BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCN21b10.yg.2.1
(574 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI127543.1|BI127543 G062P08Y Populus cambium cDNA librar... 117 5e-025
gb|CK088334.1|CK088334 A048P19.3pR Hybrid aspen plasmid lib... 64 6e-009
gb|AJ778206.1|AJ778206 AJ778206 Populus euphratica root 3-6... 54 6e-006
gb|CV237411.1|CV237411 WS01227.B21.1_N22 PT-GT-FL-A-3 Popul... 54 6e-006
gb|AI163781.1|AI163781 A048p19u Hybrid aspen plasmid librar... 48 4e-004
gb|BI072933.1|BI072933 C090P65U Populus strain T89 leaves P... 40 0.090
gb|AJ534481.1|AJ534481 AJ534481 Populus euphratica root and... 40 0.090
gb|CA933471.1|CA933471 MTU5CS.P8.E06 Aspen stem cDNA Librar... 40 0.090
gb|CF118925.1|CF118925 MTU10CS.P11.C02 Aspen stem cDNA Libr... 40 0.090
gb|CK100813.1|CK100813 C090P65.5pR Populus strain T89 leave... 40 0.090
gb|DN493538.1|DN493538 C044P02.5pR Populus strain T89 leave... 40 0.090
gb|CA924833.1|CA924833 MTU7TL.P10.B12 Aspen leaf cDNA Libra... 38 0.36
gb|CA925020.1|CA925020 MTU7TL.P12.F05 Aspen leaf cDNA Libra... 38 0.36
gb|CX181807.1|CX181807 F11_45-34_11.ab1 leaf inoculated wit... 38 0.36
gb|AF139835.1|AF139835 Populus tremula x Populus tremuloide... 38 0.36
>gb|BI127543.1|BI127543 G062P08Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 457
Score = 117 bits (59), Expect = 5e-025
Identities = 167/203 (82%)
Strand = Plus / Plus
Query: 27 gctcgattctttgttgcactgaattcgaggaaggaggtcaatgtaatgttgaagaaagaa 86
||||| || ||||||||| ||||| | ||||||||||| |||| | || | || |||||
Sbjct: 236 gctcgtttttttgttgcattgaatccaaggaaggaggtgaatgcagtgctaaaaaaagag 295
Query: 87 gcagaatactttggagacattgtcattttgccatttatagaccgctatgagctggttgtt 146
|||| ||||||||| || ||||| |||||||| ||||| || | |||||||| || |||
Sbjct: 296 gcagcatactttggtgatattgtgattttgccgtttatggatagatatgagcttgtggtt 355
Query: 147 cttaagacaattgctatctgtgagtatggggtccagaacttgactgctgcaaacatcatg 206
||||| || |||||||| ||||||| |||||| ||||| | ||||||| |||| |||
Sbjct: 356 cttaaaactattgctatttgtgagtttggggttcagaatgtttctgctgcgtacattatg 415
Query: 207 aaatgtgacgatgatacatttgt 229
|||||||| ||||||||||||||
Sbjct: 416 aaatgtgatgatgatacatttgt 438
>gb|CK088334.1|CK088334 A048P19.3pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A048P19 3', mRNA sequence
Length = 803
Score = 63.9 bits (32), Expect = 6e-009
Identities = 63/72 (87%), Gaps = 1/72 (1%)
Strand = Plus / Minus
Query: 158 tgctatctgtgagtatggggtccagaacttgactgctgcaaacatcatgaaatgtgacga 217
|||||| ||||||| |||||| ||||| || ||||||| |||| ||||||||||||||
Sbjct: 788 tgctatttgtgagt-tggggttcagaatgtgtctgctgcgtacattatgaaatgtgacga 730
Query: 218 tgatacatttgt 229
||||||||||||
Sbjct: 729 tgatacatttgt 718
>gb|AJ778206.1|AJ778206 AJ778206 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400040H01F1, mRNA sequence
Length = 682
Score = 54.0 bits (27), Expect = 6e-006
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 201 atcatgaaatgtgacgatgatacatttgtgagagt 235
|||||||| |||||||||||||||||||||||||
Sbjct: 414 atcatgaagggtgacgatgatacatttgtgagagt 448
>gb|CV237411.1|CV237411 WS01227.B21.1_N22 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01227_N22 3', mRNA sequence
Length = 867
Score = 54.0 bits (27), Expect = 6e-006
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 201 atcatgaaatgtgacgatgatacatttgtgagagt 235
|||||||| |||||||||||||||||||||||||
Sbjct: 835 atcatgaagggtgacgatgatacatttgtgagagt 801
Score = 40.1 bits (20), Expect = 0.090
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 466 agatggaagatgtaagcatgggcctatgggtcgagaagttcaat 509
||||||||||||| |||||||| | ||||| ||| ||||||||
Sbjct: 570 agatggaagatgtgagcatgggaatgtgggtagagcagttcaat 527
>gb|AI163781.1|AI163781 A048p19u Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 296
Score = 48.1 bits (24), Expect = 4e-004
Identities = 110/136 (80%), Gaps = 2/136 (1%)
Strand = Plus / Plus
Query: 27 gctcgattctttgttgcactgaattcgaggaaggaggtcaatgtaatgttgaagaaagaa 86
||||| || ||||||||| ||||| | ||||||||||| |||| | || | || |||||
Sbjct: 162 gctcgtttttttgttgcattgaatccaaggaaggaggtgaatgcagtgctaaaaaaagag 221
Query: 87 gcagaatactttg-gagacattgtcattttgccatttatagaccgctatgagctggttgt 145
|||| |||||||| | || ||||| |||||||| |||| || || |||||||| || ||
Sbjct: 222 gcagcatactttgngtgatattgtgattttgcc-gttatggatcgatatgagcttgtggt 280
Query: 146 tcttaagacaattgct 161
|||||| || ||||||
Sbjct: 281 tcttaaaactattgct 296
>gb|BI072933.1|BI072933 C090P65U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 411
Score = 40.1 bits (20), Expect = 0.090
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 216 gatgatacatttgtgagagt 235
||||||||||||||||||||
Sbjct: 104 gatgatacatttgtgagagt 123
>gb|AJ534481.1|AJ534481 AJ534481 Populus euphratica root and shoot Populus euphratica cDNA
clone 46, mRNA sequence
Length = 574
Score = 40.1 bits (20), Expect = 0.090
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 498 gcggccgcccgggcaggtac 479
>gb|CA933471.1|CA933471 MTU5CS.P8.E06 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 606
Score = 40.1 bits (20), Expect = 0.090
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 270 gcggccgcccgggcaggtac 289
>gb|CF118925.1|CF118925 MTU10CS.P11.C02 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 786
Score = 40.1 bits (20), Expect = 0.090
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 637 gcggccgcccgggcaggtac 656
Score = 40.1 bits (20), Expect = 0.090
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 644 gcggccgcccgggcaggtac 625
>gb|CK100813.1|CK100813 C090P65.5pR Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA clone C090P65 5', mRNA sequence
Length = 216
Score = 40.1 bits (20), Expect = 0.090
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 216 gatgatacatttgtgagagt 235
||||||||||||||||||||
Sbjct: 118 gatgatacatttgtgagagt 137
>gb|DN493538.1|DN493538 C044P02.5pR Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA clone C044P02 5', mRNA sequence
Length = 598
Score = 40.1 bits (20), Expect = 0.090
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 157 ttgctatctgtgagtatggggtcc 180
||||||||||||| ||||||||||
Sbjct: 221 ttgctatctgtgaatatggggtcc 244
>gb|CA924833.1|CA924833 MTU7TL.P10.B12 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 569
Score = 38.2 bits (19), Expect = 0.36
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 547 gcggccgcccgggcaggta 529
>gb|CA925020.1|CA925020 MTU7TL.P12.F05 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 568
Score = 38.2 bits (19), Expect = 0.36
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 547 gcggccgcccgggcaggta 529
>gb|CX181807.1|CX181807 F11_45-34_11.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 606
Score = 38.2 bits (19), Expect = 0.36
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 260 gttgaacaatggtgacaaa 278
|||||||||||||||||||
Sbjct: 501 gttgaacaatggtgacaaa 519
>gb|AF139835.1|AF139835 Populus tremula x Populus tremuloides F-box containing protein
TIR1 (TIR1) mRNA, complete cds
Length = 2646
Score = 38.2 bits (19), Expect = 0.36
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 47 gcggccgcccgggcaggta 65
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 60,818
Number of Sequences: 369679
Number of extensions: 60818
Number of successful extensions: 17038
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17010
Number of HSP's gapped (non-prelim): 28
length of query: 574
length of database: 203,408,664
effective HSP length: 19
effective length of query: 555
effective length of database: 196,384,763
effective search space: 108993543465
effective search space used: 108993543465
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)