BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCA17a05.yg.2.1
(548 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV277661.1|CV277661 WS0144.B21_D09 PTxD-IL-A-5 Populus t... 54 6e-006
gb|DN493538.1|DN493538 C044P02.5pR Populus strain T89 leave... 54 6e-006
gb|BI071270.1|BI071270 C054P51U Populus strain T89 leaves P... 50 9e-005
gb|CV237411.1|CV237411 WS01227.B21.1_N22 PT-GT-FL-A-3 Popul... 50 9e-005
gb|AJ774176.1|AJ774176 AJ774176 Populus euphratica shoot 3-... 38 0.34
>gb|CV277661.1|CV277661 WS0144.B21_D09 PTxD-IL-A-5 Populus trichocarpa x Populus deltoides
cDNA clone WS0144_D09 3', mRNA sequence
Length = 877
Score = 54.0 bits (27), Expect = 6e-006
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 446 tccacccacatgcccatgctcacgtcctccatctt 480
||||||||||| |||||||||||||| ||||||||
Sbjct: 544 tccacccacattcccatgctcacgtcttccatctt 578
>gb|DN493538.1|DN493538 C044P02.5pR Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA clone C044P02 5', mRNA sequence
Length = 598
Score = 54.0 bits (27), Expect = 6e-006
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 446 tccacccacatgcccatgctcacgtcctccatctt 480
||||||||||| |||||||||||||| ||||||||
Sbjct: 563 tccacccacattcccatgctcacgtcttccatctt 529
>gb|BI071270.1|BI071270 C054P51U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 340
Score = 50.1 bits (25), Expect = 9e-005
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 445 ctccacccacatgcccatgctcacgtcctccatcttgaaca 485
|||||||||||| ||||| ||||| || |||||||||||||
Sbjct: 139 ctccacccacattcccatactcacatcttccatcttgaaca 99
>gb|CV237411.1|CV237411 WS01227.B21.1_N22 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01227_N22 3', mRNA sequence
Length = 867
Score = 50.1 bits (25), Expect = 9e-005
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 449 acccacatgcccatgctcacgtcctccatcttgaaca 485
|||||||| ||||||||||| || |||||||||||||
Sbjct: 540 acccacattcccatgctcacatcttccatcttgaaca 576
Score = 38.2 bits (19), Expect = 0.34
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 389 aactggcagaacctccagctgtggacatact 419
|||||||||||| || ||||||| |||||||
Sbjct: 480 aactggcagaacttcaagctgtgcacatact 510
>gb|AJ774176.1|AJ774176 AJ774176 Populus euphratica shoot 3-6 months Populus euphratica
cDNA clone P0000300013F04F1, mRNA sequence
Length = 366
Score = 38.2 bits (19), Expect = 0.34
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 323 tcccagaggcacagcatctgcctgggggactggta 357
||||||||||| | ||| |||||||||| ||||||
Sbjct: 263 tcccagaggcatatcatttgcctgggggcctggta 229
Score = 38.2 bits (19), Expect = 0.34
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 389 aactggcagaacctccagctgtggacatact 419
|||||||||||| || ||||||| |||||||
Sbjct: 197 aactggcagaacttcaagctgtgcacatact 167
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 46,715
Number of Sequences: 369679
Number of extensions: 46715
Number of successful extensions: 12896
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12884
Number of HSP's gapped (non-prelim): 12
length of query: 548
length of database: 203,408,664
effective HSP length: 19
effective length of query: 529
effective length of database: 196,384,763
effective search space: 103887539627
effective search space used: 103887539627
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)