BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCF7a10.yg.2.1
(523 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DV463139.1|DV463139 MTUNUL1.P12.C01 NUL Populus fremonti... 66 1e-009
gb|BI138525.1|BI138525 F108P50Y Populus flower cDNA library... 60 9e-008
gb|BU814412.1|BU814412 N029C01 Populus bark cDNA library Po... 60 9e-008
gb|AC149295.1| Populus trichocarpa clone Pop1-008L01, compl... 60 9e-008
gb|AC149424.1| Populus trichocarpa clone Pop1-011N15, compl... 60 9e-008
gb|AC149425.1| Populus trichocarpa clone Pop1-041F22, compl... 60 9e-008
gb|AC149426.1| Populus trichocarpa clone Pop1-053A03, compl... 60 9e-008
gb|DT477642.1|DT477642 WS02520.BR_I18 PT-MB-N-A-15 Populus ... 54 5e-006
gb|BU820611.1|BU820611 UB12CPA10 Populus tremula cambium cD... 52 2e-005
gb|DN500074.1|DN500074 UB12CPA10.5pR Populus active cambium... 52 2e-005
gb|BU883590.1|BU883590 UM93TF01 Populus flower cDNA library... 40 0.082
gb|BP927943.1|BP927943 BP927943 full-length enriched poplar... 40 0.082
gb|DT474122.1|DT474122 WS01230.BR_O03 PT-GT-FL-A-3 Populus ... 40 0.082
gb|AJ777448.1|AJ777448 AJ777448 Populus euphratica root 3-6... 38 0.32
>gb|DV463139.1|DV463139 MTUNUL1.P12.C01 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 623
Score = 65.9 bits (33), Expect = 1e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 439 aacaagatatttgctgaaaatgcatttgatgctgtgatgca 479
||||| || ||||||||||||||||||||||||||||||||
Sbjct: 480 aacaaaatctttgctgaaaatgcatttgatgctgtgatgca 520
>gb|BI138525.1|BI138525 F108P50Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 410
Score = 60.0 bits (30), Expect = 9e-008
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 455 aaaatgcatttgatgctgtgatgcactttgcagc 488
||||||||||||||||||||||||| ||||||||
Sbjct: 331 aaaatgcatttgatgctgtgatgcattttgcagc 298
>gb|BU814412.1|BU814412 N029C01 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 349
Score = 60.0 bits (30), Expect = 9e-008
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 455 aaaatgcatttgatgctgtgatgcactttgcagc 488
||||||||||||||||||||||||| ||||||||
Sbjct: 54 aaaatgcatttgatgctgtgatgcattttgcagc 87
>gb|AC149295.1| Populus trichocarpa clone Pop1-008L01, complete sequence
Length = 101981
Score = 60.0 bits (30), Expect = 9e-008
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 455 aaaatgcatttgatgctgtgatgcactttgcagc 488
||||||||||||||||||||||||| ||||||||
Sbjct: 33739 aaaatgcatttgatgctgtgatgcattttgcagc 33772
>gb|AC149424.1| Populus trichocarpa clone Pop1-011N15, complete sequence
Length = 152544
Score = 60.0 bits (30), Expect = 9e-008
Identities = 33/34 (97%)
Strand = Plus / Plus
Query: 455 aaaatgcatttgatgctgtgatgcactttgcagc 488
||||||||||||||||||||||||| ||||||||
Sbjct: 82886 aaaatgcatttgatgctgtgatgcattttgcagc 82919
>gb|AC149425.1| Populus trichocarpa clone Pop1-041F22, complete sequence
Length = 106128
Score = 60.0 bits (30), Expect = 9e-008
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 455 aaaatgcatttgatgctgtgatgcactttgcagc 488
||||||||||||||||||||||||| ||||||||
Sbjct: 16024 aaaatgcatttgatgctgtgatgcattttgcagc 15991
>gb|AC149426.1| Populus trichocarpa clone Pop1-053A03, complete sequence
Length = 148552
Score = 60.0 bits (30), Expect = 9e-008
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 455 aaaatgcatttgatgctgtgatgcactttgcagc 488
||||||||||||||||||||||||| ||||||||
Sbjct: 16670 aaaatgcatttgatgctgtgatgcattttgcagc 16637
>gb|DT477642.1|DT477642 WS02520.BR_I18 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02520_I18 5', mRNA sequence
Length = 809
Score = 54.0 bits (27), Expect = 5e-006
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 455 aaaatgcatttgatgctgtgatgcactttgc 485
||||||||||||||||||||||||| |||||
Sbjct: 709 aaaatgcatttgatgctgtgatgcattttgc 739
>gb|BU820611.1|BU820611 UB12CPA10 Populus tremula cambium cDNA library Populus tremula cDNA
5 prime, mRNA sequence
Length = 504
Score = 52.0 bits (26), Expect = 2e-005
Identities = 66/80 (82%)
Strand = Plus / Plus
Query: 439 aacaagatatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttat 498
||||| || |||| ||| ||||||||||||||||||||||| || || |||| || |||
Sbjct: 250 aacaaaatctttgttgagaatgcatttgatgctgtgatgcatttcgctgctgttgcatat 309
Query: 499 gtgggagagagcacattgga 518
|| || ||||| ||| ||||
Sbjct: 310 gttggtgagagtacaatgga 329
>gb|DN500074.1|DN500074 UB12CPA10.5pR Populus active cambium cDNA library Populus tremula
cDNA clone UB12CPA10 5', mRNA sequence
Length = 733
Score = 52.0 bits (26), Expect = 2e-005
Identities = 66/80 (82%)
Strand = Plus / Plus
Query: 439 aacaagatatttgctgaaaatgcatttgatgctgtgatgcactttgcagctgnngcttat 498
||||| || |||| ||| ||||||||||||||||||||||| || || |||| || |||
Sbjct: 250 aacaaaatctttgttgagaatgcatttgatgctgtgatgcatttcgctgctgttgcatat 309
Query: 499 gtgggagagagcacattgga 518
|| || ||||| ||| ||||
Sbjct: 310 gttggtgagagtacaatgga 329
>gb|BU883590.1|BU883590 UM93TF01 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 611
Score = 40.1 bits (20), Expect = 0.082
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 153 gtaacaggaggagctggttatattggttcaca 184
||||| ||||||||||| | ||||||||||||
Sbjct: 188 gtaactggaggagctggatttattggttcaca 219
>gb|BP927943.1|BP927943 BP927943 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-077_G13.f 5', mRNA sequence
Length = 478
Score = 40.1 bits (20), Expect = 0.082
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 309 atctttgctgatctggggga 328
||||||||||||||||||||
Sbjct: 201 atctttgctgatctggggga 182
>gb|DT474122.1|DT474122 WS01230.BR_O03 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01230_O03 5', mRNA sequence
Length = 883
Score = 40.1 bits (20), Expect = 0.082
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 153 gtaacaggaggagctggttatattggttcaca 184
||||| ||||||||||| | ||||||||||||
Sbjct: 188 gtaactggaggagctggatttattggttcaca 219
>gb|AJ777448.1|AJ777448 AJ777448 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400028D04F1, mRNA sequence
Length = 659
Score = 38.2 bits (19), Expect = 0.32
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 452 ctgaaaatgcatttgatgc 470
|||||||||||||||||||
Sbjct: 552 ctgaaaatgcatttgatgc 570
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 62,691
Number of Sequences: 369679
Number of extensions: 62691
Number of successful extensions: 18007
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17952
Number of HSP's gapped (non-prelim): 55
length of query: 523
length of database: 203,408,664
effective HSP length: 19
effective length of query: 504
effective length of database: 196,384,763
effective search space: 98977920552
effective search space used: 98977920552
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)