BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBS9a01.xg.2.1
(480 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV130599.1|CV130599 B9SP06e11 Populus stem seasonal libr... 119 1e-025
gb|CF235007.1|CF235007 PtaJXT0017G2G0214 Poplar cDNA librar... 100 9e-020
gb|CA924252.1|CA924252 MTU7CL.P3.E09 Aspen leaf cDNA Librar... 74 5e-012
gb|CX170067.1|CX170067 A03_69-2_01.ab1 leaf inoculated with... 66 1e-009
gb|CV241047.1|CV241047 WS02511.B21_B06 PT-MB-N-A-15 Populus... 54 5e-006
gb|CK319187.1|CK319187 X9P07h03 Populus stem seasonal libra... 50 8e-005
gb|AJ775854.1|AJ775854 AJ775854 Populus euphratica root 3-6... 48 3e-004
gb|BU880404.1|BU880404 UM45TE12 Populus flower cDNA library... 42 0.019
gb|BU882839.1|BU882839 UM82TH11 Populus flower cDNA library... 42 0.019
gb|BU892831.1|BU892831 P070A09 Populus petioles cDNA librar... 42 0.019
gb|DN500996.1|DN500996 UM45TE12.5pR Populus female catkins ... 42 0.019
gb|DN501301.1|DN501301 UM82TH11.5pR Populus female catkins ... 42 0.019
gb|DV464576.1|DV464576 MTUNUL1.P29.C05 NUL Populus fremonti... 42 0.019
gb|BI127494.1|BI127494 G061P44Y Populus cambium cDNA librar... 38 0.30
gb|BU868208.1|BU868208 M112E10 Populus flower cDNA library ... 38 0.30
gb|BU884580.1|BU884580 R012F05 Populus root cDNA library Po... 38 0.30
gb|CA822124.1|CA822124 R04A09 two-month-old roots from clon... 38 0.30
gb|CV263587.1|CV263587 WS02022.B21_E03 PTxN-IB-N-A-11 Popul... 38 0.30
gb|CV274393.1|CV274393 WS0173.B21_C04 PTxD-NR-A-8 Populus t... 38 0.30
gb|DT469933.1|DT469933 WS01919.C21_F19 PT-DX-N-A-10 Populus... 38 0.30
gb|DT506628.1|DT506628 WS02416.BR_B08 PTxD-ICC-N-A-14 Popul... 38 0.30
gb|AI165848.1|AI165848 A092P75U Hybrid aspen plasmid librar... 36 1.2
gb|BI130753.1|BI130753 G110P33Y Populus cambium cDNA librar... 36 1.2
gb|BU877670.1|BU877670 V037G09 Populus flower cDNA library ... 36 1.2
gb|BU884952.1|BU884952 R018E05 Populus root cDNA library Po... 36 1.2
gb|BU895269.1|BU895269 X021F05 Populus wood cDNA library Po... 36 1.2
gb|BU896865.1|BU896865 X047A11 Populus wood cDNA library Po... 36 1.2
gb|BU897345.1|BU897345 X055E08 Populus wood cDNA library Po... 36 1.2
gb|CF227420.1|CF227420 PtaD4G12B0804 Poplar cDNA library fr... 36 1.2
gb|CF233538.1|CF233538 PtaJXO0024G2G0214 Poplar cDNA librar... 36 1.2
gb|CK099979.1|CK099979 A092P75.5pR Hybrid aspen plasmid lib... 36 1.2
gb|CN193407.1|CN193407 PtdH925 hybrid poplar systemically w... 36 1.2
gb|CN193408.1|CN193408 PtdH926A hybrid poplar systemically ... 36 1.2
gb|CN518843.1|CN518843 GQ0102.B3_N15 GQ010 Populus trichoca... 36 1.2
gb|CV226012.1|CV226012 WS0163.B21_A14 PT-DX-A-7 Populus tri... 36 1.2
gb|CV263630.1|CV263630 WS02022.B21_F22 PTxN-IB-N-A-11 Popul... 36 1.2
gb|CV269517.1|CV269517 WS0208.B21_H14 PTxN-IB-N-A-11 Populu... 36 1.2
gb|CV280347.1|CV280347 WS0135.B21_O19 PTxD-IL-FL-A-4 Populu... 36 1.2
gb|CV280518.1|CV280518 WS0136.B21_J21 PTxD-IL-FL-A-4 Populu... 36 1.2
gb|CV280532.1|CV280532 WS0136.B21_K22 PTxD-IL-FL-A-4 Populu... 36 1.2
gb|CV280571.1|CV280571 WS0136.B21_N15 PTxD-IL-FL-A-4 Populu... 36 1.2
gb|CV280668.1|CV280668 WS0137.B21_E05 PTxD-IL-FL-A-4 Populu... 36 1.2
gb|CX168382.1|CX168382 D02_69-92_08.ab1 leaf inoculated wit... 36 1.2
gb|CX173466.1|CX173466 D04_69-47_08.ab1 leaf inoculated wit... 36 1.2
gb|DT478714.1|DT478714 WS02523.BR_J10 PT-MB-N-A-15 Populus ... 36 1.2
gb|DT483904.1|DT483904 WS02523.B21_O07 PT-MB-N-A-15 Populus... 36 1.2
gb|DT491763.1|DT491763 WS02548.C21_L11 PT-MB-N-A-15 Populus... 36 1.2
gb|DT500989.1|DT500989 WS0131.BR_B02 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT501048.1|DT501048 WS0131.BR_E12 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT501134.1|DT501134 WS0131.BR_K02 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT501168.1|DT501168 WS0131.BR_M04 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT501220.1|DT501220 WS0131.BR_P08 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT501964.1|DT501964 WS01314.BR_O19 PTxD-IL-FL-A-4 Populu... 36 1.2
gb|DT501970.1|DT501970 WS01314.BR_P07 PTxD-IL-FL-A-4 Populu... 36 1.2
gb|DT502531.1|DT502531 WS0133.BR_E23 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT502832.1|DT502832 WS0134.BR_G11 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT502950.1|DT502950 WS0134.BR_N12 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT503229.1|DT503229 WS0135.BR_O19 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT503438.1|DT503438 WS0136.BR_J21 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT503454.1|DT503454 WS0136.BR_K22 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT503501.1|DT503501 WS0136.BR_N15 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT503614.1|DT503614 WS0137.BR_E05 PTxD-IL-FL-A-4 Populus... 36 1.2
gb|DT504835.1|DT504835 WS01314.B21_O19 PTxD-IL-FL-A-4 Popul... 36 1.2
gb|DT504841.1|DT504841 WS01314.B21_P07 PTxD-IL-FL-A-4 Popul... 36 1.2
gb|DT518965.1|DT518965 WS02439.B21_N16 PTxD-ICC-N-A-14 Popu... 36 1.2
emb|AJ567346.1|POP567346 Populus tremula x Populus tremuloi... 36 1.2
gb|BU835813.1|BU835813 T079A03 Populus apical shoot cDNA li... 34 4.6
gb|BU881923.1|BU881923 UM69TD03 Populus flower cDNA library... 34 4.6
gb|CA929446.1|CA929446 MTU2CA.P13.H03 Aspen apex cDNA Libra... 34 4.6
gb|CA929658.1|CA929658 MTU2CA.P16.G09 Aspen apex cDNA Libra... 34 4.6
gb|CK100260.1|CK100260 C015P36.5pR Populus strain T89 leave... 34 4.6
gb|CK110723.1|CK110723 P026F09 Populus petioles cDNA librar... 34 4.6
gb|CN192837.1|CN192837 PtdH1735 hybrid poplar systemically ... 34 4.6
gb|AJ767093.1|AJ767093 AJ767093 Populus euphratica leaf adu... 34 4.6
gb|CV244163.1|CV244163 WS0253.B21_O13 PT-MB-N-A-15 Populus ... 34 4.6
gb|CV253606.1|CV253606 WS0222.B21_H07 PTxD-ICC-A-12 Populus... 34 4.6
gb|CV263015.1|CV263015 WS02020.B21_B23 PTxN-IB-N-A-11 Popul... 34 4.6
gb|CX177383.1|CX177383 B08_45-35_04.ab1 leaf inoculated wit... 34 4.6
gb|CX178290.1|CX178290 C06_45-118_06.ab1 leaf inoculated wi... 34 4.6
gb|CX178573.1|CX178573 D06_45-118_08.ab1 leaf inoculated wi... 34 4.6
gb|CX181004.1|CX181004 G07_45-80_13.ab1 leaf inoculated wit... 34 4.6
gb|CX181135.1|CX181135 A05_45-12_01.ab1 leaf inoculated wit... 34 4.6
gb|CX185831.1|CX185831 G09_45-95_13.ab1 leaf inoculated wit... 34 4.6
gb|BP925066.1|BP925066 BP925066 full-length enriched poplar... 34 4.6
gb|BP926230.1|BP926230 BP926230 full-length enriched poplar... 34 4.6
gb|DT472094.1|DT472094 WS01225.BR.1_B17 PT-GT-FL-A-3 Populu... 34 4.6
gb|DT520041.1|DT520041 WS02446.B21.1_G16 PTxD-ICC-N-A-14 Po... 34 4.6
gb|AC149545.1| Populus trichocarpa clone Pop1-71J23, comple... 34 4.6
>gb|CV130599.1|CV130599 B9SP06e11 Populus stem seasonal library Populus deltoides cDNA,
mRNA sequence
Length = 879
Score = 119 bits (60), Expect = 1e-025
Identities = 102/116 (87%)
Strand = Plus / Plus
Query: 67 tggtctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaatctatgg 126
|||||||| |||||||| ||| | || || || |||||||||||||| |||||| |||||
Sbjct: 544 tggtctcagattgcagcacagttacctggaagaactgataatgagataaagaatttatgg 603
Query: 127 aactcgtgcatcaagaagaagctgaggcagaaaggcattgatcccaacacccacaa 182
||||| ||||| ||||||||||||||||||| ||||||||| |||||||| |||||
Sbjct: 604 aactcctgcattaagaagaagctgaggcagagaggcattgaccccaacactcacaa 659
>gb|CF235007.1|CF235007 PtaJXT0017G2G0214 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 725
Score = 99.6 bits (50), Expect = 9e-020
Identities = 99/116 (85%)
Strand = Plus / Plus
Query: 67 tggtctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaatctatgg 126
|||||||| |||||||| ||| | || || || |||||||||||||| |||||| |||||
Sbjct: 493 tggtctcagattgcagcacagttacctggaagaactgataatgagataaagaatttatgg 552
Query: 127 aactcgtgcatcaagaagaagctgaggcagaaaggcattgatcccaacacccacaa 182
||||| ||||| || || ||||||||||||| |||||||| |||||||| |||||
Sbjct: 553 aactcctgcattaanaanaagctgaggcagaggggcattgaccccaacactcacaa 608
>gb|CA924252.1|CA924252 MTU7CL.P3.E09 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 747
Score = 73.8 bits (37), Expect = 5e-012
Identities = 109/133 (81%)
Strand = Plus / Minus
Query: 64 aggtggtctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaatcta 123
||||||||||| ||||| || ||| |||| || ||||| || ||||| || |||||||||
Sbjct: 310 aggtggtctcagattgcggcacagttgcccggaaggacagacaatgaaataaagaatcta 251
Query: 124 tggaactcgtgcatcaagaagaagctgaggcagaaaggcattgatcccaacacccacaag 183
|||||||| ||| | ||||| || || ||||||| ||||||||| || ||||||||
Sbjct: 250 tggaactcttgcttaaagaaaaaacttaggcagagaggcattgaccctgttacccacaaa 191
Query: 184 ccacttactgagg 196
|||||| ||||||
Sbjct: 190 ccactttctgagg 178
>gb|CX170067.1|CX170067 A03_69-2_01.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 669
Score = 65.9 bits (33), Expect = 1e-009
Identities = 108/133 (81%)
Strand = Plus / Plus
Query: 64 aggtggtctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaatcta 123
||||||||||| ||||| || || |||| || ||||| || ||||| || |||||||||
Sbjct: 461 aggtggtctcagattgcggcacaattgcctggaaggacagacaatgaaataaagaatcta 520
Query: 124 tggaactcgtgcatcaagaagaagctgaggcagaaaggcattgatcccaacacccacaag 183
|||||||| ||| | ||||| || || ||||||| ||||||||| || ||||||||
Sbjct: 521 tggaactcttgcttaaagaaaaaacttaggcagagaggcattgaccctgttacccacaaa 580
Query: 184 ccacttactgagg 196
|||||| ||||||
Sbjct: 581 ccactttctgagg 593
>gb|CV241047.1|CV241047 WS02511.B21_B06 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02511_B06 3', mRNA sequence
Length = 766
Score = 54.0 bits (27), Expect = 5e-006
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 89 tgccagggaggactgataatgagatcaagaa 119
|||||||||| ||||||||||||||||||||
Sbjct: 759 tgccagggagaactgataatgagatcaagaa 729
>gb|CK319187.1|CK319187 X9P07h03 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 776
Score = 50.1 bits (25), Expect = 8e-005
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 88 ctgccagggaggactgataatgagatcaagaat 120
||||| || ||||||||||||||||||||||||
Sbjct: 319 ctgcctggaaggactgataatgagatcaagaat 351
>gb|AJ775854.1|AJ775854 AJ775854 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400006D03F1, mRNA sequence
Length = 626
Score = 48.1 bits (24), Expect = 3e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 75 aattgcagcgcagctgccagggaggactgataatga 110
||||||||| ||| ||||||| ||||||||||||||
Sbjct: 169 aattgcagctcagttgccaggcaggactgataatga 204
>gb|BU880404.1|BU880404 UM45TE12 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 506
Score = 42.1 bits (21), Expect = 0.019
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 96 gaggactgataatgagatcaagaat 120
|||||| ||||||||||||||||||
Sbjct: 321 gaggacagataatgagatcaagaat 345
>gb|BU882839.1|BU882839 UM82TH11 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 584
Score = 42.1 bits (21), Expect = 0.019
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 100 actgataatgagatcaagaat 120
|||||||||||||||||||||
Sbjct: 396 actgataatgagatcaagaat 416
>gb|BU892831.1|BU892831 P070A09 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 674
Score = 42.1 bits (21), Expect = 0.019
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 96 gaggactgataatgagatcaagaat 120
|||||| ||||||||||||||||||
Sbjct: 310 gaggacagataatgagatcaagaat 334
>gb|DN500996.1|DN500996 UM45TE12.5pR Populus female catkins cDNA library Populus
trichocarpa cDNA clone UM45TE12 5', mRNA sequence
Length = 801
Score = 42.1 bits (21), Expect = 0.019
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 96 gaggactgataatgagatcaagaat 120
|||||| ||||||||||||||||||
Sbjct: 320 gaggacagataatgagatcaagaat 344
>gb|DN501301.1|DN501301 UM82TH11.5pR Populus female catkins cDNA library Populus
trichocarpa cDNA clone UM82TH11 5', mRNA sequence
Length = 716
Score = 42.1 bits (21), Expect = 0.019
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 100 actgataatgagatcaagaat 120
|||||||||||||||||||||
Sbjct: 396 actgataatgagatcaagaat 416
>gb|DV464576.1|DV464576 MTUNUL1.P29.C05 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 775
Score = 42.1 bits (21), Expect = 0.019
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 96 gaggactgataatgagatcaagaat 120
|||||| ||||||||||||||||||
Sbjct: 312 gaggacagataatgagatcaagaat 336
>gb|BI127494.1|BI127494 G061P44Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 557
Score = 38.2 bits (19), Expect = 0.30
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 103 gataatgagatcaagaatc 121
|||||||||||||||||||
Sbjct: 328 gataatgagatcaagaatc 346
>gb|BU868208.1|BU868208 M112E10 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 450
Score = 38.2 bits (19), Expect = 0.30
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 103 gataatgagatcaagaatc 121
|||||||||||||||||||
Sbjct: 290 gataatgagatcaagaatc 308
>gb|BU884580.1|BU884580 R012F05 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 738
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 61 aacaggtggtctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaa 119
||||| |||||| | |||||| | || || ||||| || ||||||||||| ||||||||
Sbjct: 325 aacagatggtctaagattgcatcacatctaccaggaagaactgataatgaaatcaagaa 383
>gb|CA822124.1|CA822124 R04A09 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 690
Score = 38.2 bits (19), Expect = 0.30
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 103 gataatgagatcaagaatc 121
|||||||||||||||||||
Sbjct: 366 gataatgagatcaagaatc 384
>gb|CV263587.1|CV263587 WS02022.B21_E03 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02022_E03 3', mRNA sequence
Length = 941
Score = 38.2 bits (19), Expect = 0.30
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 103 gataatgagatcaagaatc 121
|||||||||||||||||||
Sbjct: 908 gataatgagatcaagaatc 890
>gb|CV274393.1|CV274393 WS0173.B21_C04 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0173_C04 3', mRNA sequence
Length = 932
Score = 38.2 bits (19), Expect = 0.30
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 103 gataatgagatcaagaatc 121
|||||||||||||||||||
Sbjct: 923 gataatgagatcaagaatc 905
>gb|DT469933.1|DT469933 WS01919.C21_F19 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01919_F19 3', mRNA sequence
Length = 868
Score = 38.2 bits (19), Expect = 0.30
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 103 gataatgagatcaagaatc 121
|||||||||||||||||||
Sbjct: 782 gataatgagatcaagaatc 764
>gb|DT506628.1|DT506628 WS02416.BR_B08 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02416_B08 5', mRNA sequence
Length = 858
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 61 aacaggtggtctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaa 119
||||| |||||| | |||||| | || || ||||| || ||||||||||| ||||||||
Sbjct: 351 aacagatggtctaagattgcatcacatctaccaggaagaactgataatgaaatcaagaa 409
Score = 34.2 bits (17), Expect = 4.6
Identities = 44/53 (83%)
Strand = Plus / Plus
Query: 136 atcaagaagaagctgaggcagaaaggcattgatcccaacacccacaagccact 188
|||||||||||||| ||| ||| || |||||||| ||| |||||||||||
Sbjct: 426 atcaagaagaagctaaggaagatgggaattgatcctctcactcacaagccact 478
>gb|AI165848.1|AI165848 A092P75U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 415
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 50 ccagggagaacagataatgagataaagaat 79
>gb|BI130753.1|BI130753 G110P33Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 515
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 402 ccagggagaacagataatgagataaagaat 431
>gb|BU877670.1|BU877670 V037G09 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 439
Score = 36.2 bits (18), Expect = 1.2
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 169 cccaacacccacaagcca 186
||||||||||||||||||
Sbjct: 132 cccaacacccacaagcca 115
>gb|BU884952.1|BU884952 R018E05 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 675
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 425 ccagggagaacagataatgagataaagaat 454
>gb|BU895269.1|BU895269 X021F05 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 671
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 516 ccagggagaacagataatgagataaagaat 545
>gb|BU896865.1|BU896865 X047A11 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 550
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 234 ccagggagaacagataatgagataaagaat 263
>gb|BU897345.1|BU897345 X055E08 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 530
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 246 ccagggagaacagataatgagataaagaat 275
>gb|CF227420.1|CF227420 PtaD4G12B0804 Poplar cDNA library from wood tissues Populus alba x
Populus tremula cDNA 5', mRNA sequence
Length = 576
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 424 ccagggagaacagataatgagataaagaat 453
>gb|CF233538.1|CF233538 PtaJXO0024G2G0214 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 732
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 81 ccagggagaacagataatgagataaagaat 110
>gb|CK099979.1|CK099979 A092P75.5pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A092P75 5', mRNA sequence
Length = 730
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 95 ccagggagaacagataatgagataaagaat 124
>gb|CN193407.1|CN193407 PtdH925 hybrid poplar systemically wound-induced leaf cDNA library
Populus trichocarpa x Populus deltoides cDNA 5, mRNA
sequence
Length = 341
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 295 ccagggagaacagataatgagataaagaat 324
>gb|CN193408.1|CN193408 PtdH926A hybrid poplar systemically wound-induced leaf cDNA library
Populus trichocarpa x Populus deltoides cDNA 5, mRNA
sequence
Length = 397
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 340 ccagggagaacagataatgagataaagaat 369
>gb|CN518843.1|CN518843 GQ0102.B3_N15 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0102_N15 5', mRNA sequence
Length = 570
Score = 36.2 bits (18), Expect = 1.2
Identities = 24/26 (92%)
Strand = Plus / Plus
Query: 106 aatgagatcaagaatctatggaactc 131
||||| || |||||||||||||||||
Sbjct: 477 aatgaaataaagaatctatggaactc 502
>gb|CV226012.1|CV226012 WS0163.B21_A14 PT-DX-A-7 Populus trichocarpa cDNA clone WS0163_A14
3', mRNA sequence
Length = 837
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 761 ccagggagaacagataatgagataaagaat 732
>gb|CV263630.1|CV263630 WS02022.B21_F22 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02022_F22 3', mRNA sequence
Length = 913
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 431 ccagggagaacagataatgagataaagaat 460
>gb|CV269517.1|CV269517 WS0208.B21_H14 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0208_H14 3', mRNA sequence
Length = 788
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 725 ccagggagaacagataatgagataaagaat 696
>gb|CV280347.1|CV280347 WS0135.B21_O19 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0135_O19 3', mRNA sequence
Length = 878
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 691 ccagggagaacagataatgagataaagaat 662
>gb|CV280518.1|CV280518 WS0136.B21_J21 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0136_J21 3', mRNA sequence
Length = 843
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 676 ccagggagaacagataatgagataaagaat 647
>gb|CV280532.1|CV280532 WS0136.B21_K22 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0136_K22 3', mRNA sequence
Length = 841
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 676 ccagggagaacagataatgagataaagaat 647
>gb|CV280571.1|CV280571 WS0136.B21_N15 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0136_N15 3', mRNA sequence
Length = 842
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 676 ccagggagaacagataatgagataaagaat 647
>gb|CV280668.1|CV280668 WS0137.B21_E05 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0137_E05 3', mRNA sequence
Length = 824
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 676 ccagggagaacagataatgagataaagaat 647
>gb|CX168382.1|CX168382 D02_69-92_08.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 681
Score = 36.2 bits (18), Expect = 1.2
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 324 aatgctgatgcccgtgta 341
||||||||||||||||||
Sbjct: 405 aatgctgatgcccgtgta 422
>gb|CX173466.1|CX173466 D04_69-47_08.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 656
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 356 ccagggagaacagataatgagataaagaat 327
>gb|DT478714.1|DT478714 WS02523.BR_J10 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02523_J10 5', mRNA sequence
Length = 838
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 267 ccagggagaacagataatgagataaagaat 238
>gb|DT483904.1|DT483904 WS02523.B21_O07 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02523_O07 3', mRNA sequence
Length = 912
Score = 36.2 bits (18), Expect = 1.2
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 103 gataatgagatcaagaat 120
||||||||||||||||||
Sbjct: 738 gataatgagatcaagaat 721
>gb|DT491763.1|DT491763 WS02548.C21_L11 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02548_L11 3', mRNA sequence
Length = 823
Score = 36.2 bits (18), Expect = 1.2
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 103 gataatgagatcaagaat 120
||||||||||||||||||
Sbjct: 795 gataatgagatcaagaat 778
>gb|DT500989.1|DT500989 WS0131.BR_B02 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0131_B02 5', mRNA sequence
Length = 851
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 175 ccagggagaacagataatgagataaagaat 204
>gb|DT501048.1|DT501048 WS0131.BR_E12 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0131_E12 5', mRNA sequence
Length = 841
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 181 ccagggagaacagataatgagataaagaat 210
>gb|DT501134.1|DT501134 WS0131.BR_K02 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0131_K02 5', mRNA sequence
Length = 702
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 68 ccagggagaacagataatgagataaagaat 97
>gb|DT501168.1|DT501168 WS0131.BR_M04 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0131_M04 5', mRNA sequence
Length = 784
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 182 ccagggagaacagataatgagataaagaat 211
>gb|DT501220.1|DT501220 WS0131.BR_P08 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0131_P08 5', mRNA sequence
Length = 772
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 138 ccagggagaacagataatgagataaagaat 167
>gb|DT501964.1|DT501964 WS01314.BR_O19 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01314_O19 5', mRNA sequence
Length = 852
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT501970.1|DT501970 WS01314.BR_P07 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01314_P07 5', mRNA sequence
Length = 851
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT502531.1|DT502531 WS0133.BR_E23 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0133_E23 5', mRNA sequence
Length = 857
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 183 ccagggagaacagataatgagataaagaat 212
>gb|DT502832.1|DT502832 WS0134.BR_G11 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0134_G11 5', mRNA sequence
Length = 765
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT502950.1|DT502950 WS0134.BR_N12 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0134_N12 5', mRNA sequence
Length = 759
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT503229.1|DT503229 WS0135.BR_O19 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0135_O19 5', mRNA sequence
Length = 852
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT503438.1|DT503438 WS0136.BR_J21 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0136_J21 5', mRNA sequence
Length = 852
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT503454.1|DT503454 WS0136.BR_K22 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0136_K22 5', mRNA sequence
Length = 851
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT503501.1|DT503501 WS0136.BR_N15 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0136_N15 5', mRNA sequence
Length = 850
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT503614.1|DT503614 WS0137.BR_E05 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS0137_E05 5', mRNA sequence
Length = 851
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 177 ccagggagaacagataatgagataaagaat 206
>gb|DT504835.1|DT504835 WS01314.B21_O19 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01314_O19 3', mRNA sequence
Length = 845
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 676 ccagggagaacagataatgagataaagaat 647
>gb|DT504841.1|DT504841 WS01314.B21_P07 PTxD-IL-FL-A-4 Populus trichocarpa x Populus
deltoides cDNA clone WS01314_P07 3', mRNA sequence
Length = 846
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 676 ccagggagaacagataatgagataaagaat 647
>gb|DT518965.1|DT518965 WS02439.B21_N16 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02439_N16 3', mRNA sequence
Length = 874
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 738 ccagggagaacagataatgagataaagaat 709
>emb|AJ567346.1|POP567346 Populus tremula x Populus tremuloides mRNA for MYB transcription
factor R2R3 type (myb gene)
Length = 813
Score = 36.2 bits (18), Expect = 1.2
Identities = 27/30 (90%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaat 120
|||||||| || ||||||||||| ||||||
Sbjct: 292 ccagggagaacagataatgagataaagaat 321
>gb|BU835813.1|BU835813 T079A03 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 464
Score = 34.2 bits (17), Expect = 4.6
Identities = 26/29 (89%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaa 119
|||||||| || ||||| |||||||||||
Sbjct: 285 ccagggagaacagataacgagatcaagaa 313
>gb|BU881923.1|BU881923 UM69TD03 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 524
Score = 34.2 bits (17), Expect = 4.6
Identities = 26/29 (89%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaa 119
||||| ||||| ||||| |||||||||||
Sbjct: 247 ccaggaaggacagataacgagatcaagaa 275
>gb|CA929446.1|CA929446 MTU2CA.P13.H03 Aspen apex cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 668
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 401 tgttcctggagcagctt 417
|||||||||||||||||
Sbjct: 114 tgttcctggagcagctt 98
>gb|CA929658.1|CA929658 MTU2CA.P16.G09 Aspen apex cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 613
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 401 tgttcctggagcagctt 417
|||||||||||||||||
Sbjct: 117 tgttcctggagcagctt 101
>gb|CK100260.1|CK100260 C015P36.5pR Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA clone C015P36 5', mRNA sequence
Length = 582
Score = 34.2 bits (17), Expect = 4.6
Identities = 26/29 (89%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaa 119
||||| ||||| ||||| |||||||||||
Sbjct: 417 ccaggaaggacagataacgagatcaagaa 445
>gb|CK110723.1|CK110723 P026F09 Populus petioles cDNA library Populus tremula cDNA clone
P026F09 5', mRNA sequence
Length = 311
Score = 34.2 bits (17), Expect = 4.6
Identities = 26/29 (89%)
Strand = Plus / Plus
Query: 135 catcaagaagaagctgaggcagaaaggca 163
||||||||||||| |||| |||||||||
Sbjct: 162 catcaagaagaagaggaggaagaaaggca 190
>gb|CN192837.1|CN192837 PtdH1735 hybrid poplar systemically wound-induced leaf cDNA library
Populus trichocarpa x Populus deltoides cDNA 5, mRNA
sequence
Length = 428
Score = 34.2 bits (17), Expect = 4.6
Identities = 26/29 (89%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgagatcaagaa 119
||||| ||||| ||||| |||||||||||
Sbjct: 374 ccaggaaggacagataacgagatcaagaa 402
>gb|AJ767093.1|AJ767093 AJ767093 Populus euphratica leaf adult Populus euphratica cDNA
clone P0000100001D02F1, mRNA sequence
Length = 573
Score = 34.2 bits (17), Expect = 4.6
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 91 ccagggaggactgataatgag 111
||||| |||||||||||||||
Sbjct: 450 ccaggaaggactgataatgag 470
>gb|CV244163.1|CV244163 WS0253.B21_O13 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS0253_O13 3', mRNA sequence
Length = 600
Score = 34.2 bits (17), Expect = 4.6
Identities = 26/29 (89%)
Strand = Plus / Minus
Query: 91 ccagggaggactgataatgagatcaagaa 119
||||| ||||| ||||| |||||||||||
Sbjct: 591 ccaggaaggacagataacgagatcaagaa 563
>gb|CV253606.1|CV253606 WS0222.B21_H07 PTxD-ICC-A-12 Populus trichocarpa x Populus
deltoides cDNA clone WS0222_H07 3', mRNA sequence
Length = 706
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 138 caagaagaagctgaggc 154
|||||||||||||||||
Sbjct: 400 caagaagaagctgaggc 384
>gb|CV263015.1|CV263015 WS02020.B21_B23 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02020_B23 3', mRNA sequence
Length = 487
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 103 gataatgagatcaagaa 119
|||||||||||||||||
Sbjct: 57 gataatgagatcaagaa 41
>gb|CX177383.1|CX177383 B08_45-35_04.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 694
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 401 tgttcctggagcagctt 417
|||||||||||||||||
Sbjct: 666 tgttcctggagcagctt 682
>gb|CX178290.1|CX178290 C06_45-118_06.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 656
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 461 aaactctctatttccct 477
|||||||||||||||||
Sbjct: 47 aaactctctatttccct 31
>gb|CX178573.1|CX178573 D06_45-118_08.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 648
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 461 aaactctctatttccct 477
|||||||||||||||||
Sbjct: 47 aaactctctatttccct 31
>gb|CX181004.1|CX181004 G07_45-80_13.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 638
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 237 aacctcagggtccagcg 253
|||||||||||||||||
Sbjct: 237 aacctcagggtccagcg 221
>gb|CX181135.1|CX181135 A05_45-12_01.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 670
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 237 aacctcagggtccagcg 253
|||||||||||||||||
Sbjct: 268 aacctcagggtccagcg 252
>gb|CX185831.1|CX185831 G09_45-95_13.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 686
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 401 tgttcctggagcagctt 417
|||||||||||||||||
Sbjct: 656 tgttcctggagcagctt 672
>gb|BP925066.1|BP925066 BP925066 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-040_C06.f 5', mRNA sequence
Length = 606
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 237 aacctcagggtccagcg 253
|||||||||||||||||
Sbjct: 220 aacctcagggtccagcg 204
>gb|BP926230.1|BP926230 BP926230 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-056_O18.f 5', mRNA sequence
Length = 572
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 237 aacctcagggtccagcg 253
|||||||||||||||||
Sbjct: 345 aacctcagggtccagcg 329
>gb|DT472094.1|DT472094 WS01225.BR.1_B17 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01225_B17 5', mRNA sequence
Length = 887
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 17 aagacgaagaagacctc 33
|||||||||||||||||
Sbjct: 115 aagacgaagaagacctc 131
>gb|DT520041.1|DT520041 WS02446.B21.1_G16 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02446_G16 3', mRNA sequence
Length = 874
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 138 caagaagaagctgaggc 154
|||||||||||||||||
Sbjct: 400 caagaagaagctgaggc 384
>gb|AC149545.1| Populus trichocarpa clone Pop1-71J23, complete sequence
Length = 103543
Score = 34.2 bits (17), Expect = 4.6
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 108 tgagatcaagaatctat 124
|||||||||||||||||
Sbjct: 96921 tgagatcaagaatctat 96905
Database: Populus_nucl_with_EST.fasta
Posted date: May 2, 2006 3:31 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 59,960
Number of Sequences: 369679
Number of extensions: 59960
Number of successful extensions: 14558
Number of sequences better than 10.0: 90
Number of HSP's better than 10.0 without gapping: 90
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14449
Number of HSP's gapped (non-prelim): 109
length of query: 480
length of database: 203,408,664
effective HSP length: 19
effective length of query: 461
effective length of database: 196,384,763
effective search space: 90533375743
effective search space used: 90533375743
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)