BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF31c07.yg.2.3
(732 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU877658.1|BU877658 V037F03 Populus flower cDNA library ... 40 0.12
gb|DN501916.1|DN501916 V037F03.5pR Populus male catkins cDN... 40 0.12
gb|DT479421.1|DT479421 WS02525.BR_N02 PT-MB-N-A-15 Populus ... 40 0.12
>gb|BU877658.1|BU877658 V037F03 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 475
Score = 40.1 bits (20), Expect = 0.12
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 401 atggattggatcattcacctcgatactgatgagttgattcatccagctggtgcccg 456
||||||||||| |||| || || |||||||| ||||||| || |||||||||||
Sbjct: 168 atggattggatacttcatcttgacactgatgaactgattcaccctgctggtgcccg 223
>gb|DN501916.1|DN501916 V037F03.5pR Populus male catkins cDNA library Populus trichocarpa
cDNA clone V037F03 5', mRNA sequence
Length = 663
Score = 40.1 bits (20), Expect = 0.12
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 401 atggattggatcattcacctcgatactgatgagttgattcatccagctggtgcccg 456
||||||||||| |||| || || |||||||| ||||||| || |||||||||||
Sbjct: 217 atggattggatacttcatcttgacactgatgaactgattcaccctgctggtgcccg 272
>gb|DT479421.1|DT479421 WS02525.BR_N02 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02525_N02 5', mRNA sequence
Length = 910
Score = 40.1 bits (20), Expect = 0.12
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 401 atggattggatcattcacctcgatactgatgagttgattcatccagctggtgcccg 456
||||||||||| |||| || || |||||||| ||||||| || |||||||||||
Sbjct: 770 atggattggatacttcatcttgacactgatgaactgattcaccctgctggtgcccg 825
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 70,780
Number of Sequences: 369679
Number of extensions: 70780
Number of successful extensions: 19879
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19876
Number of HSP's gapped (non-prelim): 3
length of query: 732
length of database: 203,408,664
effective HSP length: 19
effective length of query: 713
effective length of database: 196,384,763
effective search space: 140022336019
effective search space used: 140022336019
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)