BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF30a10.yg.2.1
(1130 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AJ778077.1|AJ778077 AJ778077 Populus euphratica root 3-6... 44 0.012
>gb|AJ778077.1|AJ778077 AJ778077 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400039B03F1, mRNA sequence
Length = 674
Score = 44.1 bits (22), Expect = 0.012
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 842 ttttggtgtggtcatgttggag 863
||||||||||||||||||||||
Sbjct: 453 ttttggtgtggtcatgttggag 474
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 118,169
Number of Sequences: 369679
Number of extensions: 118169
Number of successful extensions: 33665
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33664
Number of HSP's gapped (non-prelim): 1
length of query: 1130
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1111
effective length of database: 196,384,763
effective search space: 218183471693
effective search space used: 218183471693
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)