393 cctcggcggcggcggcggcggccg 416
>gb|CW116733.1|CW116733 104_492_11107276_148_34605_008 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11107276, DNA
sequence
Length = 492
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 214 gcagcggcggcggcggccgt 233
||||||||||||||||||||
Sbjct: 401 gcagcggcggcggcggccgt 420
>gb|CW142687.1|CW142687 104_534_11136999_148_34946_062 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11136999, DNA
sequence
Length = 643
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 211 tcggcagcggcggcggcggc 230
||||||||||||||||||||
Sbjct: 96 tcggcagcggcggcggcggc 77
>gb|CW143407.1|CW143407 104_535_11137397_116_34952_027 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11137397, DNA
sequence
Length = 589
Score = 40.1 bits (20), Expect = 0.22
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 209 cctcggcagcggcggcggcggccg 232
||||||| ||||||||||||||||
Sbjct: 542 cctcggcggcggcggcggcggccg 565
>gb|CW143408.1|CW143408 104_535_11137397_148_34956_027 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11137397, DNA
sequence
Length = 674
Score = 40.1 bits (20), Expect = 0.22
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 209 cctcggcagcggcggcggcggccg 232
||||||| ||||||||||||||||
Sbjct: 346 cctcggcggcggcggcggcggccg 323
>gb|CW159792.1|CW159792 104_566_11149541_116_36421_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11149541, DNA
sequence
Length = 652
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 214 gcagcggcggcggcggccgt 233
||||||||||||||||||||
Sbjct: 335 gcagcggcggcggcggccgt 354
>gb|CW162685.1|CW162685 104_570_11151068_116_36452_080 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11151068, DNA
sequence
Length = 617
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 212 cggcagcggcggcggcggcc 231
||||||||||||||||||||
Sbjct: 400 cggcagcggcggcggcggcc 381
>gb|CW169906.1|CW169906 104_580_11154918_116_36512_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11154918, DNA
sequence
Length = 400
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 212 cggcagcggcggcggcggcc 231
||||||||||||||||||||
Sbjct: 256 cggcagcggcggcggcggcc 275
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 551,937
Number of Sequences: 832831
Number of extensions: 551937
Number of successful extensions: 278299
Number of sequences better than 0.5: 101
Number of HSP's better than 0.5 without gapping: 101
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 277808
Number of HSP's gapped (non-prelim): 416
length of query: 570
length of database: 491,359,669
effective HSP length: 19
effective length of query: 551
effective length of database: 475,535,880
effective search space: 262020269880
effective search space used: 262020269880
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)