BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF31c07.yg.2.3
         (732 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BU877658.1|BU877658  V037F03 Populus flower cDNA library ...    40   0.12 
gb|DN501916.1|DN501916  V037F03.5pR Populus male catkins cDN...    40   0.12 
gb|DT479421.1|DT479421  WS02525.BR_N02 PT-MB-N-A-15 Populus ...    40   0.12 

>gb|BU877658.1|BU877658 V037F03 Populus flower cDNA library Populus trichocarpa cDNA 5
           prime, mRNA sequence
          Length = 475

 Score = 40.1 bits (20), Expect = 0.12
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 401 atggattggatcattcacctcgatactgatgagttgattcatccagctggtgcccg 456
           |||||||||||  |||| || || ||||||||  ||||||| || |||||||||||
Sbjct: 168 atggattggatacttcatcttgacactgatgaactgattcaccctgctggtgcccg 223



>gb|DN501916.1|DN501916 V037F03.5pR Populus male catkins cDNA library Populus trichocarpa
           cDNA clone V037F03 5', mRNA sequence
          Length = 663

 Score = 40.1 bits (20), Expect = 0.12
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 401 atggattggatcattcacctcgatactgatgagttgattcatccagctggtgcccg 456
           |||||||||||  |||| || || ||||||||  ||||||| || |||||||||||
Sbjct: 217 atggattggatacttcatcttgacactgatgaactgattcaccctgctggtgcccg 272



>gb|DT479421.1|DT479421 WS02525.BR_N02 PT-MB-N-A-15 Populus trichocarpa cDNA clone
           WS02525_N02 5', mRNA sequence
          Length = 910

 Score = 40.1 bits (20), Expect = 0.12
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 401 atggattggatcattcacctcgatactgatgagttgattcatccagctggtgcccg 456
           |||||||||||  |||| || || ||||||||  ||||||| || |||||||||||
Sbjct: 770 atggattggatacttcatcttgacactgatgaactgattcaccctgctggtgcccg 825



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 70,780
Number of Sequences: 369679
Number of extensions: 70780
Number of successful extensions: 19879
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19876
Number of HSP's gapped (non-prelim): 3
length of query: 732
length of database: 203,408,664
effective HSP length: 19
effective length of query: 713
effective length of database: 196,384,763
effective search space: 140022336019
effective search space used: 140022336019
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)