BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCH2g03.yg.2.1
(537 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DT493588.1|DT493588 WS0111.BR_N04 PT-P-FL-A-2 Populus tr... 42 0.021
gb|DT495294.1|DT495294 WS01120.BR_A19 PT-P-FL-A-2 Populus t... 42 0.021
gb|DT497112.1|DT497112 WS01125.BR_I08 PT-P-FL-A-2 Populus t... 42 0.021
>gb|DT493588.1|DT493588 WS0111.BR_N04 PT-P-FL-A-2 Populus trichocarpa cDNA clone WS0111_N04
5', mRNA sequence
Length = 599
Score = 42.1 bits (21), Expect = 0.021
Identities = 48/58 (82%)
Strand = Plus / Plus
Query: 480 atagatatgaatcaggagcactatatggaggagncnttgaaaatgagnaatctgctgc 537
||||||||||| ||||| |||| ||||| || | ||||||||||| ||| ||||||
Sbjct: 218 atagatatgaaccaggataactacatggaagaagccttgaaaatgaggaatttgctgc 275
Score = 38.2 bits (19), Expect = 0.33
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 416 tgaaggaaagccagaaaaccaganccatgc 445
||||||||| ||||||||||| | ||||||
Sbjct: 154 tgaaggaaaaccagaaaaccaaaaccatgc 183
>gb|DT495294.1|DT495294 WS01120.BR_A19 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01120_A19 5', mRNA sequence
Length = 872
Score = 42.1 bits (21), Expect = 0.021
Identities = 48/58 (82%)
Strand = Plus / Plus
Query: 480 atagatatgaatcaggagcactatatggaggagncnttgaaaatgagnaatctgctgc 537
||||||||||| ||||| |||| ||||| || | ||||||||||| ||| ||||||
Sbjct: 218 atagatatgaaccaggataactacatggaagaagccttgaaaatgaggaatttgctgc 275
Score = 38.2 bits (19), Expect = 0.33
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 416 tgaaggaaagccagaaaaccaganccatgc 445
||||||||| ||||||||||| | ||||||
Sbjct: 154 tgaaggaaaaccagaaaaccaaaaccatgc 183
>gb|DT497112.1|DT497112 WS01125.BR_I08 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01125_I08 5', mRNA sequence
Length = 908
Score = 42.1 bits (21), Expect = 0.021
Identities = 48/58 (82%)
Strand = Plus / Plus
Query: 480 atagatatgaatcaggagcactatatggaggagncnttgaaaatgagnaatctgctgc 537
||||||||||| ||||| |||| ||||| || | ||||||||||| ||| ||||||
Sbjct: 221 atagatatgaaccaggataactacatggaagaagccttgaaaatgaggaatttgctgc 278
Score = 38.2 bits (19), Expect = 0.33
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 416 tgaaggaaagccagaaaaccaganccatgc 445
||||||||| ||||||||||| | ||||||
Sbjct: 157 tgaaggaaaaccagaaaaccaaaaccatgc 186
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 64,463
Number of Sequences: 369679
Number of extensions: 64463
Number of successful extensions: 20368
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 20362
Number of HSP's gapped (non-prelim): 6
length of query: 537
length of database: 203,408,664
effective HSP length: 19
effective length of query: 518
effective length of database: 196,384,763
effective search space: 101727307234
effective search space used: 101727307234
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)