BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AB021175.2.1
(1225 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AI166689.1|AI166689 xylem.est.497 Poplar xylem Lambda ZA... 40 0.20
gb|BU887353.1|BU887353 R058C06 Populus root cDNA library Po... 40 0.20
gb|CF231459.1|CF231459 PtaC0021F8F0812 Poplar cDNA library ... 40 0.20
gb|CV247347.1|CV247347 WS01117.B21_N22 PT-P-FL-A-2 Populus ... 40 0.20
gb|CV247631.1|CV247631 WS01118.B21_N01 PT-P-FL-A-2 Populus ... 40 0.20
gb|CV248700.1|CV248700 WS01121.B21_K06 PT-P-FL-A-2 Populus ... 40 0.20
gb|DN492413.1|DN492413 X013H10.3pR Populus wood cDNA librar... 40 0.20
gb|DN502456.1|DN502456 X013H10.5pR Populus wood cDNA librar... 40 0.20
gb|DT494249.1|DT494249 WS01117.BR_N22 PT-P-FL-A-2 Populus t... 40 0.20
gb|DT494569.1|DT494569 WS01118.BR.1_N01 PT-P-FL-A-2 Populus... 40 0.20
gb|DT495840.1|DT495840 WS01121.BR_K06 PT-P-FL-A-2 Populus t... 40 0.20
>gb|AI166689.1|AI166689 xylem.est.497 Poplar xylem Lambda ZAPII library Populus trichocarpa
cDNA 5', mRNA sequence
Length = 645
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 92 tcatggcggcggcggcggcg 111
||||||||||||||||||||
Sbjct: 264 tcatggcggcggcggcggcg 283
>gb|BU887353.1|BU887353 R058C06 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 569
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 94 atggcggcggcggcggcgtt 113
||||||||||||||||||||
Sbjct: 95 atggcggcggcggcggcgtt 76
>gb|CF231459.1|CF231459 PtaC0021F8F0812 Poplar cDNA library from cambial zone Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 630
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 94 atggcggcggcggcggcgtt 113
||||||||||||||||||||
Sbjct: 143 atggcggcggcggcggcgtt 124
>gb|CV247347.1|CV247347 WS01117.B21_N22 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01117_N22 3', mRNA sequence
Length = 682
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 92 tcatggcggcggcggcggcg 111
||||||||||||||||||||
Sbjct: 392 tcatggcggcggcggcggcg 373
>gb|CV247631.1|CV247631 WS01118.B21_N01 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01118_N01 3', mRNA sequence
Length = 687
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 92 tcatggcggcggcggcggcg 111
||||||||||||||||||||
Sbjct: 394 tcatggcggcggcggcggcg 375
>gb|CV248700.1|CV248700 WS01121.B21_K06 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01121_K06 3', mRNA sequence
Length = 704
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 92 tcatggcggcggcggcggcg 111
||||||||||||||||||||
Sbjct: 389 tcatggcggcggcggcggcg 370
>gb|DN492413.1|DN492413 X013H10.3pR Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA clone X013H10 3', mRNA sequence
Length = 637
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 94 atggcggcggcggcggcgtt 113
||||||||||||||||||||
Sbjct: 478 atggcggcggcggcggcgtt 497
>gb|DN502456.1|DN502456 X013H10.5pR Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA clone X013H10 5', mRNA sequence
Length = 274
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 94 atggcggcggcggcggcgtt 113
||||||||||||||||||||
Sbjct: 120 atggcggcggcggcggcgtt 101
>gb|DT494249.1|DT494249 WS01117.BR_N22 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01117_N22 5', mRNA sequence
Length = 678
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 92 tcatggcggcggcggcggcg 111
||||||||||||||||||||
Sbjct: 287 tcatggcggcggcggcggcg 306
>gb|DT494569.1|DT494569 WS01118.BR.1_N01 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01118_N01 5', mRNA sequence
Length = 685
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 92 tcatggcggcggcggcggcg 111
||||||||||||||||||||
Sbjct: 292 tcatggcggcggcggcggcg 311
>gb|DT495840.1|DT495840 WS01121.BR_K06 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01121_K06 5', mRNA sequence
Length = 676
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 92 tcatggcggcggcggcggcg 111
||||||||||||||||||||
Sbjct: 287 tcatggcggcggcggcggcg 306
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 101,151
Number of Sequences: 369679
Number of extensions: 101151
Number of successful extensions: 29040
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28996
Number of HSP's gapped (non-prelim): 29
length of query: 1225
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1206
effective length of database: 196,384,763
effective search space: 236840024178
effective search space used: 236840024178
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)